ID: 1107934353

View in Genome Browser
Species Human (GRCh38)
Location 13:45332483-45332505
Sequence ATGCATACATAAATGAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 820
Summary {0: 1, 1: 0, 2: 3, 3: 74, 4: 742}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107934350_1107934353 1 Left 1107934350 13:45332459-45332481 CCTCTGGACTCAGAGAAGAGTGG 0: 1
1: 0
2: 2
3: 31
4: 213
Right 1107934353 13:45332483-45332505 ATGCATACATAAATGAATGGAGG 0: 1
1: 0
2: 3
3: 74
4: 742
1107934347_1107934353 23 Left 1107934347 13:45332437-45332459 CCAGTTTGTGCTCCTTGCTCTAC 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1107934353 13:45332483-45332505 ATGCATACATAAATGAATGGAGG 0: 1
1: 0
2: 3
3: 74
4: 742
1107934349_1107934353 11 Left 1107934349 13:45332449-45332471 CCTTGCTCTACCTCTGGACTCAG 0: 1
1: 0
2: 3
3: 32
4: 353
Right 1107934353 13:45332483-45332505 ATGCATACATAAATGAATGGAGG 0: 1
1: 0
2: 3
3: 74
4: 742
1107934346_1107934353 24 Left 1107934346 13:45332436-45332458 CCCAGTTTGTGCTCCTTGCTCTA 0: 1
1: 0
2: 2
3: 12
4: 201
Right 1107934353 13:45332483-45332505 ATGCATACATAAATGAATGGAGG 0: 1
1: 0
2: 3
3: 74
4: 742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107934353 Original CRISPR ATGCATACATAAATGAATGG AGG Intergenic
900869239 1:5289973-5289995 ATGGATACATGGATGAATGGTGG + Intergenic
901006781 1:6175570-6175592 ATGGACAGATGAATGAATGGTGG + Intronic
901783826 1:11611621-11611643 ATGAATAAAGAAATGAATGCTGG + Intergenic
901888098 1:12238283-12238305 ATGTATACATACAGGCATGGTGG + Intronic
902006018 1:13232665-13232687 ATACATAAATAAATAAATGTAGG + Intergenic
902025321 1:13378966-13378988 ATACATAAATAAATAAATGTAGG - Intergenic
902046034 1:13525244-13525266 CTGCATACATAAAGGCATAGAGG + Intergenic
902772961 1:18656681-18656703 ATGCATGCATAAAAAAAAGGGGG + Intronic
903451888 1:23459274-23459296 ATGTTTACCTAAATGAATGATGG + Intronic
903718558 1:25387463-25387485 ATGAATATATGAATGAATGAGGG + Intronic
904247290 1:29196705-29196727 ATGAATAAATAAATGCATGCTGG + Intronic
906161345 1:43651061-43651083 AGGCATACAAAGATGAATAGGGG + Intronic
907197532 1:52698582-52698604 ATACATAGATAAATGACTGCAGG - Intergenic
907570827 1:55481986-55482008 ATGAATACATCAATAAATGCAGG + Intergenic
907774906 1:57504549-57504571 TTGGATACATAAATGAATGAGGG + Intronic
907980699 1:59477791-59477813 ATTTAAAGATAAATGAATGGGGG - Intronic
908011230 1:59779384-59779406 TTGAATAAATAAATAAATGGAGG - Intergenic
908026150 1:59953648-59953670 ATGGAGATCTAAATGAATGGAGG + Intergenic
909228467 1:73056571-73056593 ATGCACACATATGTGTATGGTGG - Intergenic
909553845 1:76930773-76930795 ATGAATACATGAATACATGGAGG - Intronic
909554412 1:76937572-76937594 ATGCACACATAAAGGAAGGATGG + Intronic
909817181 1:80010157-80010179 ATGCATACATACATAAAAGGGGG + Intergenic
909831485 1:80196829-80196851 ATGCATACATGAATGACCAGTGG - Intergenic
909977230 1:82059384-82059406 ATGCATGCATAAATGGAGGCTGG + Intergenic
911177793 1:94834451-94834473 TTGAATAAATAAATAAATGGGGG + Intronic
911730565 1:101288106-101288128 ATAAATAAATAAATAAATGGAGG + Intergenic
911922967 1:103790754-103790776 ATACATAAATGAATGAATGATGG - Intergenic
912004001 1:104872905-104872927 TTGAATACATAAATAAATAGAGG + Intergenic
912443970 1:109719526-109719548 GACAATACATAAATGAATGGTGG + Intronic
913197430 1:116469651-116469673 ATAAATAAATAAATAAATGGAGG - Intergenic
913429457 1:118774849-118774871 ATGAATAGATAAATGAAATGTGG - Intergenic
913502762 1:119487157-119487179 ATGCAAACAAAAATGTATGCTGG + Intergenic
913661192 1:121007739-121007761 ATGCATAAATAAATAAAAGAGGG + Intergenic
914012559 1:143790919-143790941 ATGCATAAATAAATAAAAGAGGG + Intergenic
914165273 1:145170264-145170286 ATGCATAAATAAATAAAAGAGGG - Intergenic
914651188 1:149699528-149699550 ATGCATAAATAAATAAAAGAGGG + Intergenic
914693814 1:150056756-150056778 CTGAATAAATAAATAAATGGGGG + Intergenic
915485200 1:156215535-156215557 ATAAATAAATAAATAAATGGGGG - Intronic
915664949 1:157435922-157435944 ATGCAAACAAAAATGCATGCTGG - Intergenic
915906681 1:159883296-159883318 ATGAATGAATGAATGAATGGGGG + Intronic
916782718 1:168053293-168053315 ATGCATACAGAAATAAAAGTTGG + Intronic
917243184 1:172971809-172971831 ATGGATAAATGGATGAATGGAGG - Intergenic
917334351 1:173912930-173912952 ATGTATACAAAAATGACTGAAGG + Intronic
917528832 1:175814811-175814833 ATGAAATCATATATGAATGGAGG + Intergenic
918228166 1:182505636-182505658 ATGAATACATGAATAAATGGAGG - Intronic
918465573 1:184818454-184818476 ATGAATAGACAGATGAATGGTGG + Intronic
918654303 1:187004951-187004973 ATGCAAACAAAAATGTATGCTGG - Intergenic
918769427 1:188535564-188535586 ATCCATACAAAAATTGATGGTGG - Intergenic
918844140 1:189586833-189586855 ATGCATTCATATATGAATGTAGG - Intergenic
918847952 1:189643384-189643406 ATGCATGCATAATTAAATGTAGG - Intergenic
920783438 1:209017009-209017031 GTGAATAAATAAATAAATGGGGG - Intergenic
921121850 1:212144178-212144200 TTGACTAAATAAATGAATGGCGG + Intergenic
921679745 1:218016670-218016692 ATGCAAACAAAAATGTATGCTGG - Intergenic
921704320 1:218304248-218304270 ATGCATTAATCAATGAATGCTGG - Intronic
922790944 1:228310688-228310710 ATGAATACATGAGTGGATGGGGG - Intronic
922792839 1:228319642-228319664 ATGGATGGATAGATGAATGGTGG - Intronic
922792879 1:228319847-228319869 ATGCATAGATGGATGGATGGTGG - Intronic
923070410 1:230559104-230559126 ATGAATGAATGAATGAATGGTGG - Intergenic
923098514 1:230794136-230794158 ATGTAGACAAAAATGAAAGGGGG + Intronic
923215212 1:231842742-231842764 TTGGTTACATAAATGAATGAGGG - Intronic
923247973 1:232151917-232151939 TTGTATAAATAAATAAATGGGGG - Intergenic
923828690 1:237529111-237529133 ATGAATAAATAAAGGAATGGAGG + Intronic
923968487 1:239171839-239171861 ATGAATACATAAATAAAATGTGG + Intergenic
924600657 1:245485864-245485886 ATGAATAAATAAATGAAGGAAGG + Intronic
924702679 1:246469645-246469667 ATAGATACATAAATAAATAGAGG + Intronic
924716064 1:246575331-246575353 ATGAATAGATAAATAAAAGGTGG + Intronic
1063062182 10:2567589-2567611 AGGCATACTAAAGTGAATGGTGG + Intergenic
1063234248 10:4096357-4096379 ATGGATGGATAAATGAATGGTGG + Intergenic
1063828563 10:9926178-9926200 ATGAATGAATGAATGAATGGAGG + Intergenic
1065496466 10:26333995-26334017 ATGCAAACAAAAATGTATGTCGG - Intergenic
1065860667 10:29870280-29870302 ATGGATACATGAATGGGTGGTGG - Intergenic
1065870848 10:29955341-29955363 ATACATACATAAATAAAGGGGGG + Intergenic
1066398700 10:35052549-35052571 ATGAATGAATAAATGAATAGTGG + Intronic
1066573410 10:36798928-36798950 ATGAATAAATGAATGAATGAGGG + Intergenic
1068487969 10:57683712-57683734 ATGAATAAATAAATGTATGAGGG + Intergenic
1068901457 10:62273811-62273833 ATGAATACATAACTAATTGGAGG + Intergenic
1069314914 10:67086120-67086142 ATGGATAGATAAATGGATGAAGG + Intronic
1069429531 10:68321866-68321888 AAGACTACATAAATAAATGGAGG + Intronic
1069515350 10:69072818-69072840 ATAAATAAATAAATGAATGAAGG + Intergenic
1069545896 10:69328448-69328470 ATGAATACAACAATGAATGTTGG - Intronic
1070125077 10:73614599-73614621 ATACATACATACACAAATGGTGG + Intronic
1070449882 10:76547490-76547512 ATAAATAAATAAATAAATGGCGG - Intronic
1071313696 10:84369916-84369938 AAGCATACATAAATGAAAATTGG - Intronic
1071421744 10:85507144-85507166 ATGAATAAATAAATGAATTATGG - Intergenic
1071463869 10:85922419-85922441 ACACATACATAAATAATTGGTGG - Intronic
1072148110 10:92661115-92661137 ATACATACATATATGTATGTAGG + Intergenic
1072692620 10:97581804-97581826 ATAAATAAATAAATGAATGAGGG - Intronic
