ID: 1107945479

View in Genome Browser
Species Human (GRCh38)
Location 13:45414320-45414342
Sequence CCAAATAAGGAAAAGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 415}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107945471_1107945479 -2 Left 1107945471 13:45414299-45414321 CCGCAGTACATGGGCAAACATCC 0: 1
1: 0
2: 0
3: 13
4: 112
Right 1107945479 13:45414320-45414342 CCAAATAAGGAAAAGGGGGCGGG 0: 1
1: 0
2: 0
3: 32
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107945479 Original CRISPR CCAAATAAGGAAAAGGGGGC GGG Intronic
900997961 1:6133053-6133075 CCAAATAAGAAAATAGGGGCTGG - Intronic
901106572 1:6760912-6760934 CAAGAAAAGGAAAAAGGGGCCGG + Intergenic
901298471 1:8180009-8180031 CCAAATAAAGGAAAGGGAGAAGG - Intergenic
901911541 1:12462821-12462843 CCAGATAAGGCTAAGGTGGCAGG - Intronic
902661070 1:17904273-17904295 CTAAATAAACAAAAGGGGCCTGG + Intergenic
902852772 1:19173899-19173921 CCAATTAACCAAAAGAGGGCAGG + Intronic
902935630 1:19762718-19762740 CCAAATCAGGAGCGGGGGGCAGG + Intronic
903228427 1:21906968-21906990 CCATGGAAGGAAAAGCGGGCTGG + Intronic
903487790 1:23704366-23704388 CCAACTAAGGAAACTGAGGCAGG - Intergenic
905034659 1:34909903-34909925 CAAGATAAGGACAAGGAGGCTGG - Intronic
905063490 1:35159736-35159758 CCAAATAAAAAAAAGAGGCCGGG + Intergenic
905345015 1:37305549-37305571 CCAAATTAGGAAAAGGGCAGAGG + Intergenic
905431267 1:37925825-37925847 CCAAAGAAGGAAAATGGAGAGGG + Intronic
905454623 1:38079718-38079740 ATAAATAAATAAAAGGGGGCAGG - Intergenic
905462798 1:38132463-38132485 ACAAATCAGGAAATGGGGGCAGG + Intergenic
906433390 1:45774398-45774420 AGAAATTAGGAAAAGGGGCCAGG + Intergenic
907337096 1:53707054-53707076 CCATATGAGGAAAATGGGTCGGG - Intronic
908306407 1:62823521-62823543 CCAAAAAGGGAAAAGAGGACAGG - Intronic
908447730 1:64216880-64216902 CTAAGAAAGGAAAAGGGGCCAGG - Intronic
908517260 1:64905820-64905842 CTAAATGAGGAAAAGAGGTCAGG + Intronic
908521400 1:64946362-64946384 GCAAATAAGTAAATGGTGGCTGG + Intronic
908756565 1:67474161-67474183 ATAAATAAGTAAAAGAGGGCCGG - Intergenic
909280243 1:73742194-73742216 CCAAATATGGAACAGGGGCCTGG + Intergenic
910347741 1:86259739-86259761 CCAAATAGGGCAAGGGGGGCTGG - Intergenic
910572699 1:88723412-88723434 ACAAATAAATAAAAGGGGGGGGG - Intronic
911040145 1:93584753-93584775 CCACACAAGGAAAAGGTGGAAGG + Intronic
912190527 1:107334329-107334351 CCAAATGAGTAAAAGCGGCCAGG - Intronic
912831034 1:112954416-112954438 ACACATAAGGAAACTGGGGCTGG - Intronic
912842618 1:113052205-113052227 CCAAAAAAGAAAAAAGGGGACGG + Intergenic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
914724092 1:150312887-150312909 TAAAATAAGGATAATGGGGCCGG + Intergenic
914951580 1:152119948-152119970 CCAAATATGGAAAAGAGCACAGG + Intergenic
915186599 1:154111084-154111106 CCAAATAAGTAAAATCTGGCTGG + Intronic
915859165 1:159423677-159423699 TCAAAGAAGGAAAAGGAGACTGG - Intergenic
916014899 1:160741321-160741343 AGAAACAAGGAAGAGGGGGCAGG + Intronic
916153942 1:161825808-161825830 CCAAGTAGGGGAGAGGGGGCTGG - Intronic
916983736 1:170167646-170167668 CCTAATAAGGAAGAGTGGGCTGG + Exonic
917256674 1:173123477-173123499 CCAAATAAGGAGATCAGGGCTGG + Intergenic
918243786 1:182642022-182642044 CCAGGTATGGAAAAGGTGGCTGG - Intergenic
918345033 1:183599847-183599869 CAAAAAAAGAAAAAGAGGGCAGG - Intergenic
918925705 1:190782740-190782762 CCAACTATGGATAATGGGGCTGG - Intergenic
918997828 1:191784831-191784853 CCAAATTTGGCAAAGGGGGCTGG - Intergenic
919138705 1:193542982-193543004 CCAAAAAAGGAGAAGGGATCTGG - Intergenic
919777485 1:201203709-201203731 CCAGAAAAGGAAGAGGAGGCGGG - Intronic
920046632 1:203137048-203137070 TGAAAAAAGAAAAAGGGGGCAGG + Intronic
920526263 1:206668951-206668973 ACAAGGAAGGAAAAGGGGGATGG - Intronic
921388778 1:214598645-214598667 TCAAATAAGTAAGTGGGGGCCGG - Intergenic
1064880511 10:20047651-20047673 CCATGTAAGGAAAGGGAGGCTGG - Intronic
1065341357 10:24709440-24709462 CCAAAACTGGAAAAGGGGGCGGG + Intronic
