ID: 1107929311

View in Genome Browser
Species Human (GRCh38)
Location 13:45293879-45293901
Sequence CAGAACGCACACATGGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107929307_1107929311 15 Left 1107929307 13:45293841-45293863 CCTGACAGTGTCAAGTGCTACCG No data
Right 1107929311 13:45293879-45293901 CAGAACGCACACATGGTTCATGG No data
1107929308_1107929311 -5 Left 1107929308 13:45293861-45293883 CCGAGCATGCAGAGCAACCAGAA No data
Right 1107929311 13:45293879-45293901 CAGAACGCACACATGGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107929311 Original CRISPR CAGAACGCACACATGGTTCA TGG Intergenic
No off target data available for this crispr