ID: 1107934863

View in Genome Browser
Species Human (GRCh38)
Location 13:45337448-45337470
Sequence AAATGTAGGCTGCATGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107934863_1107934867 11 Left 1107934863 13:45337448-45337470 CCATTAACATGCAGCCTACATTT 0: 1
1: 0
2: 1
3: 17
4: 185
Right 1107934867 13:45337482-45337504 ATGTATTCCCCAATTCAATCTGG 0: 2
1: 0
2: 1
3: 5
4: 97
1107934863_1107934868 12 Left 1107934863 13:45337448-45337470 CCATTAACATGCAGCCTACATTT 0: 1
1: 0
2: 1
3: 17
4: 185
Right 1107934868 13:45337483-45337505 TGTATTCCCCAATTCAATCTGGG 0: 2
1: 0
2: 5
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107934863 Original CRISPR AAATGTAGGCTGCATGTTAA TGG (reversed) Intronic