1066280142 10:33909206-33909228 TGAATTAAGGAAAAGGGAGCAGG - Intergenic
1066599507 10:37089541-37089563 CCAAAAAAAGAAATGGGGGAAGG - Intergenic
1066718520 10:38312751-38312773 CAAAATAAGTAGAAGGGGGTCGG - Intergenic
1068654899 10:59564436-59564458 CCAAGGAAGGAGAAGAGGGCAGG + Intergenic
1069323160 10:67199034-67199056 AAAAATAAGGTAAAGGGGGAAGG + Intronic
1070316430 10:75317579-75317601 CCATATTAAGAAATGGGGGCCGG - Intergenic
1073079740 10:100851729-100851751 CCACATAAGGAAGAGGGAGGGGG + Intergenic
1073454199 10:103626784-103626806 AAAAATAAGAAAAAGGGGGGTGG + Intronic
1075590384 10:123686965-123686987 CCAAATATGGCCAAGGGTGCTGG + Intronic
1076662018 10:132062030-132062052 CCACAGAGGGAAAGGGGGGCCGG + Intergenic
1076706562 10:132305261-132305283 CCAAATTAGGAAAATGGTTCTGG + Intronic
1076826325 10:132971417-132971439 CCAAAAAAAGAAAAGGAGGGAGG - Intergenic
1076993657 11:288525-288547 CCCAATAAGGGAGAAGGGGCAGG + Intergenic
1078610665 11:12816466-12816488 ACAAATACCAAAAAGGGGGCGGG - Intronic
1081426905 11:42935315-42935337 CCAGACAGGGAAAAGGGGGTAGG - Intergenic
1081637368 11:44729417-44729439 CCAATTCAGGAAAAGTGGGGTGG - Intronic
1083661313 11:64252774-64252796 CCAAATAAGGAAGTGGGAACAGG + Intronic
1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG + Intergenic
1084590319 11:70086435-70086457 ACAAATAAGGAAACTGAGGCAGG + Intronic
1084870787 11:72097447-72097469 CCAAGTCAGGGAGAGGGGGCAGG + Exonic
1086924744 11:92628009-92628031 TCAAATGAGGAAATGGTGGCTGG - Intronic
1087218999 11:95525799-95525821 ACAAATAAGAAAATGGGGGCAGG + Intergenic
1087987353 11:104699664-104699686 TCACATAAAGAAAATGGGGCTGG - Intergenic
1088618972 11:111662935-111662957 AGAAATAAGGTAAAGGGGCCAGG + Intronic
1090043377 11:123310167-123310189 TCAAATCAGGAAGAGGGTGCGGG - Intergenic
1090043387 11:123310226-123310248 TCAAATCAGGAAGAGGGTGCGGG - Intergenic
1090043397 11:123310285-123310307 TCAAATCAGGAAGAGGGTGCGGG - Intergenic
1090082055 11:123620175-123620197 CTAAGTAAGGAAAAAGAGGCCGG + Intronic
1090521375 11:127483098-127483120 CAAGAGAAGGAAAAGGTGGCTGG + Intergenic
1090893655 11:130950178-130950200 TCAAATATGGAGAATGGGGCAGG - Intergenic
1090992205 11:131828097-131828119 ACAAATAAGGAAAATTTGGCAGG - Intronic
1091035993 11:132234088-132234110 CCAAAAAAGCCAAAGTGGGCAGG - Intronic
1092149520 12:6237579-6237601 CCAGATAATGAGAAGGGTGCGGG - Intronic
1092247041 12:6869488-6869510 CCAGAAAAGGAAAAAGGGGAGGG + Intronic
1092818442 12:12331353-12331375 CAAATTAAGGAAAAGGTGGGAGG + Intronic
1095855442 12:46855149-46855171 CCAAATTAGGAAAAATGGGGGGG + Intergenic
1096986191 12:55759735-55759757 TCAAAAAAGAAAAAGGCGGCCGG - Intronic
1097713329 12:62938400-62938422 AAAAAAAAGGAACAGGGGGCTGG + Intergenic
1098458437 12:70703419-70703441 CCAAATAAGAAAAAGTGGAGTGG - Intronic
1099734913 12:86555069-86555091 CCTTAAAAGGAAAAGGAGGCAGG - Intronic
1100462333 12:94812576-94812598 CCAAAAAGGGAAAAGTGGGTAGG - Intergenic
1101124481 12:101617204-101617226 CCAAGTAAAGAGAAGGAGGCCGG + Exonic
1101288716 12:103344089-103344111 CCAAATTAGAAAAAGGGTGGAGG + Intronic
1102082426 12:110109283-110109305 GCAAAAAAGGAAAATGGGCCAGG + Intergenic
1102540037 12:113612065-113612087 CCATTTAAGGGAAAGTGGGCCGG + Intergenic
1103811088 12:123614501-123614523 CCAGTTAAGGAAAAGGGTCCAGG + Intronic
1106180960 13:27369024-27369046 CCAAATAATGACAATGGGGAAGG + Intergenic
1107276464 13:38686063-38686085 CCAAACAAACACAAGGGGGCAGG + Intergenic
1107332812 13:39319862-39319884 ACAAGTAATGAAGAGGGGGCTGG + Intergenic
1107945479 13:45414320-45414342 CCAAATAAGGAAAAGGGGGCGGG + Intronic
1108376503 13:49818977-49818999 CTAAATATAGAAAAGGTGGCTGG + Intergenic
1109423866 13:62147404-62147426 CCAAAGATGGAAAAGGTGGTGGG - Intergenic
1109728543 13:66378851-66378873 GCAAATAAGGAAAAGAGTGTAGG + Intronic
1110277893 13:73660528-73660550 CAAAAGAAGGAAAAGAGGGTAGG + Intergenic
1110692846 13:78452101-78452123 CCAAAAAAGGAAAAGGGGAATGG - Intergenic