1073738265 10:106376034-106376056 ATGCAAACAAAAATGTATGCTGG - Intergenic
1074199020 10:111215872-111215894 AAGAAGACATAAATGACTGGAGG - Intergenic
1074227444 10:111499222-111499244 ATGCATACATTAATAAAAGATGG + Intergenic
1074442495 10:113490912-113490934 ATGCATAGAAAAAAGACTGGAGG - Intergenic
1074673070 10:115817524-115817546 ATGCATACATATATGACAGAAGG + Intronic
1074757602 10:116636665-116636687 TTGCATAGGTAAATGAAAGGTGG + Intronic
1075077605 10:119361400-119361422 ATGGATGAATGAATGAATGGTGG - Intronic
1075127630 10:119713379-119713401 ATAAATAAATAAATAAATGGAGG - Intergenic
1075399766 10:122152362-122152384 AAGCAAACACAAATGAAAGGGGG + Intronic
1076039840 10:127236795-127236817 CTGGCTACATAAATGAATGGTGG - Intronic
1076378416 10:130008645-130008667 ATGCATGAATAAAGGAATTGTGG + Intergenic
1077821114 11:5741596-5741618 ATGAATGCACAAATGAGTGGGGG + Intronic
1078657308 11:13253704-13253726 ATGAATGAATAAATGAAAGGGGG + Intergenic
1078663910 11:13308858-13308880 ATGAACACACAAATGAATGAAGG - Intronic
1078877586 11:15413601-15413623 ATTCATATAAAAATGCATGGGGG + Intergenic
1079248280 11:18769281-18769303 ATGCATACATCAATTAAAGCAGG - Intronic
1079339653 11:19601521-19601543 ATGGATAAATAAATGAATAAAGG - Intronic
1079554102 11:21738411-21738433 ATGAATGAATAAATGAATGATGG + Intergenic
1079631277 11:22679416-22679438 ATGCATATATAAATAAATCTTGG + Intronic
1079704971 11:23604036-23604058 ATGAATAGATAAATGAATGAAGG - Intergenic
1079829930 11:25251112-25251134 AAGCCAACATAAATGAATTGGGG + Intergenic
1080023714 11:27591793-27591815 ATAAATACATAAATGAAATGTGG + Intergenic
1080942956 11:36939737-36939759 ATTAATGCATAAATGAATGAAGG - Intergenic
1080943189 11:36942429-36942451 ATGAATAAATGAATGAATGCTGG - Intergenic
1080955229 11:37085873-37085895 TTGAATAAATAAATGAATGAGGG - Intergenic
1081229654 11:40569216-40569238 ATGCATAAATTAATGAATAAAGG + Intronic
1081466584 11:43324661-43324683 ATAAATAAATAAATGAATTGTGG - Intronic
1081969734 11:47189372-47189394 ATGCATAAATAAACAAATGAAGG - Intergenic
1081984415 11:47291098-47291120 ATGCAGACGTAAATAAAAGGAGG - Intronic
1082560118 11:54609036-54609058 TTAAATACATAAATAAATGGAGG - Intergenic
1082906776 11:58316424-58316446 ATAATTACATAAATGAATGAGGG - Intergenic
1083312968 11:61794848-61794870 TTGCAAACATATCTGAATGGAGG - Intronic
1083471297 11:62885885-62885907 AGGAATGAATAAATGAATGGTGG - Intronic
1083705833 11:64514563-64514585 TTGAATAAATAAATAAATGGGGG + Intergenic
1083746216 11:64738050-64738072 ATAAATAAATAAATGAATTGGGG + Intronic
1084705135 11:70811707-70811729 ATGGATGGATAAATGAATGGTGG - Intronic
1084705155 11:70811821-70811843 ATGCATGGATGAATGAATGGTGG - Intronic
1085020684 11:73204991-73205013 ATGAATGGATAAATGAATGTGGG - Intergenic
1085655578 11:78311690-78311712 ATGAATAAACAAATGCATGGAGG - Intronic
1085776740 11:79373350-79373372 ATGGATCGATAAATGAATGAAGG + Intronic
1085963548 11:81493524-81493546 GTGTATACATAAAGGAATTGAGG - Intergenic
1086333294 11:85775475-85775497 ATAAATAAATAAATAAATGGGGG - Intronic
1086401987 11:86468373-86468395 ATGGATGGATAAATGAATGATGG - Intronic
1086511118 11:87559178-87559200 ATATTTAAATAAATGAATGGTGG + Intergenic
1086627340 11:88972521-88972543 ATGGATACATATATAAATTGGGG + Intronic
1086730606 11:90244388-90244410 AGCCAAACATAAATGTATGGTGG - Intergenic
1087048039 11:93860634-93860656 ATGCAAACAGAAATGTATGCTGG - Intergenic
1087533999 11:99420614-99420636 ATGCTTACATAATTGAGTTGTGG + Intronic
1087617911 11:100509445-100509467 GTGAATGAATAAATGAATGGAGG + Intergenic
1087632360 11:100665171-100665193 ATACATAAATAAATGAAAGAAGG - Intergenic
1088010167 11:104991115-104991137 ATAGCTACATATATGAATGGAGG + Intergenic
1088166073 11:106939246-106939268 ATGCTGAAATAAATTAATGGAGG + Intronic
1088323368 11:108576191-108576213 ATGAATAGATAAATAAATTGTGG + Intronic
1089093137 11:115895305-115895327 ATGGATGGATAAATGAGTGGTGG - Intergenic
1089736029 11:120550723-120550745 AAGCATACAGACATGAGTGGAGG + Intronic
1089936866 11:122373515-122373537 ATGCATACATAAATAAAATGTGG - Intergenic
1090448315 11:126783660-126783682 ATACAGAAATAAATAAATGGAGG + Intronic
1090929870 11:131287602-131287624 ATGAATAAGTAAATGAATGTTGG + Intergenic
1091367634 11:135035750-135035772 ATGGATGCATAGATGGATGGAGG + Intergenic
1091791045 12:3272373-3272395 ATGAATAAATGAATGAATGATGG - Intronic
1092470915 12:8779881-8779903 ATACATACATAAAAGAATTAGGG - Intronic
1092509702 12:9142436-9142458 ATGCAAACAAAAATGTATGCTGG + Intergenic
1093682251 12:22016025-22016047 ATGAATAAATGAATGAATGCTGG - Intergenic
1094193463 12:27720598-27720620 ATATATACATAAATAAATGAGGG - Intronic
1094349793 12:29511436-29511458 ATGAATGAATAAATGAATGATGG + Intronic
1094467918 12:30773553-30773575 ATGCAAACAAAAATGTATGCTGG - Intergenic
1095760513 12:45829190-45829212 ATCTATACATATATGATTGGTGG - Intronic
1096659047 12:53111694-53111716 ATGCAAACAAAAATGTATGCTGG + Intronic
1097026125 12:56056960-56056982 ATGCATGCATGCATGTATGGGGG + Intergenic
1097526528 12:60744127-60744149 ATGTAAAATTAAATGAATGGCGG - Intergenic
1097652082 12:62311499-62311521 CCGTAAACATAAATGAATGGGGG + Intronic
1097742531 12:63260890-63260912 ATGAATGAATGAATGAATGGAGG + Intergenic
1097829907 12:64213349-64213371 ATGCATACACAAAAGAATATGGG + Intronic
1098315505 12:69188325-69188347 ATGCAAACAAAAATGTATGCTGG - Intergenic
1098982165 12:76968328-76968350 CTGAATATATAAATGAATGTAGG + Intergenic
1099394280 12:82118890-82118912 ATGCATGAATGACTGAATGGTGG + Intergenic
1099480139 12:83155728-83155750 ATGCATACATATGTTTATGGCGG + Intergenic
1099567163 12:84266395-84266417 ATACATACATATATACATGGAGG + Intergenic
1099567170 12:84266585-84266607 ATGGACATTTAAATGAATGGGGG + Intergenic
1099692333 12:85973288-85973310 ATGCATATATAAAGCAATAGAGG - Exonic
1100225386 12:92551118-92551140 ATGCATACATCAGTGAAGGAAGG + Intergenic
1100359709 12:93864985-93865007 ATGAATAAACAAATGAATGAGGG + Intronic
1100866024 12:98857655-98857677 ATGAATGAATAAATGAATGAAGG + Intronic
1101174601 12:102136389-102136411 AGTCATAAATAAATGAAAGGAGG - Intronic
1101248101 12:102904026-102904048 ATGCATAAATAATTGAAAGTTGG + Intronic
1101338222 12:103815986-103816008 ATACATACATAGAAGAATGTTGG - Intronic
1101377089 12:104180631-104180653 ATGCATAAGTAAATGAAAGAAGG - Intergenic
1101643655 12:106607771-106607793 ATGAATGAATGAATGAATGGTGG + Intronic
1101782889 12:107851250-107851272 ATGCAAACAAAAATGTATGCTGG - Intergenic
1101873190 12:108582026-108582048 ATGCATGAATGAATGAATGGGGG - Intergenic
1102222956 12:111206947-111206969 ATGAATGCATAAATGGATGGTGG + Intronic
1102222969 12:111207042-111207064 ATGAATGGATAAATGGATGGTGG + Intronic
1102402207 12:112639454-112639476 ATGGATACATGAAGGGATGGGGG + Intronic
1102968600 12:117148298-117148320 GTGCAGAGATAAATGTATGGAGG + Intronic
1103064166 12:117883056-117883078 ATGGATGGATAGATGAATGGAGG - Intronic
1103173116 12:118839036-118839058 ATGAATGAATGAATGAATGGAGG + Intergenic
1104766135 12:131331374-131331396 ATGGATGGATAGATGAATGGGGG - Intergenic
1106586323 13:31059263-31059285 ATGCATGCATGAATAAATGGGGG + Intergenic
1106593093 13:31114638-31114660 GAGCATTCATAAATCAATGGAGG - Intergenic
1107015344 13:35704439-35704461 TTGGATAAATAAATAAATGGGGG - Intergenic
1107602434 13:42027396-42027418 ATGCCTAGAGAAAGGAATGGAGG - Intergenic
1107934353 13:45332483-45332505 ATGCATACATAAATGAATGGAGG + Intergenic
1108509436 13:51141944-51141966 ATGCAAACAAAAATGTATGCTGG - Intergenic
