ID: 1107948743

View in Genome Browser
Species Human (GRCh38)
Location 13:45443456-45443478
Sequence GCCATAGATTTAGCTACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107948743_1107948753 23 Left 1107948743 13:45443456-45443478 CCAGCAGTAGCTAAATCTATGGC No data
Right 1107948753 13:45443502-45443524 AGTGAGATGAGCATTAGGTAGGG No data
1107948743_1107948752 22 Left 1107948743 13:45443456-45443478 CCAGCAGTAGCTAAATCTATGGC No data
Right 1107948752 13:45443501-45443523 CAGTGAGATGAGCATTAGGTAGG No data
1107948743_1107948746 -3 Left 1107948743 13:45443456-45443478 CCAGCAGTAGCTAAATCTATGGC No data
Right 1107948746 13:45443476-45443498 GGCTCTGGATGACGGCTCCCAGG No data
1107948743_1107948748 -1 Left 1107948743 13:45443456-45443478 CCAGCAGTAGCTAAATCTATGGC No data
Right 1107948748 13:45443478-45443500 CTCTGGATGACGGCTCCCAGGGG No data
1107948743_1107948751 18 Left 1107948743 13:45443456-45443478 CCAGCAGTAGCTAAATCTATGGC No data
Right 1107948751 13:45443497-45443519 GGGGCAGTGAGATGAGCATTAGG No data
1107948743_1107948747 -2 Left 1107948743 13:45443456-45443478 CCAGCAGTAGCTAAATCTATGGC No data
Right 1107948747 13:45443477-45443499 GCTCTGGATGACGGCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107948743 Original CRISPR GCCATAGATTTAGCTACTGC TGG (reversed) Intergenic
No off target data available for this crispr