1110914979 13:81010074-81010096 AGATATAAGGAAAAGTGGGCTGG - Intergenic
1111906420 13:94260976-94260998 GAAAATAAGGAAAAGGCGCCGGG + Intronic
1112497877 13:99919155-99919177 CCAAATATGACAAACGGGGCAGG + Intergenic
1113439829 13:110319668-110319690 CCAAATAAGGAAGAAAGGGAAGG - Intronic
1113953090 13:114082641-114082663 CCAGAGAAGGAATGGGGGGCAGG + Intronic
1114429127 14:22645488-22645510 CTAAATAAGGTAGAGGGGGCTGG + Intergenic
1114783506 14:25567889-25567911 GCAAATAATGAAAAGGAGGAAGG - Intergenic
1115373139 14:32641806-32641828 CCATCTAAGGAAAATGGGGGAGG + Intronic
1115637023 14:35299616-35299638 CCAATTAAGAAAAAAGAGGCTGG - Intronic
1115673601 14:35644687-35644709 ACAAATAAGGAAAACGGGGAAGG + Intronic
1115983682 14:39081673-39081695 ACAAATATGGAAAAGTGGGAAGG + Intronic
1116381857 14:44278773-44278795 CAAAATAAGTAAATGGAGGCTGG - Intergenic
1116896258 14:50317770-50317792 CCAAAAAAAAAAAAGGGGGGTGG + Intronic
1116939742 14:50779456-50779478 CCAAATGAAAAGAAGGGGGCAGG + Intronic
1118035977 14:61866296-61866318 CCAAAAAAGGAAGAGGAGGGTGG + Intergenic
1118443496 14:65831968-65831990 TCAAATAAGAAATATGGGGCTGG + Intergenic
1119997475 14:79269343-79269365 CAAAATAAGAAAAATAGGGCCGG - Intronic
1120669071 14:87343091-87343113 CTATATTAGGAAAATGGGGCCGG + Intergenic
1120909677 14:89654709-89654731 CCAAAAAAAAAAAAGGGGGGGGG + Intergenic
1121043223 14:90767519-90767541 AGAAAGAAGGAAAAGGGGGCTGG - Intronic
1121171448 14:91857790-91857812 CCAAACTTGGAAAAGTGGGCTGG - Intronic
1121201058 14:92118675-92118697 CTAAAAAAGGTAAAGGGGCCGGG + Intronic
1121535437 14:94687455-94687477 GAAAAAAAAGAAAAGGGGGCTGG + Intergenic
1122739683 14:103864855-103864877 TCAAAAAAAAAAAAGGGGGCCGG - Intergenic
1124505727 15:30271593-30271615 CCAAATAAGACAAAGGTGACTGG + Intergenic
1124737826 15:32267039-32267061 CCAAATAAGACAAAGGTGACTGG - Intergenic
1125406690 15:39359619-39359641 TCAAATAAGTAAAAGAGGGAAGG - Intergenic
1127116279 15:55730888-55730910 GCAAATAAGGAATAGGAAGCTGG - Intronic
1127539750 15:59925353-59925375 CCAAAAAAAGAAAAGGAGGAGGG + Intergenic
1127845712 15:62868763-62868785 CCAAATAAGGAGTTGGAGGCCGG - Intergenic
1128156327 15:65394131-65394153 CCAGATAAGGAAACTGAGGCAGG + Intronic
1128686532 15:69690417-69690439 CCAAGTCAGGCACAGGGGGCTGG - Intergenic
1128744115 15:70101755-70101777 CCAAATAAGGGGCTGGGGGCTGG - Intergenic
1131362874 15:91809595-91809617 CCAAATAAAGGAGATGGGGCTGG + Intergenic
1134271618 16:12737782-12737804 CCAGATAAGGAACAGTGGGAGGG + Intronic
1134509817 16:14836999-14837021 TAAAATAAGTAAAATGGGGCCGG - Intronic
1134570836 16:15289775-15289797 CAACATAAGGAAAAGAAGGCTGG + Intergenic
1134731542 16:16466299-16466321 CAACATAAGGAAAAGAAGGCTGG - Intergenic
1134935908 16:18245702-18245724 CAACATAAGGAAAAGAAGGCCGG + Intergenic
1135263873 16:21004750-21004772 CCAAAGAAGGAAGAGGGGAAGGG - Intronic
1137484055 16:48877050-48877072 ACACATGAGGAAAAAGGGGCTGG + Intergenic
1138548714 16:57735607-57735629 CCTATTTAGGAAAAGAGGGCGGG + Intergenic
1139414578 16:66797531-66797553 GAAAATAAGAAAATGGGGGCTGG - Intronic
1142739243 17:1921116-1921138 TCACACAAGGAAAACGGGGCGGG - Intergenic
1143121539 17:4610741-4610763 CCAAATAAGGAAAAGCACTCCGG + Intergenic
1143201245 17:5115253-5115275 CGAAACAAGGAACAGAGGGCCGG + Intronic
1143545788 17:7594422-7594444 CCATATAAAGAAAATGAGGCTGG - Intronic
1143753138 17:9045660-9045682 CCAGAAAAGGAGATGGGGGCAGG + Intronic
1143799734 17:9368671-9368693 CCACTTAAGGAAAAGGAGGGAGG - Intronic
1145930173 17:28679687-28679709 TCTCATAAGAAAAAGGGGGCTGG + Intronic
1146302652 17:31702062-31702084 CAAAATAACGAAGAGTGGGCTGG - Intergenic
1146559938 17:33859378-33859400 GGAAATGAGGAAAAGGGGGGAGG + Intronic
1146974324 17:37098077-37098099 CCACAGAGGGAAGAGGGGGCAGG - Intronic
1146991524 17:37277736-37277758 CCAAATAAGGAAAAGAAAGATGG - Intronic
1147115550 17:38296803-38296825 TTAAAAAAGGAAAAGGAGGCCGG - Intergenic
1147631318 17:41933812-41933834 TCAAAAAAGAAAAAGGGGGGTGG + Intronic