1108637153 13:52346660-52346682 ATAAATACATAAATAAATGGGGG + Intergenic
1108796587 13:54039057-54039079 ATGCACACATAAATTTATTGTGG + Intergenic
1109660204 13:65447754-65447776 ATGAATACATAAATAAAATGTGG + Intergenic
1109730914 13:66412537-66412559 ATGTATACATAAATAAAAAGTGG - Intronic
1109799711 13:67360877-67360899 ATGCATACCTAATAGAATTGTGG - Intergenic
1110304033 13:73964328-73964350 ATGCAAAGATCAATGAATTGTGG - Intronic
1111774382 13:92640888-92640910 ATGCATACATAAATAAGCAGAGG + Intronic
1111856529 13:93644794-93644816 ATAAATAAATAAATAAATGGTGG + Intronic
1112140350 13:96634502-96634524 ATATATAAATGAATGAATGGAGG - Intronic
1112413544 13:99185366-99185388 ATGCAAACAAAAATGTATGCTGG + Intergenic
1112445911 13:99464116-99464138 ATAGATAGATAGATGAATGGTGG - Intergenic
1112685369 13:101818883-101818905 ATGCATAGATGAACGAATGTTGG - Intronic
1112744726 13:102513934-102513956 TTGAATAAATAAATAAATGGAGG + Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112921096 13:104613869-104613891 ATGAATGAATAAATAAATGGGGG - Intergenic
1113072890 13:106438732-106438754 ATGGATATATGAATGAATGGAGG + Intergenic
1113072928 13:106438915-106438937 ATGGATATATGAATGAATGGAGG + Intergenic
1113243205 13:108363478-108363500 ATGAGTAAATAAATAAATGGTGG - Intergenic
1113780227 13:112972544-112972566 ATGGATAAATAGATAAATGGAGG + Intronic
1114256369 14:21005091-21005113 ATGCAAACAAAAATGTATGCTGG - Intergenic
1114848735 14:26356597-26356619 ATTGATAAATAATTGAATGGAGG + Intergenic
1114906055 14:27127948-27127970 ATGCATACGGAAGGGAATGGTGG + Intergenic
1115508997 14:34121244-34121266 ATGCATAGAAAGATGACTGGAGG - Intronic
1115553439 14:34525145-34525167 CTGAATAAATAAATAAATGGAGG + Intronic
1116169635 14:41383649-41383671 ATGCATACATTAACAAATGCAGG - Intergenic
1116450690 14:45061350-45061372 ATGCATACAGATTTGAAAGGAGG - Intronic
1116571328 14:46519811-46519833 CTGGATCCCTAAATGAATGGAGG - Intergenic
1116599232 14:46898091-46898113 ATGAAAAGATAAATGCATGGAGG + Intronic
1116856419 14:49956137-49956159 ATGAATAAATGAATGAATGGAGG - Intergenic
1117012306 14:51483393-51483415 ATGTGTTCAAAAATGAATGGGGG + Intergenic
1118015337 14:61654943-61654965 ATGAATGAATGAATGAATGGAGG + Intronic
1118181087 14:63494225-63494247 ATAAATAAATAAATAAATGGCGG - Intronic
1118230517 14:63944302-63944324 ATATATAAATAAATAAATGGAGG + Intronic
1118631756 14:67711350-67711372 ATGCAAACAAAAATGTATGCTGG + Intronic
1118979708 14:70706627-70706649 ATGAATGAATAAATGAATTGAGG + Intergenic
1119120827 14:72075318-72075340 ATGAATAAATAAATGAATATAGG - Intronic
1119191905 14:72688669-72688691 ACACATACATGAATGAAGGGAGG - Intronic
1119191907 14:72688673-72688695 ATGTACACATACATGAATGAAGG - Intronic
1120719363 14:87873618-87873640 ATGAATACATGAATAAATGAAGG + Intronic
1121580706 14:95027471-95027493 ATGAACAAATGAATGAATGGAGG + Intergenic
1121756074 14:96403138-96403160 ATAAATAAATAAATAAATGGAGG + Intronic
1121853590 14:97246281-97246303 ATGAACAGATAAATGAATGGTGG - Intergenic
1122274266 14:100583387-100583409 ATGGATACATAAATGGATACAGG - Intronic
1122434238 14:101682342-101682364 ATGCAAACAAAAATGTATGCTGG + Intergenic
1124015696 15:25872859-25872881 ATACATACATAAATGGATATAGG - Intergenic
1124427315 15:29572465-29572487 ATGAATGAATGAATGAATGGGGG - Intergenic
1124679526 15:31718415-31718437 ATGAATAGAGAAATAAATGGGGG - Intronic
1124876237 15:33597239-33597261 ATGCAAACAAAAATGTATGCTGG + Intronic
1125683886 15:41551027-41551049 ATTAATAAATAAATCAATGGGGG - Intergenic
1125795799 15:42403135-42403157 ATGGATGAATGAATGAATGGGGG - Intronic
1126428096 15:48550975-48550997 ATGAATGAATGAATGAATGGAGG + Intronic
1126481450 15:49126013-49126035 ATGCATACATATTTGAATACAGG + Intronic
1126921075 15:53525448-53525470 ATGAATAAATGAATGAATGGAGG - Intronic
1126925283 15:53578485-53578507 ATAAATAAATAAATGAATGATGG + Intronic
1127338734 15:58018339-58018361 ATGAATAAATAAATAAATGTGGG + Intronic
1127342101 15:58057854-58057876 ATGAATACATAAATTCAGGGAGG + Intronic
1127607101 15:60597444-60597466 ATGGGGACATAAAGGAATGGAGG - Intronic
1127810678 15:62562526-62562548 ATAAATAAATAAATAAATGGAGG - Intronic
1128593618 15:68925166-68925188 ATGGATGGATAAATGCATGGAGG + Intronic
1128734126 15:70042729-70042751 ATGGATGGATAGATGAATGGGGG - Intergenic
1128841196 15:70853248-70853270 ATGCAAACATAAAGGTCTGGTGG + Intronic
1128900083 15:71412500-71412522 ATACATACGTAGATGAAAGGAGG - Intronic
1129254250 15:74325144-74325166 ATGGACAGAGAAATGAATGGAGG - Intronic
1130364879 15:83225920-83225942 AGGAATAGATAAATCAATGGAGG - Intergenic
1130393180 15:83477715-83477737 ATGCATACTTAAAGAAATGTGGG + Intronic
1130905044 15:88234296-88234318 ATGCATGCATCAATCAATGAAGG - Intronic
1131742107 15:95403963-95403985 ATACATACATAAAATAATTGGGG - Intergenic
1131794429 15:95999856-95999878 ATGAACAGATAAATGAATGGGGG + Intergenic
1132308984 15:100842376-100842398 ATGCACAAATAAAGGCATGGAGG - Intergenic
1133007153 16:2890185-2890207 ACGCACACAAAAATGAATGTGGG - Intronic
1133407001 16:5532599-5532621 ATGGATGAATAAATGAATTGTGG + Intergenic
1133417433 16:5617129-5617151 GTGCATTCATGAATGAATGAGGG - Intergenic
1133841937 16:9417853-9417875 ATGGATAGATGGATGAATGGAGG + Intergenic
1133965928 16:10531773-10531795 ATGAATGAATGAATGAATGGTGG + Exonic
1134848589 16:17461680-17461702 ATGCATGCATAAATAGATGGAGG + Intronic
1135086461 16:19478491-19478513 ATGGATGGATAAATGAATGATGG - Intronic
1135157044 16:20061395-20061417 ATGGATAGATGAATGGATGGGGG + Intronic
1135187364 16:20326945-20326967 ATGAATAAATAAATCAATGGGGG + Intronic
1135283284 16:21171509-21171531 ATGCATGAATGAATGGATGGAGG + Intronic
1135433910 16:22411961-22411983 GTTCATAAATAAAAGAATGGAGG - Intronic
1135538601 16:23313141-23313163 ATGAATAAATGAATGAATGATGG + Intronic
1135792956 16:25414860-25414882 ATAAATAGATGAATGAATGGAGG + Intergenic
1136024133 16:27459184-27459206 ATGCACAGATGAATGGATGGTGG + Intergenic
1137354251 16:47744095-47744117 TTGAATAAATAAATGATTGGGGG - Intergenic
1137520650 16:49192537-49192559 AAGAATAGATAAATAAATGGTGG + Intergenic
1137569442 16:49555752-49555774 GTGAATAAATAAATGGATGGAGG + Intronic
1137596719 16:49728713-49728735 ATAAATAAATAAAAGAATGGTGG - Intronic
1137748823 16:50842978-50843000 ATGAATAAATGAATGAATGAAGG + Intergenic
1138033775 16:53581785-53581807 ATGTACACATAAATGAAAGATGG - Intergenic
1139074468 16:63427268-63427290 GTGAATAAATAAATGAAGGGAGG + Intergenic
1139092360 16:63663579-63663601 ATGAATGAATGAATGAATGGTGG + Intergenic
1139414262 16:66794423-66794445 AGGCATACAGAAGGGAATGGAGG - Intronic
1139739220 16:69020883-69020905 ATACATACATATATAAAGGGGGG - Intronic
1139951185 16:70671501-70671523 TTGAATATATAAATAAATGGGGG + Intronic
1140458821 16:75121887-75121909 ATGCAAACAAAAATGTATGCTGG - Intergenic
1140816574 16:78626783-78626805 ATGATTAAATAAATAAATGGGGG - Intronic
1141029226 16:80573294-80573316 ATGCATGAATGAATGAAAGGAGG + Intergenic
1141096765 16:81168427-81168449 ATGGATGGATAAATGAAGGGTGG + Intergenic
1141110236 16:81265856-81265878 ATGGATAGATGGATGAATGGTGG - Intronic
1141314301 16:82946204-82946226 ATGGATACATGGATGAATGGAGG + Intronic
1141377663 16:83546918-83546940 ATGCAGAAATGAATGAATGAAGG + Intronic
1141854953 16:86674403-86674425 ATGGATGGATAAATGAATGAAGG - Intergenic
1142148374 16:88502061-88502083 ATAAATAAATAAATAAATGGGGG - Intronic
1142152395 16:88518436-88518458 ATGCATGGATAGATGGATGGTGG + Intronic
1143712298 17:8743326-8743348 ATGCATGGATGAATGAATGAAGG - Intronic
