ID: 1107929308

View in Genome Browser
Species Human (GRCh38)
Location 13:45293861-45293883
Sequence TTCTGGTTGCTCTGCATGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107929308_1107929314 21 Left 1107929308 13:45293861-45293883 CCGAGCATGCAGAGCAACCAGAA No data
Right 1107929314 13:45293905-45293927 GCCAAAGGATACCGGTTCTTTGG No data
1107929308_1107929313 13 Left 1107929308 13:45293861-45293883 CCGAGCATGCAGAGCAACCAGAA No data
Right 1107929313 13:45293897-45293919 CATGGAATGCCAAAGGATACCGG No data
1107929308_1107929311 -5 Left 1107929308 13:45293861-45293883 CCGAGCATGCAGAGCAACCAGAA No data
Right 1107929311 13:45293879-45293901 CAGAACGCACACATGGTTCATGG No data
1107929308_1107929312 6 Left 1107929308 13:45293861-45293883 CCGAGCATGCAGAGCAACCAGAA No data
Right 1107929312 13:45293890-45293912 CATGGTTCATGGAATGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107929308 Original CRISPR TTCTGGTTGCTCTGCATGCT CGG (reversed) Intergenic
No off target data available for this crispr