1147953692 17:44120952-44120974 CCAAACCAGGGAAAGGGGGAGGG + Intronic
1148121295 17:45213587-45213609 CAAAAAAATGAAAAGGTGGCTGG - Intergenic
1148121980 17:45218555-45218577 AAAAAAAAGGAAAAAGGGGCCGG - Intergenic
1148412788 17:47482268-47482290 TCAAAAAAAAAAAAGGGGGCCGG + Intergenic
1148414128 17:47492817-47492839 TTAAAAAAGGAAAAGGAGGCCGG + Intergenic
1148653417 17:49265960-49265982 ACAAAAAAGAAATAGGGGGCTGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148844979 17:50524547-50524569 CCAGATTAGGAAGAAGGGGCAGG - Intronic
1148907515 17:50920646-50920668 GCAAATAAGCAGAAGGGGGCTGG - Intergenic
1150041737 17:61869846-61869868 CCAAATAAGGGAATGGAGGAAGG - Exonic
1150282085 17:63934639-63934661 CAAAATAAGGAATGGGGGCCAGG + Intergenic
1151263859 17:72938444-72938466 CCTAATAAGGAACAGAAGGCTGG - Intronic
1152128227 17:78460148-78460170 CTGAATAAGGTAAAGGGGGAGGG - Exonic
1152397592 17:80043813-80043835 ACAAATATGGAAGAGGAGGCCGG - Intronic
1152891281 17:82883019-82883041 CCAGCTAAGGAAAAGTGAGCAGG - Intronic
1154383021 18:13869467-13869489 GCAAAGAAGAAAAAGGCGGCGGG - Intergenic
1155349383 18:24891672-24891694 CCAAAGAAGGAAAAGTGAACTGG - Intergenic
1157919130 18:51697777-51697799 TCAAATGAGGAAAAAGAGGCAGG - Intergenic
1158081579 18:53598804-53598826 CCAAAAAAAAAAAAGGGGGGGGG - Intergenic
1158323836 18:56293237-56293259 GTACAAAAGGAAAAGGGGGCAGG + Intergenic
1159585301 18:70278085-70278107 GCAAATAAAGAAAAAGGGCCGGG + Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1160254970 18:77240449-77240471 CAAAATAACTAGAAGGGGGCTGG - Intergenic
1160513669 18:79466712-79466734 CCAACTGAGGAAGAGGAGGCAGG - Intronic
1160761930 19:789821-789843 ACAAATAAGGAAGGGGGGGCAGG - Intergenic
1160896384 19:1404108-1404130 ACAAATAATTAAAATGGGGCCGG + Intergenic
1160949726 19:1659690-1659712 CCTGAAAAGGACAAGGGGGCTGG - Intergenic
1161248809 19:3269758-3269780 CCAAAAAAGGGAGAGGGGGAAGG - Intronic
1161491773 19:4566330-4566352 CAAAATAAGTAAAATGGAGCAGG - Intergenic
1162396146 19:10419080-10419102 TCAAATAAGGAGAAGGGCGCGGG + Intronic
1164561288 19:29293950-29293972 CCCAGTAGGGAAAAGAGGGCAGG + Intergenic
1165141961 19:33705100-33705122 CCAAATAGGGCCTAGGGGGCAGG - Intronic
1165337672 19:35183286-35183308 CAAAATCAGGAAAACAGGGCTGG + Intergenic
1165683452 19:37797311-37797333 CCAAATAAGAACAAAGAGGCTGG + Intronic
1166059073 19:40313619-40313641 CTTAAAAAGGAAAAGCGGGCTGG - Intergenic
1168015527 19:53569957-53569979 CTAAATCAGAAACAGGGGGCCGG + Intronic
1168134831 19:54343302-54343324 ACAAAAAAAGAAAAGGGGGCCGG - Intergenic
1168148315 19:54431472-54431494 ACAAGGAAGGAAAAGGTGGCAGG - Intronic
1168224010 19:54981535-54981557 CCAATTAGAGAAAAGGAGGCAGG - Intronic
1168572925 19:57485164-57485186 CCTTATAAGGAAAAGTAGGCAGG - Intergenic
1168588802 19:57615723-57615745 CCAAATAAGGAAGAGGGAAGGGG + Intronic
1202685702 1_KI270712v1_random:47902-47924 CAAAAAAAAAAAAAGGGGGCGGG + Intergenic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
925421022 2:3711966-3711988 CCACAAAAGGAAATGGGGGCAGG - Intronic
926812074 2:16764131-16764153 TCCAATCAGAAAAAGGGGGCAGG + Intergenic
927056868 2:19373525-19373547 CCCAATAAGGCCATGGGGGCGGG - Intergenic
927177920 2:20423204-20423226 CCAAGCAAGGAAAGGAGGGCAGG - Intergenic
927194059 2:20535698-20535720 CCAACACAGGAGAAGGGGGCAGG + Intergenic
927434209 2:23053288-23053310 CAAAATAAGGGAAAGGGTACAGG + Intergenic
927592948 2:24372570-24372592 CCAAGTCAGGAATAGGGGGTGGG - Intergenic
927791018 2:26009535-26009557 CCATATAAAGAAATGGGGGGAGG - Intergenic
928581718 2:32714461-32714483 CTAAATAAAGAAAATGGGGTAGG - Intronic
928848210 2:35706611-35706633 TCAAGAAAGGAAATGGGGGCCGG - Intergenic
929487144 2:42364931-42364953 GCACATAAGGAAAAGCAGGCAGG - Intronic
929652964 2:43700587-43700609 CCCAAGAAGGAAAACGGTGCAGG - Exonic
929951509 2:46413453-46413475 GGTAATAAGGAAAAGGAGGCTGG + Intergenic
930780442 2:55219895-55219917 CCAAAAAAGAAAAGGTGGGCAGG - Intronic
