ID: 1107951093

View in Genome Browser
Species Human (GRCh38)
Location 13:45462911-45462933
Sequence TGGGGAACACAGCATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 269}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107951086_1107951093 9 Left 1107951086 13:45462879-45462901 CCTGAGTCAAGTGTTCCCAGTAG 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1107951093 13:45462911-45462933 TGGGGAACACAGCATGCTGCTGG 0: 1
1: 0
2: 5
3: 26
4: 269
1107951091_1107951093 -6 Left 1107951091 13:45462894-45462916 CCCAGTAGTTCAAATGGTGGGGA 0: 1
1: 0
2: 0
3: 10
4: 86
Right 1107951093 13:45462911-45462933 TGGGGAACACAGCATGCTGCTGG 0: 1
1: 0
2: 5
3: 26
4: 269
1107951092_1107951093 -7 Left 1107951092 13:45462895-45462917 CCAGTAGTTCAAATGGTGGGGAA 0: 1
1: 0
2: 1
3: 4
4: 109
Right 1107951093 13:45462911-45462933 TGGGGAACACAGCATGCTGCTGG 0: 1
1: 0
2: 5
3: 26
4: 269
1107951085_1107951093 10 Left 1107951085 13:45462878-45462900 CCCTGAGTCAAGTGTTCCCAGTA 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1107951093 13:45462911-45462933 TGGGGAACACAGCATGCTGCTGG 0: 1
1: 0
2: 5
3: 26
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107951093 Original CRISPR TGGGGAACACAGCATGCTGC TGG Intergenic
900243287 1:1626801-1626823 AGGGGGTCACAGCAGGCTGCAGG - Intronic
900701846 1:4053434-4053456 TGGTGAACACAGCAGGATGGGGG - Intergenic
900839311 1:5034908-5034930 TGGTGAACACATCAAGGTGCTGG - Intergenic
901019665 1:6249395-6249417 GGGGGAACTCAGGAAGCTGCTGG + Exonic
901198396 1:7453197-7453219 TGGGGAACCCAGGCTGCCGCTGG - Intronic
901303249 1:8214941-8214963 TGGGAAACACTGGCTGCTGCAGG + Intergenic
902371200 1:16008133-16008155 AGGGCAACACAGAATGATGCTGG + Exonic
903846221 1:26281081-26281103 TGTGGAACAAAACACGCTGCAGG + Exonic
903974317 1:27139140-27139162 TGGGGAGCCCAGCCAGCTGCAGG - Intronic
904857985 1:33514497-33514519 TGGGGCACCCAGCACTCTGCTGG - Exonic
907265564 1:53258224-53258246 TCTGGGACACAGTATGCTGCTGG - Intronic
907651866 1:56302821-56302843 TGGGGCACAGAGCATGGTGAAGG + Intergenic
907660065 1:56383757-56383779 TGGGGAACACAGGGTGGAGCAGG - Intergenic
911329954 1:96515546-96515568 TGGGGAACACAGGTTGGAGCAGG + Intergenic
917959656 1:180132198-180132220 GGGGGAAGAAAGCATGCTGGAGG + Intergenic
918911557 1:190578727-190578749 TGAGGAAAACAGCTTGCTGCGGG + Intergenic
920201620 1:204263121-204263143 TGGGGGACAAAACATGCCGCGGG + Intronic
920992729 1:210955276-210955298 TAGTGAAAACAGCATGCTTCTGG - Intronic
921220257 1:212968647-212968669 TGGGGAACCCAGCAGGAAGCTGG + Intronic
921806634 1:219462498-219462520 TGGGGAACAAGGCATACTTCTGG - Intergenic
922244060 1:223777585-223777607 TGGGGAACAGACCATGCTAAAGG - Intergenic
922502717 1:226109150-226109172 CCGGGAACACAGCAGGCCGCCGG + Intergenic
922663028 1:227446909-227446931 TGAGGAACACAGAAAGCTGAAGG - Intergenic
923420580 1:233810828-233810850 TGTGTGACACAGCATGCTGAAGG - Intergenic
923694296 1:236231996-236232018 TGGAGGAAACAGCATGCAGCTGG - Intronic
924830163 1:247585623-247585645 TGGAGAAAACAGAATGCTGTTGG + Intergenic
1066449229 10:35512783-35512805 TGGGGAGCTCAGCATGGTGATGG + Intronic
1066662454 10:37749706-37749728 CTGAGAACACAGCATGCTGCTGG - Intergenic
1067346160 10:45440603-45440625 TGGGGTGCACAGCAGGCAGCTGG - Exonic
1067348884 10:45457862-45457884 TGGGGACCACTGCAAGCTGGAGG + Exonic
1067961539 10:50857660-50857682 TGGGGAACACACTAAGCTGGTGG + Intronic
1069572834 10:69504762-69504784 CTGGGCACACAGCACGCTGCGGG - Intronic
