ID: 1107948753

View in Genome Browser
Species Human (GRCh38)
Location 13:45443502-45443524
Sequence AGTGAGATGAGCATTAGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107948743_1107948753 23 Left 1107948743 13:45443456-45443478 CCAGCAGTAGCTAAATCTATGGC No data
Right 1107948753 13:45443502-45443524 AGTGAGATGAGCATTAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107948753 Original CRISPR AGTGAGATGAGCATTAGGTA GGG Intergenic
No off target data available for this crispr