931005168 2:57842247-57842269 GGAGATAAGGAAAAGAGGGCAGG - Intergenic
931760694 2:65414261-65414283 CCAAATAGGGGAAAGGAGGAAGG + Intronic
932369111 2:71173100-71173122 CCATCTAAGGAAATGGGGGGTGG - Intergenic
932757816 2:74421076-74421098 TAAAATAAAGAAAACGGGGCCGG - Intronic
932909395 2:75790119-75790141 CCAAAGAAGAAAAAGGTGTCTGG - Intergenic
933144349 2:78833155-78833177 CAAAATAAGGCTAAAGGGGCAGG + Intergenic
933190122 2:79324919-79324941 CCAAATAAAGAAATAGGGCCAGG + Intronic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
934684749 2:96312769-96312791 CTAATTAAGGAAAAGGAGTCAGG + Intergenic
934895565 2:98116818-98116840 AAAAATAAAGAAAAAGGGGCAGG - Intronic
934931183 2:98425456-98425478 CAAAATGAGTAAAATGGGGCAGG + Intergenic
935068532 2:99673889-99673911 ACAAATAGGGAAATGGGGTCAGG - Intronic
935588928 2:104827279-104827301 CGAAATAGGGAGAAGGGGACCGG + Intergenic
935620229 2:105123554-105123576 TAAAATAAGGAAGAGGGGGCTGG + Intergenic
936693021 2:114914834-114914856 CCAAATAAAGAAATGGGGCCGGG + Intronic
936949340 2:117962345-117962367 CCAATTAAGGACAAGTAGGCTGG + Intronic
937078729 2:119125468-119125490 GCAAAGAAGGAAAGGGAGGCCGG - Intergenic
937826783 2:126375075-126375097 CTGAATAAAGAAAATGGGGCTGG - Intergenic
939572276 2:143854659-143854681 GAAAATAAGGGAGAGGGGGCAGG + Intergenic
939828434 2:147044045-147044067 ACATATGGGGAAAAGGGGGCTGG + Intergenic
940384425 2:153053917-153053939 CCAAATAGGAAAAAGGCTGCGGG - Intergenic
941790407 2:169546625-169546647 CCAAGTGAGGAGAAGGGAGCAGG + Exonic
942470896 2:176258458-176258480 ACAAATAAGGAAAGAGGGGAAGG + Intergenic
943551910 2:189351722-189351744 TAAATTAATGAAAAGGGGGCAGG + Intergenic
944526683 2:200626727-200626749 ACAAAGAAGGAATATGGGGCTGG + Intronic
944553932 2:200869537-200869559 CCAAAAAAGGAGGAAGGGGCAGG + Intergenic
944567064 2:201002135-201002157 CTCAATAAGAAAAATGGGGCTGG + Intronic
945657259 2:212640282-212640304 ACAAATAAGGAAAAGGAGAATGG - Intergenic
946045636 2:216818669-216818691 CCAGTCAAGGTAAAGGGGGCAGG + Intergenic
946091685 2:217231121-217231143 CCAACTATGGAAAAGGGGAAGGG - Intergenic
946118977 2:217492290-217492312 CCAAATAGGGGAAAAGGGGGTGG - Intronic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
947323896 2:228953696-228953718 GCCAATAAGGCAAAGGGAGCTGG - Intronic
947680635 2:232028991-232029013 CCAAATCAAAAAAAGGGGGAGGG - Intronic
947783639 2:232794134-232794156 CTTAAGAAGGAAAAGGGGGATGG - Intronic
1171187314 20:23132050-23132072 ACAAATAAGGAAAAGGGCCGCGG - Intergenic
1172388306 20:34549000-34549022 CCAAAAAAGCAAAGTGGGGCCGG - Intronic
1172575948 20:36008723-36008745 CCATTTAAGGAAGAAGGGGCTGG + Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172623937 20:36336847-36336869 CCCAGGAAGGAGAAGGGGGCTGG - Intronic
1173017092 20:39235543-39235565 CCAAATACGGACAAGGAGGCGGG - Intergenic
1173161001 20:40652709-40652731 CCAAAGAAGAAAAAGGGGCTTGG + Intergenic
1173599632 20:44284377-44284399 CCAATTAAGGCAAATGAGGCTGG + Intergenic
1177038186 21:16071466-16071488 CCTAATATGGAAAGGGGGGGGGG - Intergenic
1177671169 21:24229922-24229944 CTAAATAAGGAATAGTAGGCAGG - Intergenic
1177987362 21:27993579-27993601 TTAAATAAGCAAAAGGGGCCTGG + Intergenic
1178573626 21:33764390-33764412 CAGAATAAGGAAGAGCGGGCAGG + Intronic
1179450378 21:41464492-41464514 CCTTATAAGGAAATGGAGGCTGG + Intergenic
1180675850 22:17586051-17586073 CCAAATAGGGAAGAGTGGGAAGG + Intronic
1182292266 22:29289510-29289532 CCAGATAGGGAAAAGGGGATGGG - Intronic
1182363189 22:29759768-29759790 TCAAAAAAATAAAAGGGGGCCGG + Intronic
1182488007 22:30650836-30650858 CCAAAGCAGGACAAGGGGGCTGG - Intronic
1182716149 22:32357464-32357486 TCAAAAAAAAAAAAGGGGGCTGG - Intronic
1183502297 22:38188177-38188199 CAAAATAAGAAAAAAAGGGCTGG + Intronic
1184142780 22:42588157-42588179 ACAAAAAAGTAAAATGGGGCCGG + Intronic
1184954913 22:47879530-47879552 AAAAATAAGGCCAAGGGGGCAGG - Intergenic
1184976701 22:48067325-48067347 CCACATGAGGAGAAGGGGCCAGG - Intergenic