1143714017 17:8754157-8754179 ATGAATACATGAATGAATGAAGG + Intronic
1144589877 17:16514987-16515009 ATAAATAAATAAATGAAAGGAGG - Intergenic
1145227200 17:21139719-21139741 ATGCAAGCAAAAATGAATGCTGG + Intronic
1145271587 17:21407628-21407650 ATGGGTAGATGAATGAATGGAGG - Intronic
1145309799 17:21695072-21695094 ATGGGTAGATGAATGAATGGAGG - Intronic
1146683860 17:34827316-34827338 ATGAATACATAAATTCATGCCGG - Intergenic
1146742657 17:35300149-35300171 ATGCAAACAAAAATGTATGCTGG - Intergenic
1147515280 17:41110894-41110916 ATGCAAACAAAAATGCATGCTGG - Intergenic
1147534560 17:41311060-41311082 ATGAATTAATAAATGAAGGGAGG - Intergenic
1147851506 17:43446993-43447015 ATGAATAGATAAATGAAATGTGG - Intergenic
1148281251 17:46349209-46349231 ATAGTTACAGAAATGAATGGTGG + Intronic
1148303479 17:46567144-46567166 ATAGTTACAGAAATGAATGGTGG + Intronic
1148763700 17:50024143-50024165 ATGCATGCATATATGTATGTAGG + Intergenic
1149508885 17:57220647-57220669 ATGGATACATAAATAAACTGTGG + Intergenic
1149634080 17:58152625-58152647 AAGCATATAAAAATGTATGGGGG + Intergenic
1150459814 17:65340296-65340318 TTGCATAAATAATTGAATGGGGG + Intergenic
1150924788 17:69521671-69521693 ATGAATAAATGGATGAATGGGGG - Intronic
1152240940 17:79160647-79160669 ATGAATGAATGAATGAATGGGGG - Intronic
1152984637 18:310692-310714 ATGCATGAATGAATGAATGGGGG - Intergenic
1153066789 18:1054378-1054400 ATGCATACATATATGACTACAGG - Intergenic
1153140225 18:1963812-1963834 ATCCATACCTAAAAGAATGCTGG - Intergenic
1153172577 18:2333013-2333035 ATGCATGCATTAATGACTTGTGG - Intergenic
1153369288 18:4295572-4295594 ACACATACAAAAATAAATGGAGG + Intronic
1153431304 18:5020059-5020081 ATACATGAATAAATGAATGAAGG + Intergenic
1153725653 18:7952068-7952090 ATGCATATATACATGCATTGTGG - Intronic
1153920861 18:9788664-9788686 ATCCATCAACAAATGAATGGAGG + Intronic
1154304716 18:13222189-13222211 ATGAGTAAATAAATGGATGGGGG - Intronic
1155151128 18:23123815-23123837 ATGAATAAATACATAAATGGAGG + Intergenic
1155676395 18:28434452-28434474 TTGAATAAATAAATAAATGGGGG - Intergenic
1155752751 18:29449138-29449160 ATAAATAAATAAATAAATGGGGG - Intergenic
1156250264 18:35345525-35345547 TTGAATAAATAAATGAATTGTGG + Intergenic
1156471614 18:37380602-37380624 ATGAATAGATGGATGAATGGTGG - Intronic
1156471651 18:37380843-37380865 ATGGATGGATAAATGGATGGAGG - Intronic
1156625698 18:38905421-38905443 GTGCATATATAAAAGAATGAAGG - Intergenic
1156789914 18:40958689-40958711 ATGCAAACAGGAATGAATTGAGG + Intergenic
1156954071 18:42940096-42940118 CTGCATAAACAAATGCATGGGGG - Intronic
1157458103 18:47855981-47856003 ATGAATAAATAAAGAAATGGAGG + Intronic
1157640656 18:49210324-49210346 ATGAATAAATAAATAAACGGTGG + Intronic
1157691850 18:49689687-49689709 ATGAATACAGAAATTAATAGAGG + Intergenic
1157839657 18:50944823-50944845 ATTTATAAATAAATGAATGAAGG - Intronic
1157955142 18:52088547-52088569 ATGCCTACATTTATGCATGGTGG - Intergenic
1158007500 18:52689782-52689804 ATGCATACATAAGTGATTGAAGG - Intronic
1158142266 18:54268391-54268413 ATACATACATACAGGCATGGAGG + Intergenic
1158309834 18:56145865-56145887 ATGCATACATAGATACATGCAGG - Intergenic
1159330030 18:66980736-66980758 TTGAATAAATAAATAAATGGGGG - Intergenic
1159701186 18:71630203-71630225 CTACATTCATAAATTAATGGGGG + Intergenic
1159726768 18:71970503-71970525 TTGAATACATAAATAAATGAAGG + Intergenic
1160624803 18:80196159-80196181 ATGTAGACATACATCAATGGTGG - Intronic
1161364534 19:3870581-3870603 ATGAATAAACAAATAAATGGAGG + Intergenic
1161433846 19:4250276-4250298 ATGAATAAATGAATGAATGAGGG - Intronic
1161622795 19:5308076-5308098 ATGCAGAGAAAAATGCATGGTGG - Intronic
1161866767 19:6838481-6838503 ATACATAGATAAATGATAGGTGG - Intronic
1161934599 19:7363919-7363941 ATGGATAAATAAAAGAATGAAGG + Intronic
1161934620 19:7364035-7364057 ATGGATAAATGAATGAATGAAGG + Intronic
1162320312 19:9967801-9967823 ATGAATAAATAAATAAATGAAGG + Intronic
1162891522 19:13736610-13736632 ATGAATCAATAAATGAATGAGGG - Intronic
1163033018 19:14556650-14556672 ATGAATGGATAAATGAATGCAGG + Intronic
1163780840 19:19247066-19247088 ATAAATACATGAATAAATGGGGG - Intronic
1164522034 19:28986844-28986866 CTGAATACATAAATAAATGAGGG + Intergenic
1164649444 19:29881440-29881462 ATGCAGAAATAAGAGAATGGGGG + Intergenic
1165559228 19:36664905-36664927 ATACATACATAAATTATTAGTGG + Intronic
1165678150 19:37746347-37746369 ATAGATACAGAAATAAATGGTGG + Intronic
1165777244 19:38411882-38411904 ATGAATGAATAAATGAATGTGGG + Intronic
1167412787 19:49355035-49355057 ATACATACATACATAAATGGGGG + Intronic
1167844270 19:52147904-52147926 ATGCAAACAAAAATGTATGCTGG - Intergenic
1168438788 19:56345116-56345138 ATGCAAACAAAAATGTATGCTGG + Intronic
1168520245 19:57044512-57044534 ATGGATAGATGAATGAATGATGG + Intergenic
925260169 2:2521912-2521934 ATGGGTAGATAAATGGATGGAGG - Intergenic
925558611 2:5162327-5162349 ATGAATGAATAAATGAATTGTGG + Intergenic
925777025 2:7345806-7345828 ATGGATGGATAGATGAATGGTGG + Intergenic
926378465 2:12259868-12259890 ATGAATGAATAAATGAATGAGGG + Intergenic
926421050 2:12699758-12699780 ATGAATAAGTAAATGGATGGAGG + Intergenic
926440670 2:12885216-12885238 AGGAATGCATAAATGACTGGAGG - Intergenic
927396959 2:22663288-22663310 GTGAATAAATAAATGAATGTGGG + Intergenic
927855693 2:26526347-26526369 ATGAATTGATAAATGGATGGAGG + Intronic
928133500 2:28670597-28670619 ATACATACATACATAAATGAAGG + Intergenic
928226437 2:29452560-29452582 ATGCATAATAAAATCAATGGAGG + Intronic
928576826 2:32663629-32663651 ATACATACATACATAAATAGGGG - Intronic
928718724 2:34094681-34094703 ATGAACACAAAAATCAATGGAGG - Intergenic
928835070 2:35533823-35533845 GTGAATACATAAATGAAATGTGG + Intergenic
929035336 2:37685742-37685764 TTGAATAAATAAATCAATGGGGG + Intronic
929609921 2:43263364-43263386 ATGCATACAGAAATATATGCTGG + Intronic
929725139 2:44417430-44417452 ATGAATACATAAATGAATTGTGG - Intronic
929874317 2:45783917-45783939 ATGAAGAAAGAAATGAATGGAGG - Intronic
930084474 2:47484809-47484831 ATGAATGCATAAATGAAACGTGG + Intronic
930360140 2:50367532-50367554 ATTCAGAAATAAATGATTGGGGG + Intronic
930568291 2:53051160-53051182 TTGAATATATAAATGTATGGAGG + Intergenic
931035874 2:58242280-58242302 ATGCTTACAGAAAAGAATGCTGG + Intergenic
931110499 2:59105548-59105570 ATTCATACAGAAAAGAAGGGTGG - Intergenic
931250943 2:60530056-60530078 ATGCATTCATATATGAATGTTGG - Intronic
931593181 2:63909309-63909331 ATGAATGAATAAATGAATGGTGG + Intronic
931858856 2:66332756-66332778 ATGGATGAATAAATGAATGATGG + Intergenic
931942873 2:67272392-67272414 ATGCATAAATGAATGAATACGGG - Intergenic
932232989 2:70097697-70097719 ATGCATACAACAAAGAATAGAGG - Intergenic
932819805 2:74889760-74889782 ATGCATACCTACATATATGGGGG - Intronic
932863288 2:75316577-75316599 ATAAATAAATAAATAAATGGAGG + Intergenic
933191003 2:79333563-79333585 ATGCATACAGGAATAAATGTTGG - Intronic
933296807 2:80500325-80500347 ATGAATGAATAAATGGATGGTGG - Intronic
933460635 2:82579426-82579448 AAACATAATTAAATGAATGGTGG - Intergenic
933486521 2:82931644-82931666 ATGCATACACAGATGAAAAGAGG - Intergenic
933551309 2:83780583-83780605 AAGCAGAAATAAATGAATGGAGG - Intergenic
933596384 2:84287657-84287679 ATGAATGAATAAATGAATGGAGG + Intergenic
934786287 2:97009982-97010004 TTGCATAGATGAAAGAATGGAGG - Intronic
935264079 2:101380065-101380087 ATGAATAGATAGATGAATGATGG - Intronic
935534415 2:104277106-104277128 ATGCATACAAAAATATATAGGGG + Intergenic
