ID: 1107929307

View in Genome Browser
Species Human (GRCh38)
Location 13:45293841-45293863
Sequence CGGTAGCACTTGACACTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107929307_1107929312 26 Left 1107929307 13:45293841-45293863 CCTGACAGTGTCAAGTGCTACCG No data
Right 1107929312 13:45293890-45293912 CATGGTTCATGGAATGCCAAAGG No data
1107929307_1107929309 8 Left 1107929307 13:45293841-45293863 CCTGACAGTGTCAAGTGCTACCG No data
Right 1107929309 13:45293872-45293894 GAGCAACCAGAACGCACACATGG No data
1107929307_1107929311 15 Left 1107929307 13:45293841-45293863 CCTGACAGTGTCAAGTGCTACCG No data
Right 1107929311 13:45293879-45293901 CAGAACGCACACATGGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107929307 Original CRISPR CGGTAGCACTTGACACTGTC AGG (reversed) Intergenic
No off target data available for this crispr