ID: 1107948751

View in Genome Browser
Species Human (GRCh38)
Location 13:45443497-45443519
Sequence GGGGCAGTGAGATGAGCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107948743_1107948751 18 Left 1107948743 13:45443456-45443478 CCAGCAGTAGCTAAATCTATGGC No data
Right 1107948751 13:45443497-45443519 GGGGCAGTGAGATGAGCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107948751 Original CRISPR GGGGCAGTGAGATGAGCATT AGG Intergenic
No off target data available for this crispr