935635192 2:105244469-105244491 ATGGATGAATAAATGAATGCAGG - Intergenic
935841175 2:107112418-107112440 ATGATTAAATAAATAAATGGGGG + Intergenic
936490493 2:112967514-112967536 ATAGTTACATAAATAAATGGGGG - Intergenic
936631123 2:114204018-114204040 ATGAATATATAAATGATTGTAGG + Intergenic
937122420 2:119450089-119450111 ATAAATAAATAAATAAATGGAGG + Intronic
937147158 2:119657209-119657231 ATTCATAGAAAAATGAGTGGAGG - Intronic
937565240 2:123277602-123277624 ATGCATACATTAAGAATTGGGGG + Intergenic
937614890 2:123910268-123910290 ATGAATGAATAAATGAGTGGTGG - Intergenic
937819853 2:126297604-126297626 ATGCTGACATAAATAAATGTGGG + Intergenic
938581700 2:132652294-132652316 ATGAATGAATAAATGAAGGGAGG + Intronic
938631829 2:133176024-133176046 ATGCATCCATAAATCAATCTGGG + Intronic
939310776 2:140472228-140472250 ATGAATGAATAAATGAATGATGG + Intronic
940438179 2:153680143-153680165 ATGAATAAATAAATGAATATAGG + Intergenic
940480542 2:154224612-154224634 ATAAATACAAAAATAAATGGAGG + Intronic
940535571 2:154937262-154937284 ATGAATAAATAAATGAAATGTGG - Intergenic
940626386 2:156180611-156180633 ATGCACAAATAAATGAAGAGGGG + Intergenic
941184087 2:162299382-162299404 AAGCAGACATGAAAGAATGGAGG + Intronic
941388880 2:164887022-164887044 ATGCATAGAAAAATGACTGGAGG + Intergenic
942028720 2:171936882-171936904 ATGCAGACATAAATGGATTCTGG - Intronic
942228739 2:173839852-173839874 TTGAATAAATAAATAAATGGAGG - Intergenic
942536055 2:176965527-176965549 ATGCATACATAAAATAATAATGG - Intergenic
942555133 2:177164982-177165004 ATGCATCCTTAAATGATTCGTGG + Intergenic
942980226 2:182071690-182071712 ATGAACAGATAAATCAATGGAGG - Intronic
942982153 2:182095464-182095486 AGGGATACAATAATGAATGGTGG - Intronic
942996983 2:182274705-182274727 ATTCATACATACATGAAAGAAGG - Intronic
943079729 2:183244113-183244135 ATTTATACATAGATGAATGCTGG - Intergenic
943514963 2:188873899-188873921 ATGTATACATAGATGAAGTGGGG - Intergenic
943666366 2:190613532-190613554 ATGCAAACAAAAATGTATGCTGG + Intergenic
944006420 2:194913495-194913517 ATAATTACATAAATGTATGGTGG - Intergenic
944165672 2:196717450-196717472 ATCCACACATAGATGAATGAAGG + Intronic
944201884 2:197116534-197116556 AAGCAGACAAAAAAGAATGGGGG - Intronic
944524180 2:200601468-200601490 ATGAATAAATAAATAAATGATGG + Intronic
945204918 2:207321075-207321097 TTGAATAAATAAATAAATGGGGG + Intergenic
945257711 2:207815937-207815959 ATACATACATACATAAATGTAGG - Intergenic
945765137 2:213966871-213966893 ATGCTTCCCTTAATGAATGGAGG - Intronic
946096253 2:217276996-217277018 CTGGATAAATAAATAAATGGGGG - Intergenic
946366733 2:219253385-219253407 ATGCATACACAGAGGAAAGGGGG + Intronic
946408108 2:219502945-219502967 ATACATACATAAATAAATAAAGG - Intronic
946843324 2:223838217-223838239 ATAAATAAATAAATAAATGGGGG - Intergenic
947037595 2:225876733-225876755 TTGAATACATAAATGAATTAAGG + Intergenic
947287664 2:228534567-228534589 ATGCAAACAAAAATGTATGCTGG - Intergenic
947341198 2:229141623-229141645 ATGCATTCATCAATCAATGTGGG + Intronic
947455004 2:230246018-230246040 ATGAATACATGAATAGATGGGGG - Intronic
948285483 2:236781388-236781410 ATGCCTACAAAAATGAATTTTGG - Intergenic
949029410 2:241784472-241784494 ATGCAAACAAAAATGGATGCTGG + Intronic
1168865712 20:1084717-1084739 ATGAATGAATAAATGAATGATGG + Intergenic
1168999705 20:2159497-2159519 ATGCATGGATAAAAGAATTGTGG + Intronic
1169492745 20:6084999-6085021 ATGCAAACAGAAATAAAAGGAGG - Intronic
1169548584 20:6677235-6677257 ATGATTACATGAATGAATGCAGG + Intergenic
1169567740 20:6874052-6874074 ATGAATAAATAAATGATTGAGGG + Intergenic
1169727360 20:8750519-8750541 ATGGATAGATAAATGGATAGAGG - Intronic
1169822460 20:9727639-9727661 ATAAATAAATAAATAAATGGGGG - Intronic
1170007483 20:11685221-11685243 ATGAATGCATAAACAAATGGCGG + Intergenic
1170195752 20:13687583-13687605 ATGAATGGATAAATGAATTGTGG - Intergenic
1170435135 20:16318661-16318683 CTGAATAAATAAATAAATGGGGG + Intronic
1170477669 20:16732054-16732076 CTGTATAAATAAGTGAATGGTGG + Intronic
1171512617 20:25697532-25697554 ATGCATAATTAGATAAATGGGGG - Intergenic
1172131200 20:32656947-32656969 ATGAATGGATAAATGAAAGGTGG + Intergenic
1173309218 20:41881810-41881832 ATGCATAGAGGAATGGATGGAGG - Intergenic
1173904079 20:46613323-46613345 ATAAATAAATAAATAAATGGTGG + Intronic
1173954225 20:47018294-47018316 ATGAATGAATGAATGAATGGGGG - Intronic
1174521221 20:51132240-51132262 AGGCACAGATGAATGAATGGAGG - Intergenic
1174713760 20:52734916-52734938 ATGAATGGATAAATGAATTGTGG - Intergenic
1174940005 20:54916438-54916460 ATGGATTAATGAATGAATGGTGG - Intergenic
1175068713 20:56313059-56313081 ATGAATGCATAAATAAATGGTGG + Intergenic
1175660356 20:60807428-60807450 TTGGATACACAAATAAATGGGGG - Intergenic
1175754177 20:61518934-61518956 ATGGATAGATGAATGAATGATGG - Intronic
1175772598 20:61633027-61633049 ATGGATGGATAAATGGATGGAGG - Intronic
1175942516 20:62544156-62544178 ATGAATAAATAAATGAAGTGCGG - Intergenic
1177272589 21:18869054-18869076 ATAAATAAATAAATAAATGGGGG + Intergenic
1178217605 21:30618111-30618133 ATACATTCATGAATGAACGGTGG + Intergenic
1178869990 21:36365535-36365557 ATGCATATATAAATCAAAGAGGG + Intronic
1179144441 21:38754978-38755000 ATGCATACATATAAAAATGGTGG + Intergenic
1180256385 21:46631888-46631910 ATGCAAACAAAAATGTATGCTGG + Intergenic
1182896964 22:33867074-33867096 ATGGATAGATGAATGAATGAGGG + Intronic
1183025427 22:35062527-35062549 ATGGATGCATAAATGATTGGAGG + Intergenic
1183112817 22:35664131-35664153 ATGCAAACAAAAATGTATGCTGG - Exonic
1183323955 22:37181281-37181303 ATGAATGAATAAATGAACGGTGG + Exonic
1183683013 22:39345232-39345254 ATTAATAAATAAATAAATGGAGG + Intergenic
1184444686 22:44540214-44540236 ATGGATAGATGGATGAATGGTGG + Intergenic
1185104469 22:48859359-48859381 ATGGATAGATGAATGGATGGAGG - Intergenic
1185163414 22:49243286-49243308 ATGGATAGATAGATGGATGGAGG + Intergenic
1185405651 22:50647667-50647689 ATGCAAACAAAAATGTATGCTGG - Intergenic
949147129 3:715316-715338 ATGCATAAATAAACAAATGAAGG - Intergenic
949728846 3:7083590-7083612 GTGAAAACATAAATGAATGCAGG - Intronic
951625081 3:24651473-24651495 ATACATAAATGAATGAATGAGGG + Intergenic
951900031 3:27647598-27647620 ATGAATAAATAAATGAGGGGAGG - Intergenic
952049881 3:29371912-29371934 ATGAAGAAATAAATGAATAGAGG - Intronic
952413530 3:33070272-33070294 TTGCATAAATAATTGAATTGAGG + Intronic
952423852 3:33154772-33154794 AAGAAGACTTAAATGAATGGAGG + Intronic
952592058 3:34967904-34967926 ATGAATACCTAAATCAATGTAGG - Intergenic
952662402 3:35867574-35867596 ATGCATACACAAAGGACTGTGGG - Intergenic
952915853 3:38240855-38240877 ATACATATATAAACAAATGGGGG + Intronic
954247668 3:49344447-49344469 ATAAATAAATAAATAAATGGTGG + Intergenic
954768179 3:52940543-52940565 ACACATACATACATAAATGGAGG + Intronic
954900037 3:54011225-54011247 ATGAATACATGAATGAATAAAGG - Intergenic
954944576 3:54409025-54409047 AAGAATACATAAATGAATAAAGG - Intronic
955086586 3:55708745-55708767 ATAAATAAATAAATAAATGGAGG + Intronic
955565823 3:60244281-60244303 ATATACACATAAATGTATGGGGG + Intronic
956395337 3:68820034-68820056 AAGTGTACATAAATGAATGAAGG + Intronic
956541363 3:70343826-70343848 ATGAATACATAAATATATGGAGG - Intergenic
956807446 3:72829505-72829527 ATAAATACATAAATGAAAGAAGG + Intronic
957490681 3:80922782-80922804 ATGTATACATCAATGAATCCAGG - Intergenic
957643858 3:82893975-82893997 ATTCATACATTAATGTTTGGTGG - Intergenic
957721404 3:84004868-84004890 ATGAATAAATAAATGAATTTGGG + Intergenic