949254930 3:2034890-2034912 CAAAATAAGGAAATGGGGCGAGG + Intergenic
949977533 3:9474712-9474734 CCAAATGAGCATAAGTGGGCTGG - Intronic
952098385 3:29983231-29983253 GCAAAAAAAAAAAAGGGGGCGGG - Intronic
952111631 3:30130427-30130449 CCAAGCAAGTAAAAGTGGGCAGG - Intergenic
952747016 3:36791094-36791116 CTAATTAGGGAAAAGGGAGCAGG + Intergenic
954128458 3:48546984-48547006 CAAAATCAGAAAAAGGGGCCTGG - Intronic
954165685 3:48755766-48755788 AAAAAAAAGGAAATGGGGGCTGG - Intronic
954290029 3:49644780-49644802 CTTAATAAGGAAATGTGGGCTGG - Intronic
954671063 3:52291650-52291672 CCACATTAGAAAAAGGGGGCTGG - Intronic
954811623 3:53251842-53251864 AGAAAAAAGGAAAAGGGGCCAGG + Intronic
956138422 3:66121348-66121370 ACATATAAGAAAACGGGGGCCGG - Intergenic
956739017 3:72260427-72260449 CCAAATGGGGAAAAGGGGAAAGG - Intergenic
957665493 3:83219576-83219598 CCAAAAAAAAAAAAGGGGGGAGG - Intergenic
957694787 3:83621486-83621508 ACAAATAAGGCAAAGGGAGTAGG - Intergenic
958720736 3:97839747-97839769 ACAAAAAAAAAAAAGGGGGCTGG - Intronic
958877357 3:99631471-99631493 CCAAATGGGGTAAAGGGGGCTGG + Intergenic
959472216 3:106766000-106766022 GCAAATAAGGAGAAAGAGGCAGG + Intergenic
960077976 3:113510138-113510160 CCAAATAAGAAAAATGAGACTGG + Intronic
960164286 3:114384292-114384314 GGGAAAAAGGAAAAGGGGGCTGG + Intronic
960190333 3:114696747-114696769 CCAATGAAAGAAAAGGGGGAGGG + Intronic
960303714 3:116035455-116035477 CAAGAGAAGGAAAAGGGGGTGGG + Intronic
961958412 3:130828060-130828082 CAAAATAAGGAAGATGGTGCTGG + Intergenic
962493374 3:135915577-135915599 TCAAAGCAGGAAAAGTGGGCAGG - Intergenic
964710003 3:159661767-159661789 CCAAGGGAGGAAAAGGAGGCTGG + Intronic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965400346 3:168205988-168206010 CAAGATGGGGAAAAGGGGGCCGG - Intergenic
965759248 3:172057513-172057535 CCAAAAAAGTAAAAGGGGTTGGG + Intronic
966524210 3:180903471-180903493 CAAAAAAAGGAAAAAGGGCCAGG + Intronic
966603217 3:181795865-181795887 CAAAATAAGGAAGAGAGGCCAGG - Intergenic
967322979 3:188212516-188212538 CCAAATATGGAGAAGCAGGCTGG - Intronic
967793848 3:193576918-193576940 CCAAATAAGCAAAAAGAAGCAGG + Intronic
969184831 4:5467362-5467384 CCAGCGAAGGACAAGGGGGCCGG - Intronic
969289925 4:6232120-6232142 CCAAATAAGGAGAAGGCCGCAGG - Intergenic
969603942 4:8192786-8192808 ACAAATAAAGACAAGTGGGCCGG - Intronic
971282470 4:25252126-25252148 CCAAATAATAACATGGGGGCGGG - Intronic
972186297 4:36532468-36532490 GGAAATAAGGAAAAGAGGGAGGG - Intergenic
973637254 4:52871523-52871545 ACAAATAAGGAAAAAGAGGGGGG - Intergenic
973768143 4:54182303-54182325 TCAAATAAGAAAAAGTTGGCCGG - Intronic
973817399 4:54631662-54631684 TCAAATTAGGACAAGGGGCCAGG + Intergenic
975071524 4:70145569-70145591 CCTAATAATGAAAAAGGGTCAGG + Intronic
975709219 4:77142548-77142570 ACAAAAAAGGAAAAGACGGCTGG + Intergenic
977627304 4:99201298-99201320 CCAAACAATGAAGAGGGGGAAGG - Intergenic
977800516 4:101224705-101224727 ATAAATAAGGAAATCGGGGCAGG + Intronic
977862714 4:101984791-101984813 CTGCATAAGAAAAAGGGGGCAGG + Intronic
978075318 4:104521959-104521981 GCAAAGAGGGAAAAGGGGGAGGG - Intergenic
978614052 4:110575961-110575983 ACAAAAAAAGAAAAGGAGGCTGG + Intergenic
979474646 4:121140766-121140788 AAAAAAAAGGAAAAGGGGGAGGG + Intronic
981731940 4:147908830-147908852 AAAAATAAGATAAAGGGGGCAGG - Intronic
982234749 4:153242032-153242054 CCCATTATGGAACAGGGGGCAGG + Intronic
982675748 4:158373941-158373963 GGAAATAAGAAAAAGGGGGAAGG + Intronic
984889920 4:184482704-184482726 TCAAAAAAGGAAATGTGGGCCGG - Intergenic
985211682 4:187602546-187602568 ACAAATAAGGAAAAGGGATGAGG + Intergenic
985313897 4:188633486-188633508 AGAAATAAGGAAAATGGGTCGGG + Intergenic
985385356 4:189440724-189440746 CAAAATAAGAAAAGGGGGGAGGG - Intergenic
985826276 5:2193944-2193966 CCTAATATGGAAAGGGAGGCTGG - Intergenic
985945823 5:3182171-3182193 CCAAATAAAGAAAATGAGGGTGG + Intergenic
987361013 5:17106484-17106506 CCAATTAAAAAAAAGGGGGAGGG - Intronic
987372199 5:17203521-17203543 CCAAATAACCACAAGGTGGCAGG - Intronic
