ID: 1107931043

View in Genome Browser
Species Human (GRCh38)
Location 13:45307671-45307693
Sequence CTGTTGACAGAAATGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107931038_1107931043 -6 Left 1107931038 13:45307654-45307676 CCTGGGCGCTGCCTCTGCTGTTG No data
Right 1107931043 13:45307671-45307693 CTGTTGACAGAAATGGAGGGAGG No data
1107931030_1107931043 27 Left 1107931030 13:45307621-45307643 CCCAGCTACTTGGGAGGCCAAGG 0: 575
1: 6225
2: 109699
3: 315305
4: 471854
Right 1107931043 13:45307671-45307693 CTGTTGACAGAAATGGAGGGAGG No data
1107931037_1107931043 10 Left 1107931037 13:45307638-45307660 CCAAGGCAGGAGGATGCCTGGGC No data
Right 1107931043 13:45307671-45307693 CTGTTGACAGAAATGGAGGGAGG No data
1107931032_1107931043 26 Left 1107931032 13:45307622-45307644 CCAGCTACTTGGGAGGCCAAGGC 0: 422
1: 5059
2: 95082
3: 266494
4: 418506
Right 1107931043 13:45307671-45307693 CTGTTGACAGAAATGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107931043 Original CRISPR CTGTTGACAGAAATGGAGGG AGG Intergenic
No off target data available for this crispr