957813093 3:85254230-85254252 ATGCATAGTTAAAGGAATGTGGG + Intronic
958095831 3:88942963-88942985 ATGCATACAAAAAGGTATGGGGG - Intergenic
958682325 3:97346930-97346952 ATGACTCCATAAATGAATGAAGG + Intronic
958692445 3:97485020-97485042 ATGCATACATTTATGCAGGGGGG + Intronic
958884882 3:99714632-99714654 ATGGATGGATAAATGAATGATGG - Intronic
959274806 3:104265075-104265097 ATGCAAACAAAAATGTATGCTGG - Intergenic
959462237 3:106641667-106641689 ATGCATTCTTGAATGAATTGAGG - Intergenic
960131300 3:114058893-114058915 ATGCATAGAAAAATGACTGAAGG - Intronic
960510022 3:118538690-118538712 ATGAATAGATAAATAAATTGTGG - Intergenic
960721498 3:120628514-120628536 ATTCAAACATAAATGCCTGGAGG + Exonic
960803761 3:121563458-121563480 ATGCATAAATAAATGAAAGTTGG + Intergenic
963063820 3:141246601-141246623 ATGAAGAGATTAATGAATGGAGG - Intronic
963731714 3:148981026-148981048 AAGCATAGATAAATAAATGCAGG + Intergenic
964023109 3:152039023-152039045 ATGCAAACAAAAATGTATGCTGG + Intergenic
964783272 3:160364545-160364567 ATGCATACATATATTTATGGTGG + Intronic
965482491 3:169236432-169236454 ATGAATACATAAATGAATAAGGG + Intronic
966305358 3:178527008-178527030 ATGTCTACATATATGAATGGCGG - Intronic
966357138 3:179092888-179092910 TTGAATATATAAATAAATGGAGG - Intergenic
966389331 3:179435338-179435360 ATCAATATTTAAATGAATGGAGG - Intronic
966800011 3:183754545-183754567 ATTCATACGGAAATGAATGGAGG + Intronic
966963361 3:184964600-184964622 ATGGATTCATGAATGAATAGAGG - Intronic
967244577 3:187472714-187472736 ATGCAAACAAAAATGTATGCTGG - Intergenic
967342546 3:188415910-188415932 ATGCACACACAAATCAATGCAGG + Intronic
967382121 3:188870414-188870436 TTAAATACATAAATGAATGAGGG - Intronic
967523912 3:190470415-190470437 AGGCATCCATAAATGAAGTGAGG + Intergenic
967540836 3:190665950-190665972 ATACATAAATAAATAAATAGGGG + Intergenic
967686674 3:192425260-192425282 AAGCAAACACAAATGAAAGGTGG + Intronic
967694949 3:192519755-192519777 CTGAATACATAAATAAATGTAGG - Intronic
967787185 3:193509992-193510014 ATGAATGCATGCATGAATGGAGG + Intronic
969273202 4:6116787-6116809 ATGAATACATAAAACAATGATGG + Intronic
969503281 4:7567798-7567820 ATGATTAAATAAATAAATGGGGG - Intronic
969686451 4:8677290-8677312 ATTCATCCATGAATGAATGTTGG - Intergenic
969986237 4:11213918-11213940 ATGAATAATTAAATGAATGGAGG - Intergenic
970702283 4:18756489-18756511 ATGAAGAAATAAATGAATAGTGG - Intergenic
971228266 4:24775667-24775689 ATGAATGAATAAATTAATGGCGG + Intergenic
971513034 4:27450963-27450985 AAACATACAAAAATGAATAGTGG - Intergenic
971944316 4:33254509-33254531 ATGCAAACAAAAATGTATGCTGG + Intergenic
971955484 4:33412317-33412339 ATGCAAACAAAAATGTATGCTGG - Intergenic
972214106 4:36875534-36875556 ATGAATGAATAAATGAATAGAGG + Intergenic
972493975 4:39615378-39615400 AAAAATAAATAAATGAATGGGGG + Intronic
972862188 4:43183632-43183654 ATAAATAAATAAATAAATGGGGG - Intergenic
973245682 4:48009091-48009113 ATGCAAACAAAAATGTATGCTGG + Intronic
973324888 4:48850244-48850266 ATTCATAAATAAATAAATGGTGG - Intronic
973639876 4:52892207-52892229 ATGCAGCCGTAAATGAGTGGAGG - Intronic
974948292 4:68555153-68555175 ATGCAAACAAAAATGTATGCTGG - Intronic
975053007 4:69889559-69889581 ATAAATAAATAAATAAATGGGGG - Intergenic
975233150 4:71958350-71958372 TTACATAAATAAATAAATGGGGG - Intergenic
976020192 4:80614103-80614125 ATGTATACAGAAATGAAAAGGGG - Intronic
976362229 4:84193710-84193732 CTGAATAAATAAATAAATGGGGG + Intergenic
976757193 4:88511268-88511290 GTGAATACATAAATAAATCGTGG + Intergenic
977484772 4:97629039-97629061 ATGCATATACAAATGAATATGGG - Intronic
977720463 4:100234360-100234382 ATGCAAACAAAAATGTATGCTGG + Intergenic
977761928 4:100748051-100748073 ATGCAAACAAAAATGTATGCTGG - Intronic
978010639 4:103678564-103678586 ATGAATGAATAAATGAATGGAGG - Intronic
978877415 4:113658458-113658480 ATGCAGACCTAAAAGAAGGGAGG - Intronic
979155217 4:117378435-117378457 ATGAATACATAAATAAATGGGGG + Intergenic
979155821 4:117389240-117389262 TTGCATTGATAAATGAATGTAGG + Intergenic
979629696 4:122886545-122886567 TTGAATAAATAAATAAATGGAGG - Intronic
979928140 4:126593775-126593797 ATGAATGGATAAATAAATGGTGG + Intergenic
980071761 4:128250902-128250924 ATGCAAACAAAAATGTATGCTGG + Intergenic
981218379 4:142200096-142200118 CTGAATAAGTAAATGAATGGAGG - Intronic
981854186 4:149267917-149267939 ATGCATACATAAATGAATAAGGG + Intergenic
982234577 4:153240737-153240759 AAGCATACCTCAATGACTGGAGG + Intronic
982345621 4:154354541-154354563 ATCCATACATAAAGTAATGAGGG - Intronic
982854853 4:160368508-160368530 ATACTTATAGAAATGAATGGTGG + Intergenic
983435999 4:167716246-167716268 GTGAATACATAAATAAATGAAGG + Intergenic
983721034 4:170851723-170851745 ATGCATATATAAGTGGAGGGAGG + Intergenic
984230067 4:177085189-177085211 ATGCAGACAAAAATGAAAAGGGG + Intergenic
984985715 4:185327934-185327956 ATGCAAACAAAAATGTATGCTGG + Intronic
985119554 4:186626580-186626602 ATGCATGAATGAATGAATGAGGG + Intronic
985227190 4:187774695-187774717 ATGCAAACAAAAATGTATGCTGG + Intergenic
987068000 5:14308519-14308541 ATGGATGGATAAATGGATGGAGG - Intronic
987460346 5:18201548-18201570 ATGCAAACAAAAATGTATGCTGG - Intergenic
987552536 5:19402756-19402778 ATGCATACATAAATAATGGTTGG - Intergenic
987652438 5:20760178-20760200 ATTCACACATTAATAAATGGAGG + Intergenic
987679307 5:21115075-21115097 ATGCAAACAGAAATGTATGCTGG + Intergenic
988195069 5:27994413-27994435 ATTCATACATTAATAAATGTTGG - Intergenic
988682616 5:33498506-33498528 ATAAATAAATAAATAAATGGTGG + Intergenic
988743121 5:34101305-34101327 ATTCACACATTAATAAATGGAGG - Intronic
989428632 5:41326167-41326189 ATGCATGGATGGATGAATGGAGG - Intronic
989628482 5:43456159-43456181 GTGCAAAGATAAATCAATGGAGG + Intronic
990061832 5:51659678-51659700 ATGCATACATAAATTAACTTGGG - Intergenic
991528153 5:67586457-67586479 ATACATTCATAAATTATTGGTGG + Intergenic
991733826 5:69613778-69613800 ATGCCCACAAAAGTGAATGGAGG + Intergenic
991810260 5:70468920-70468942 ATGCCCACAAAAGTGAATGGAGG + Intergenic
991860441 5:71008368-71008390 ATGCCCACAAAAGTGAATGGAGG - Intronic
992292633 5:75294910-75294932 ATGCAAACAAAAATGTATGCTGG - Intergenic
992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG + Intronic
992353974 5:75960803-75960825 ATTAATAAATAAATGAATGCAGG - Intergenic
992381234 5:76239828-76239850 ATTCATACATTAATGAATTGTGG - Intronic
993580713 5:89657441-89657463 ATACATACAAAAAAGAATGCTGG - Intergenic
993654926 5:90565560-90565582 ATAAATGCATAAATGAAAGGTGG - Intronic
994285341 5:97957799-97957821 ATGCATACATATAAGAATTATGG - Intergenic
995231451 5:109769479-109769501 ATCCATACATAAATAAAGGGCGG + Intronic
997701819 5:135907468-135907490 ATAAATAAATAAATAAATGGGGG - Intergenic
998480279 5:142457554-142457576 ATGCATGAATAAATTAATGGGGG - Intergenic
998699515 5:144682037-144682059 ATGAATACATAAATGCATTTAGG - Intergenic
998737541 5:145159764-145159786 ATGTAGACAGAAGTGAATGGAGG - Intergenic
999032403 5:148308396-148308418 ATGTAAAAATAAATGAATGCCGG + Intergenic
1000327165 5:160181038-160181060 ATGCATGAATGAATGAATGAAGG + Intergenic
1000456675 5:161457800-161457822 ATGAATTCATAAATGCATGTAGG - Intronic
1000836857 5:166165953-166165975 ATGCATATCTAAATGATTGCAGG - Intergenic
1000905941 5:166965906-166965928 ATATATAAATAAATGAATGGCGG - Intergenic
1001099851 5:168805234-168805256 ATGAATACAAGAATGAATGAAGG + Intronic
1001146685 5:169191155-169191177 ATGAATAAATGAATGAATAGTGG + Intronic