993985613 5:94593878-94593900 CCAAATGAGGAGAAGGGAGCAGG - Intronic
995338080 5:111025700-111025722 CAAAATAAGGCCAAGGGGACTGG + Intergenic
995461843 5:112411602-112411624 ACAGATAAGGAAACTGGGGCTGG + Intronic
997386526 5:133477514-133477536 ACAAATAAGGAAACTGAGGCTGG + Intronic
997392366 5:133527693-133527715 CCAAATAAGGAAAAGTGCAATGG - Intronic
998254607 5:140575136-140575158 ACAAATAAGGAAAGAGAGGCAGG - Intronic
999395416 5:151223909-151223931 CCGAAAAAGGTAAAGGGCGCCGG - Exonic
1000278359 5:159760351-159760373 CCACATACGGACAAGGTGGCTGG - Intergenic
1000297755 5:159926920-159926942 ACAAATAAGGAAATGGGCTCAGG + Intronic
1000558683 5:162758602-162758624 TCAAATAAGGACAAGGAGGTAGG + Intergenic
1000944049 5:167398746-167398768 AGGAATAAGGGAAAGGGGGCTGG - Intronic
1001527292 5:172437865-172437887 CCAAATGGGGAAATGGCGGCAGG + Intronic
1002554091 5:180020717-180020739 CAAGAGAAAGAAAAGGGGGCAGG + Intronic
1003121448 6:3322059-3322081 GCAAACAAGGAATAGGGGCCAGG + Intronic
1003784183 6:9465255-9465277 CTAAATAATGAAAATGGGGAAGG + Intergenic
1003805216 6:9720706-9720728 CGAAATAAGGCAAGGGGAGCAGG + Intronic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004424799 6:15500079-15500101 CCAAATAAAGGAAGGGGGGTAGG - Intronic
1004984394 6:21064398-21064420 CCAGAAAAAGAAAAGGGGACTGG + Intronic
1005045781 6:21640954-21640976 CAAAAAAAGGAAAAGATGGCCGG - Intergenic
1005415443 6:25595306-25595328 CCAGATAAGCCAAAGGCGGCAGG + Intronic
1006464400 6:34183210-34183232 CCAGACAAGGAAATGGGGACTGG + Intergenic
1006734277 6:36261439-36261461 CCACATGAGGAAAAGGGAGGAGG + Intronic
1007483627 6:42166036-42166058 TCAAAAAAGGAAAAAGGGGCTGG - Intronic
1008237713 6:49070165-49070187 CCAAAGAGGGAAAAGAGGACTGG + Intergenic
1009823411 6:68835283-68835305 CCAAATAAGGAAAACAGTGTTGG - Intronic
1011258568 6:85449626-85449648 CCAAAGAAGGAAAAGAGAGGGGG - Intronic
1011458058 6:87573487-87573509 ACAAACAAGAAAAAGGGGGTTGG + Intronic
1012023805 6:93962409-93962431 CCAATTATGGAAAATGGGGATGG + Intergenic
1013331694 6:109108509-109108531 CAAAATAAGAAAAATGGGGCTGG - Intronic
1014785351 6:125612221-125612243 ACAAAAAAGGAAAATGGGGGTGG - Intergenic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015766932 6:136728742-136728764 CCAAATAAGAAAATTAGGGCTGG - Intronic
1017648195 6:156557871-156557893 CCAAATAAAGACAGAGGGGCAGG + Intergenic
1017837165 6:158189063-158189085 GCAAAAAAGGAAAAGGTGGGTGG - Intronic
1018865005 6:167739494-167739516 CCACATAAGGAAAAGTCGTCTGG + Intergenic
1019966795 7:4506061-4506083 CCAAAGAAGGAACTGGGGGCCGG + Intergenic
1020108452 7:5434057-5434079 CCATCTAAAAAAAAGGGGGCGGG - Intronic
1020135237 7:5584023-5584045 CCAAAAAAAGAAAAGAGGCCAGG + Intergenic
1022035648 7:26531673-26531695 CCAAATACAGAAGTGGGGGCAGG + Intergenic
1022495349 7:30849846-30849868 CAAAATAAGGACAATGTGGCTGG - Intronic
1022786949 7:33647891-33647913 CCAAAGAGGCAAATGGGGGCAGG - Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1024965242 7:55018653-55018675 CAAAAGAAGGGAAAGGGGGAAGG + Intergenic
1026499946 7:70935629-70935651 CTGAATAAGGAAGAGGGGGCAGG - Intergenic
1026774817 7:73224904-73224926 ACAAATCAGGAAAAGGAGCCAGG - Intergenic
1026891903 7:73987255-73987277 ATAAATAAGTAAAATGGGGCCGG - Intergenic
1027015671 7:74778275-74778297 ACAAATCAGGAAAAGGAGCCAGG - Intronic
1027072356 7:75167662-75167684 ACAAATCAGGAAAAGGAGCCAGG + Intergenic
1028636945 7:92999823-92999845 ACAAATTAAGAAAAGGGGACAGG + Intergenic
1028819702 7:95193083-95193105 CCACATGAGGAAAATGAGGCAGG + Intronic
1028848593 7:95511324-95511346 GAAAACAAAGAAAAGGGGGCTGG - Intronic
1029184334 7:98727777-98727799 CCAAAAAAGGAAAAGAAAGCAGG - Intergenic
1032303888 7:130714526-130714548 ACAAATAAGGAACAGGAGGATGG - Intergenic
1032799041 7:135303395-135303417 ACAAAGAAGGAAGAGGGGGAAGG + Intergenic
1032881129 7:136091703-136091725 CCTAAAAAGGAAAAGAGAGCGGG - Intergenic
1033261696 7:139849605-139849627 CCAAATAAGCAATAGAGGGAAGG + Intronic