1001290600 5:170456002-170456024 ATGCATACATATATTTATTGAGG + Intronic
1001326438 5:170730990-170731012 CTGAATACATAAATAAATGCAGG + Intronic
1001609427 5:172988198-172988220 ATGAATGCATAAATGACAGGTGG - Intronic
1002822575 6:740123-740145 ATAAATACATAAATAAATGAAGG - Intergenic
1003313006 6:4985764-4985786 TTGAATACATTAATGAGTGGGGG + Intergenic
1003745988 6:9003061-9003083 AGGCATTCACAAATGAAAGGAGG + Intergenic
1004369053 6:15036521-15036543 ATAAATAAATAAATAAATGGTGG + Intergenic
1004569884 6:16834923-16834945 ATACATAAATAAATAAAAGGAGG - Intergenic
1004646495 6:17566882-17566904 ATGCAAACAAAAATGTATGCTGG + Intergenic
1004829039 6:19457588-19457610 GTGAATGCATAAATTAATGGTGG + Intergenic
1005300081 6:24461933-24461955 ATGAATGCATAAATGACTGTCGG + Intronic
1005418289 6:25624214-25624236 ATGCAGACATAGGAGAATGGGGG + Intergenic
1005591675 6:27335176-27335198 AAGAAAACATAAACGAATGGTGG - Intergenic
1005825852 6:29631618-29631640 AGGCATACAGAGAGGAATGGTGG + Intronic
1006312222 6:33268863-33268885 ATGCATACCTAAAGAAATGGTGG + Intronic
1006404496 6:33836815-33836837 ATGCATTCATAAATTATGGGGGG - Intergenic
1007372483 6:41435404-41435426 TTGAATAAATAAATAAATGGAGG - Intergenic
1007737154 6:43988707-43988729 ATGCATTCTTAAATGAGTAGAGG + Intergenic
1008019490 6:46559857-46559879 ATGAATGAATGAATGAATGGGGG - Intronic
1008741165 6:54610125-54610147 AAGCATGCATGAATGAATGGAGG - Intergenic
1008794150 6:55279900-55279922 ATCAATACATAAATGAAAGTAGG + Intronic
1009489689 6:64274168-64274190 ATGAATGAATAAATGAATGGAGG - Intronic
1009894682 6:69733754-69733776 AGGCATTCATAATTGAATGGTGG - Intronic
1010080640 6:71856963-71856985 TTGAATAAATAAATAAATGGGGG - Intergenic
1010336852 6:74695306-74695328 AGGCATGCATTATTGAATGGTGG - Intergenic
1010510128 6:76708171-76708193 ATGAATAGATAGATGAATGAAGG - Intergenic
1010631496 6:78204239-78204261 ATGCATACATTAATGGAAAGTGG + Intergenic
1010778856 6:79920188-79920210 ATTCATACATATATTATTGGGGG - Intronic
1010853555 6:80808780-80808802 ATAAATAAATAAATGATTGGTGG + Intergenic
1010942618 6:81936439-81936461 ATACATAAATAAATAAAAGGGGG - Intergenic
1011307324 6:85942650-85942672 ATGAATACATGAATGAATTAGGG - Intergenic
1011888235 6:92124830-92124852 ATGCATATATGAATGAATGAAGG - Intergenic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1013184486 6:107746016-107746038 ATAAATAAATAAAAGAATGGAGG + Intronic
1015932939 6:138380774-138380796 ATAAATACATAAATAAATGCAGG + Intronic
1016657380 6:146537026-146537048 TTGGATATATAAATGAATAGGGG + Intergenic
1017067619 6:150543760-150543782 AAGAATAAATGAATGAATGGTGG + Intergenic
1017299986 6:152845791-152845813 ATCCATAGATGAATGAATGAAGG + Intergenic
1017765700 6:157605435-157605457 ATCCATACATAAATAAAGGATGG - Intronic
1017783403 6:157734107-157734129 ATAAATACATAAATGAATGATGG + Intronic
1018630747 6:165819819-165819841 ATGAATACATGAATGAATGATGG + Intronic
1018674900 6:166211244-166211266 ATGCATATATATATGAAAAGAGG + Intergenic
1018766337 6:166936236-166936258 ATGAATGAATGAATGAATGGAGG + Intronic
1018965493 6:168484708-168484730 ATGAATAGATAAATGAAATGTGG + Intronic
1019345564 7:528489-528511 ATGGACGCATAAATGAATGGAGG + Intergenic
1019609064 7:1927565-1927587 GTGCAAACATAATTCAATGGTGG + Intronic
1021159399 7:17253317-17253339 ATGGATGGATGAATGAATGGAGG + Intergenic
1021246700 7:18271911-18271933 ATGCATCCATAAATGAAGGAAGG + Intronic
1021601147 7:22364887-22364909 ATGCACGCATGAATGAATGCTGG + Intergenic
1021824111 7:24530923-24530945 ATAAATAAATTAATGAATGGGGG - Intergenic
1022219088 7:28294493-28294515 ATGAATGCATGGATGAATGGAGG + Intergenic
1023449390 7:40266681-40266703 TTGAATACATGAATGAATGGGGG + Intronic
1023820681 7:43978955-43978977 ATGAATGAATGAATGAATGGGGG + Intergenic
1024111353 7:46149962-46149984 TTGAATAAATAAATAAATGGGGG - Intergenic
1024177181 7:46852464-46852486 ATGAACACATAAATAAATTGTGG - Intergenic
1024304515 7:47916390-47916412 ATAAATAAATAAATAAATGGGGG + Intronic
1024546333 7:50523934-50523956 ATAAATGCATAAATGAATTGTGG + Intronic
1025039493 7:55628338-55628360 ATGCAAACAAAAATGTATGCTGG + Intergenic
1026227519 7:68455674-68455696 ATCCATAAATCAATGAATGCAGG - Intergenic
1026346832 7:69481868-69481890 ATAAATAAATAAATAAATGGAGG - Intergenic
1026420364 7:70230508-70230530 ATGGATCCATAAATGATTTGGGG + Intronic
1026844843 7:73692958-73692980 ATGTATAAATTAAGGAATGGCGG + Intronic
1027432276 7:78126957-78126979 ATAAATACATAAATAAATAGCGG - Intronic
1027471125 7:78575501-78575523 AGGACTACATAAATGAAAGGGGG + Intronic
1028266224 7:88729371-88729393 AAGCATTCATAAAAGAAAGGAGG - Intergenic
1028698122 7:93741363-93741385 CTGAATAAGTAAATGAATGGAGG - Intronic
1028735672 7:94209538-94209560 GTACATACATAAATAAATGCTGG - Intergenic
1030074992 7:105729319-105729341 ATAAATAAATAAATAAATGGAGG + Intronic
1030634142 7:111929272-111929294 ACACATACATATATAAATGGAGG + Intronic
1030782732 7:113621988-113622010 ATGCAAACAAAAATGTATGCTGG + Intergenic
1031112793 7:117631682-117631704 ATGCATAGCAAAATGAATGTGGG - Intronic
1031227496 7:119058927-119058949 ATGCAAACAAAAATGTATGCTGG + Intergenic
1032998750 7:137479550-137479572 ATGCACACATAATTTAATGAAGG + Intronic
1033445736 7:141420338-141420360 ATGAATAAATAAATGAATGTAGG + Intronic
1034883616 7:154780886-154780908 ATGAATAGATAAATGCATGATGG + Intronic
1035013333 7:155740421-155740443 ATAAATACATAAATGAATTCAGG + Intronic
1035102570 7:156413742-156413764 ATGCATGCAGCAATGCATGGTGG + Intergenic
1037731651 8:21530130-21530152 AAACATACATATATGTATGGAGG - Intergenic
1037921243 8:22807794-22807816 ATGGATGGATAAATGGATGGAGG - Intronic
1038820490 8:30947630-30947652 ATGAATGAATGAATGAATGGAGG + Intergenic
1038861567 8:31393813-31393835 AGTCATAAATCAATGAATGGAGG + Intergenic
1039132597 8:34284274-34284296 ATGCATAAATAAATAAATGCAGG + Intergenic
1039331113 8:36537822-36537844 ATATATATATATATGAATGGCGG + Intergenic
1039606178 8:38882644-38882666 AGGCATGCAGAAATAAATGGTGG + Intergenic
1039663150 8:39488825-39488847 AATCAGACATAAATAAATGGAGG + Intergenic
1039937220 8:42055900-42055922 ATGCATAGAGAAAAAAATGGGGG - Intergenic
1040673961 8:49726326-49726348 ATGAATAAAAAAATAAATGGAGG + Intergenic
1041027111 8:53698397-53698419 CTGCATACATAAAGAAATGAAGG - Intergenic
1041297248 8:56370484-56370506 ATGCAAACAAAAATGTATGCTGG + Intergenic
1041572494 8:59353014-59353036 ATGCATAAAAAAATGGATTGTGG - Intergenic
1041738797 8:61137935-61137957 CTGCATGAATGAATGAATGGAGG - Intronic
1041913180 8:63111627-63111649 TTACATACATACTTGAATGGGGG - Intergenic
1042474940 8:69237130-69237152 ATGCAAACATACATATATGGGGG + Intergenic
1042937217 8:74071890-74071912 ATGCATAAATAAATAAATTGTGG - Intergenic
1043558839 8:81466848-81466870 ATACATACATAAAGGCATAGAGG - Intergenic
1043963952 8:86450789-86450811 ATCTATAAGTAAATGAATGGTGG + Intronic
1044392945 8:91673943-91673965 ATGCATGAATAAATGAAAGAAGG - Intergenic
1045102534 8:98860068-98860090 ATTAATACATGAATGAATAGTGG - Intronic
1045825762 8:106396103-106396125 ATAAATACATAAATAAATAGAGG + Intronic
1046385587 8:113505158-113505180 ATGCAAACAAAAATGTATGCTGG + Intergenic
1047303644 8:123635927-123635949 ATGCATGAATGAATGAATGATGG - Intergenic
1047306922 8:123659867-123659889 ATGAATGGATAAATGAATGCTGG - Intergenic
1047601377 8:126429217-126429239 ATGAATGAATGAATGAATGGAGG + Intergenic
1047903051 8:129444539-129444561 ATGCTTACATAAGTTAATGAAGG - Intergenic
1048071447 8:131026061-131026083 AAGCATGCATTAATGAATGATGG + Intronic