1035628603 8:1091846-1091868 CGAAAGAGGGAAAAGGGGGAAGG - Intergenic
1035677612 8:1466373-1466395 CCAAAAGAGGAAAAGGGAGGGGG - Intergenic
1035846794 8:2874285-2874307 ACAAATGAGGAAAATGGGTCTGG - Intergenic
1036000090 8:4592680-4592702 AAAAATAAGGAAAAGAGGCCGGG - Intronic
1036557852 8:9875794-9875816 CAAAATGAGGAAGAGGTGGCTGG + Intergenic
1038080623 8:24131880-24131902 TTAATTAAGGAAAGGGGGGCTGG - Intergenic
1039060430 8:33567757-33567779 TCAAAAAAGAAAAAGAGGGCCGG - Intergenic
1039738965 8:40362352-40362374 CCACATCAGGAAAAGAGGGCAGG + Intergenic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1041899625 8:62967104-62967126 TCAAATAAAGAAAAGCTGGCAGG + Intronic
1042178191 8:66058379-66058401 GCAAATATGGAAAAGGGATCAGG - Intronic
1042555360 8:70029782-70029804 CAAAATAAGGAAATAGGGCCAGG - Intergenic
1043264079 8:78240496-78240518 CCAGATATGGAAAAGAAGGCTGG + Intergenic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1044123250 8:88424559-88424581 GGAAATAAGGCAGAGGGGGCAGG - Intergenic
1048660309 8:136592419-136592441 CCACTGAAGGAAAAGGAGGCTGG + Intergenic
1048667911 8:136684857-136684879 TCAAATAAAGAAATGGGGCCGGG - Intergenic
1049070879 8:140354823-140354845 CCAAATGAGAAAATGGAGGCTGG + Intronic
1049600311 8:143504497-143504519 CCAAAGACGGAGGAGGGGGCAGG - Intronic
1050094932 9:2054561-2054583 TAAAATGGGGAAAAGGGGGCAGG - Intronic
1050461795 9:5883765-5883787 CCTAAGAAGGAATAGGGGGTGGG - Intronic
1050547319 9:6719869-6719891 AAAAATAAGAAAAAGGGGCCAGG - Intergenic
1050607087 9:7313519-7313541 AAAAATAAAGAAAAGGGGGCTGG - Intergenic
1051212015 9:14754932-14754954 TCAAAAAAGAAAAAAGGGGCAGG + Intronic
1053164692 9:35836134-35836156 TCACATAAGGACAAGGGTGCTGG + Intronic
1053281083 9:36820138-36820160 CCAGATCAGGAGTAGGGGGCGGG - Intergenic
1053579261 9:39386794-39386816 ACAAATAAGAACAAAGGGGCCGG - Intergenic
1053843775 9:42214880-42214902 ACAAATAAGAACAAAGGGGCCGG - Intergenic
1054100845 9:60945600-60945622 ACAAATAAGAACAAAGGGGCCGG - Intergenic
1054122219 9:61220974-61220996 ACAAATAAGAACAAAGGGGCCGG - Intergenic
1054585504 9:66961284-66961306 ACAAATAAGAACAAAGGGGCCGG + Intergenic
1054707972 9:68482281-68482303 CCAACCAAGGAGAAAGGGGCAGG - Intronic
1055352880 9:75407533-75407555 CCAAATGAGGCAGAGGGGACAGG - Intergenic
1055873278 9:80911726-80911748 ACAGATAAGGAAAAGGGCTCGGG - Intergenic
1056216133 9:84407912-84407934 GCAAAAAAGGAACTGGGGGCCGG + Intergenic
1057696609 9:97327262-97327284 ATAAAAAAGGAAAAGTGGGCAGG - Intronic
1057772813 9:97983333-97983355 CCATGGAGGGAAAAGGGGGCTGG - Intergenic
1057898494 9:98929178-98929200 CCAAATATGCAAAAAGGGGAAGG - Intergenic
1060458980 9:123830566-123830588 CAAAACAGGGAAAAGAGGGCCGG + Intronic
1060688672 9:125636576-125636598 CCAAATAATGAACACAGGGCAGG + Intronic
1060748987 9:126156341-126156363 CCAAATAAGGAAAGAGGCTCAGG + Intergenic
1062152708 9:135030164-135030186 CCACATCAGGAGGAGGGGGCAGG - Intergenic
1186026494 X:5319377-5319399 CCAAGCAAGGAGAATGGGGCAGG + Intergenic
1187500911 X:19837735-19837757 ATAAAAAAGGAAAAGGTGGCTGG - Intronic
1188934411 X:36155681-36155703 TCAAATAAGGAAACTGAGGCTGG - Intergenic
1189033631 X:37474466-37474488 GCAAACAAGGATAAGGAGGCTGG + Intronic
1189351437 X:40278716-40278738 CACAAGAAGGAAAATGGGGCTGG + Intergenic
1189507183 X:41623705-41623727 CAAAAAAAAGAAAAGGGGCCAGG - Intronic
1190746671 X:53327536-53327558 CCCACTAGGGGAAAGGGGGCTGG - Intergenic
1191681683 X:63847161-63847183 TCAACTAAAAAAAAGGGGGCTGG - Intergenic
1192403475 X:70860478-70860500 GTAAATAAGGAAAAGGGTACAGG - Intronic
1193111794 X:77737422-77737444 CCAAAAAAAAAAAAGGGGGGGGG + Intronic
1195537274 X:106023175-106023197 CCAAGGAAGGTAAAGGAGGCAGG - Intergenic
1196321775 X:114349370-114349392 CTCAAAAAGGAAAAGGGGGGGGG + Intergenic
1198028059 X:132728423-132728445 ACAAATAAGGACAAGGCAGCGGG + Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201630435 Y:16065690-16065712 GAAAAAAAGGAAAAGGGAGCAGG + Intergenic