1048165588 8:132058986-132059008 ATGAGGAGATAAATGAATGGAGG - Intronic
1048388130 8:133932728-133932750 CTGAATAAATAAATAAATGGAGG - Intergenic
1048548402 8:135408221-135408243 ATGATTAAATAAATAAATGGGGG - Intergenic
1048598224 8:135889550-135889572 GTGAATAAATGAATGAATGGAGG + Intergenic
1049341671 8:142115960-142115982 ATGAATAGATAAATGAATAAGGG - Intergenic
1049351470 8:142167025-142167047 ATGCTTATATTAAGGAATGGGGG + Intergenic
1049364256 8:142229110-142229132 ATGGATGGATAAATGGATGGTGG + Intronic
1049448739 8:142646585-142646607 ATGCAAACAAAAATGTATGCTGG + Intergenic
1049464992 8:142747024-142747046 ATGGATAGATAAATGGATAGGGG + Intergenic
1050078161 9:1886936-1886958 TTGAATACGTAGATGAATGGAGG - Intergenic
1050175725 9:2867740-2867762 ATAAATAAATAAATAAATGGGGG - Intergenic
1050664004 9:7914497-7914519 ATGCAAACATATGTGTATGGAGG + Intergenic
1051178997 9:14390980-14391002 TTGCATATATAAAGAAATGGGGG + Intronic
1051862028 9:21636810-21636832 ATGATTAAATAAATAAATGGGGG + Intergenic
1051892133 9:21953375-21953397 GTGAATAAATAAATAAATGGGGG + Intronic
1051965264 9:22820632-22820654 ATACATTCTTAAATGAATGTAGG + Intergenic
1052474509 9:28941600-28941622 ATGCATGAATAAGTGAGTGGAGG - Intergenic
1052498017 9:29253153-29253175 TTGAATACATAAATTAATGAAGG - Intergenic
1052499351 9:29270077-29270099 ATGCATACATACATAAAAGAAGG + Intergenic
1054756711 9:68966165-68966187 TTGAATAAATAAATAAATGGAGG + Intronic
1054968198 9:71054063-71054085 AGGCATACATATATCAATGGTGG - Intronic
1055092406 9:72376295-72376317 ATACATACATAAATAAATAAAGG + Intergenic
1055135994 9:72829557-72829579 TTACATACATAAATGCATGCAGG - Intronic
1055431632 9:76249915-76249937 ATACAAATATAAATAAATGGTGG + Intronic
1056592938 9:87978575-87978597 ATAAATAAATAAATGAATGTAGG + Intergenic
1056686489 9:88767653-88767675 ATGAATAAATAAATAAGTGGGGG - Intergenic
1056718053 9:89049471-89049493 ATACACACAAAAATGAATGGAGG - Intronic
1056725493 9:89111042-89111064 GTGTATACATAAATGATTGAGGG - Intronic
1057235804 9:93358839-93358861 ATGCAAACAAAAATGTATGCTGG - Intergenic
1057467482 9:95328713-95328735 ATGCAAACAAAAATGTATGCTGG + Intergenic
1057646618 9:96881763-96881785 ATGGACATATAAATAAATGGAGG - Intergenic
1057842578 9:98497996-98498018 ATGAATGGATAAATGAATTGTGG + Intronic
1057909962 9:99012105-99012127 ATGCAAACAAAAATGTATGCTGG + Intronic
1058006090 9:99916386-99916408 ATAAATAAATAAATAAATGGAGG - Intronic
1058677834 9:107415707-107415729 TTGAATAAATAAATGAATGGGGG - Intergenic
1058997169 9:110310749-110310771 ATGCAAACAAAAATGTATGCTGG - Intronic
1059205960 9:112465778-112465800 ATGAATAGGTAAATGAATTGTGG - Intronic
1059354023 9:113686068-113686090 ATGCATATATATGTGTATGGTGG - Intergenic
1059542215 9:115142440-115142462 TTACAAACATAAATAAATGGAGG + Intronic
1060163369 9:121387709-121387731 ATAAATAAATAAATAAATGGGGG - Intergenic
1060734844 9:126060241-126060263 ATAAATAAATAAATGAAAGGTGG - Intergenic
1061963389 9:133999214-133999236 ATGAATACAGGGATGAATGGAGG - Intergenic
1185582419 X:1220923-1220945 ATAGATACATAGAAGAATGGAGG + Intergenic
1185633070 X:1530082-1530104 ATGGATACATAGATGGATGACGG - Intronic
1185883876 X:3764536-3764558 ATGGATAGATAAATGAATCATGG - Intergenic
1186460099 X:9741387-9741409 ATGCAAACAGATATCAATGGAGG - Exonic
1186669528 X:11755917-11755939 ATGAATGAATGAATGAATGGGGG + Intergenic
1186742260 X:12530843-12530865 ATGGATGAATAGATGAATGGTGG + Intronic
1186873912 X:13798458-13798480 ATGCATACAGAGATGTATGCAGG - Intronic
1186874829 X:13806834-13806856 ATGCAGACATAAAGGGCTGGTGG - Intronic
1187037508 X:15557258-15557280 ATGAATACATAATTTAAAGGGGG + Intergenic
1187076552 X:15941114-15941136 ATGGATGGATGAATGAATGGAGG - Intergenic
1187373073 X:18726378-18726400 ATAAATAAATAAATAAATGGCGG + Intronic
1187508507 X:19896935-19896957 ATGAATACATATGTGATTGGTGG + Intergenic
1187984008 X:24790886-24790908 ATACATAAATAAATGAGTGGGGG - Intronic
1188080528 X:25833984-25834006 AAGAATAGATAAATAAATGGGGG + Intergenic
1188206404 X:27364313-27364335 ATGCATAGAGACATGAATAGAGG - Intergenic
1188349927 X:29116296-29116318 ATGCAGTCAAAAAAGAATGGAGG + Intronic
1188435726 X:30156059-30156081 TTGAATACATAAATAAATTGTGG - Intergenic
1188563974 X:31504069-31504091 ATGAACAAATAAATGAATGAGGG + Intronic
1189032545 X:37465145-37465167 ATGAATACATAGCTCAATGGGGG - Intronic
1189065546 X:37804585-37804607 ATGAATAGATAAATGAAAAGTGG + Intronic
1189357366 X:40321139-40321161 ACACAAAGATAAATGAATGGAGG - Intergenic
1189691525 X:43622107-43622129 ATGCAAACAAAAATGTATGCTGG + Intergenic
1190150197 X:47939859-47939881 TTGAATAAATAAATAAATGGGGG + Intronic
1190387774 X:49899303-49899325 GTGAATACCTAAATAAATGGAGG - Intergenic
1190795823 X:53740728-53740750 ACGCAAACATAATTCAATGGAGG - Intergenic
1190899647 X:54657934-54657956 ATAAATACATAAATAAATAGTGG - Intergenic
1191060352 X:56289081-56289103 TTGTATAAATAAATAAATGGGGG - Intergenic
1192171325 X:68857019-68857041 ATGCACACATGAATGAATAGAGG - Intergenic
1192235732 X:69294379-69294401 ATGCATACATGCATGAAGGAAGG - Intergenic
1192483510 X:71505190-71505212 ATAAATAGATAAATAAATGGGGG + Intronic
1192927960 X:75776451-75776473 GTGCATACATAAATGCATGCTGG + Intergenic
1193318499 X:80092914-80092936 ATGAATAGATAAATGAAATGGGG - Intergenic
1193355147 X:80511700-80511722 TTGCATATATAAATCAATGGGGG - Intergenic
1194143841 X:90239947-90239969 ATGTATATGTAACTGAATGGGGG - Intergenic
1194573141 X:95577005-95577027 ATGAATAAATAAATAAATGTGGG - Intergenic
1194886833 X:99326060-99326082 ATGCAAACAAAAATGTATGCTGG - Intergenic
1195727694 X:107935129-107935151 ATGAGTGAATAAATGAATGGCGG - Intergenic
1195979531 X:110562276-110562298 ATGCCTATATAAAAGAAAGGGGG - Intergenic
1196074404 X:111559594-111559616 ATGCAAACAAAAATGTATGCTGG + Intergenic
1196556579 X:117091630-117091652 ATGCATGTATAAGTGAATGAAGG + Intergenic
1196772842 X:119312241-119312263 ATGCAAACAAAAATGTATGCTGG - Intergenic
1197014758 X:121609992-121610014 ATGCATGAATAAATGAATTTGGG - Intergenic
1197325415 X:125087842-125087864 TTGAATAAATAAATAAATGGTGG + Intergenic
1197481129 X:126987517-126987539 ATGCAAACAAAAATGTATGCTGG - Intergenic
1197568534 X:128119113-128119135 ATGCAAACAAAAATGTATGCTGG + Intergenic
1197831041 X:130642984-130643006 AAGCATACATAAATGCATACAGG - Intronic
1198063379 X:133070457-133070479 ATGCAGACATACAAGACTGGAGG - Intronic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1198632370 X:138654765-138654787 ATACATACATACATAAATAGCGG + Intronic
1199091146 X:143693683-143693705 TTTCACAGATAAATGAATGGTGG + Intergenic
1199377460 X:147131051-147131073 ATGCAAACAAAAATGTATGCTGG - Intergenic
1199523425 X:148764616-148764638 TTGCAGACAGAAATGAATGATGG - Intronic
1200099196 X:153681188-153681210 ATGATTACATAAATAAATGTGGG + Intronic
1200425390 Y:3014766-3014788 ATGAACAAATGAATGAATGGAGG - Intergenic
1200489603 Y:3809248-3809270 ATGTATATGTAACTGAATGGGGG - Intergenic
1200781544 Y:7220755-7220777 ATGGATAGATAAATGAATCATGG + Intergenic
1200789682 Y:7288243-7288265 ATGCATACCCAAATAAATGCAGG - Intergenic
1201115180 Y:10829913-10829935 CTGTCGACATAAATGAATGGAGG - Intergenic
1201291306 Y:12422342-12422364 ATGCATGCATGCATGAATGAAGG + Intergenic
1201363233 Y:13175863-13175885 ATGCAAACAAAAATGTATGTTGG - Intergenic
1201491134 Y:14542674-14542696 ATGCACACATATATGTATTGCGG + Intronic
1201553792 Y:15247318-15247340 ATGCAGAAACAAATGAAAGGTGG + Intergenic
1201917333 Y:19196255-19196277 ATGGATAGATAAATGAATGATGG + Intergenic