1070304403 10:75231056-75231078 GGGGGAAAAAAGCCTGCTGCTGG - Exonic
1071297413 10:84232379-84232401 TGGGCAGCACAGCATGCGGCGGG - Exonic
1072618447 10:97064620-97064642 TGGGGCACACTACTTGCTGCAGG + Intronic
1073509344 10:104033729-104033751 TGGGGAACAGAGCACGCTGGGGG - Intronic
1073674711 10:105632626-105632648 TAAGCAAAACAGCATGCTGCTGG - Intergenic
1075002897 10:118810927-118810949 TGGGGGCCCCAGCATCCTGCTGG + Intergenic
1076591378 10:131586096-131586118 TGGGGAAGAGACCAAGCTGCTGG + Intergenic
1076725901 10:132412978-132413000 TGGTGACCACAGCAGCCTGCTGG + Intronic
1077165223 11:1131754-1131776 TGGGGAACACAGGGTGGTCCCGG - Intergenic
1077677383 11:4207073-4207095 TTGAAAACACAGCATGCAGCCGG + Intergenic
1078152589 11:8772071-8772093 TGGTGAACACATCAAGGTGCCGG + Intronic
1078577936 11:12517322-12517344 TGGGGACCAGAGCATGGTGGGGG - Intronic
1078720566 11:13880058-13880080 GGAGGAACACAGCATCCTCCTGG + Intergenic
1080591106 11:33723714-33723736 TGGGGAACCAAGCAAGCCGCTGG - Intronic
1080778253 11:35406474-35406496 TGAGGACCAAAGCATGCTCCAGG + Intronic
1081704354 11:45172246-45172268 TAGTGAACACAGCAAGGTGCTGG - Intronic
1083764030 11:64833647-64833669 TGGGGAACACAGCCTGCAGGAGG + Exonic
1084649906 11:70483027-70483049 AGGGGAGCACAGCTTGGTGCAGG + Intronic
1084899078 11:72296119-72296141 AGGGAAGCCCAGCATGCTGCAGG + Intronic
1085277645 11:75310236-75310258 AGGGCAACACAGCCTGCTCCAGG + Intronic
1085510212 11:77084330-77084352 TGAGGAAGGCAGCATGGTGCGGG + Intronic
1086415871 11:86588571-86588593 AGGGCAACACAGCAAGCTGGAGG + Intronic
1087011670 11:93520106-93520128 TGAGAAACAAAGCATGCTGCAGG + Intronic
1092057282 12:5518651-5518673 TGGGAACCACAGTGTGCTGCGGG - Intronic
1092305666 12:7298175-7298197 TGGGATACACAGCAGGTTGCTGG - Intergenic
1098611973 12:72469819-72469841 TGTGGAACAAAGAATACTGCTGG + Exonic
1102825144 12:115942753-115942775 TGGGGAAGACAGAATGGAGCCGG - Intergenic
1103183814 12:118938538-118938560 TGGGGAATCCTGCCTGCTGCTGG - Intergenic
1103323512 12:120105128-120105150 TGGGGAACAAGGCAGGCTTCAGG + Intronic
1103467898 12:121156569-121156591 AGGGTCACACAGCTTGCTGCAGG + Intronic
1103746471 12:123128077-123128099 TGAGGAACACAGAATGCTCCTGG - Intronic
1103994562 12:124820668-124820690 TGGGGGACACATCCAGCTGCTGG + Intronic
1104156740 12:126140455-126140477 TGTGGAAGACACCATGATGCTGG - Intergenic
1104473777 12:129053558-129053580 TCAGGAACACAGAATCCTGCAGG + Intergenic
1104506440 12:129336773-129336795 TGTGGGAAACAGCATGCAGCCGG + Intronic
1105545317 13:21346787-21346809 CGGGGAACAAACAATGCTGCAGG + Intergenic
1106394032 13:29363005-29363027 TGAGGAACATACCTTGCTGCAGG - Intronic
1107951093 13:45462911-45462933 TGGGGAACACAGCATGCTGCTGG + Intergenic
1109393900 13:61728779-61728801 TTGGAAACATAGCATCCTGCAGG - Intergenic
1113944185 13:114034395-114034417 GGGGCCACACAGCCTGCTGCTGG - Intronic
1115079498 14:29433927-29433949 TGGAGAACACAGGAAGCTGGTGG + Intergenic
1116064437 14:39964638-39964660 TGTGGTACACTGTATGCTGCTGG + Intergenic
1116839700 14:49807489-49807511 TGGAGAACATAGAATACTGCTGG - Intronic
1119682662 14:76604594-76604616 TGGTGAACACATCAAGATGCTGG - Intergenic
1120516875 14:85481329-85481351 TGGGGAACAAAGCAGGCAGATGG + Intergenic
1122070003 14:99200185-99200207 TTGGGAATCCAGGATGCTGCAGG + Intronic
1125577794 15:40767173-40767195 AGGGGCACACAGCAAGCTCCTGG - Exonic
1125729200 15:41883301-41883323 TGGGAAACACAGCAAGGTGGGGG - Intronic
1127950527 15:63801056-63801078 TGGTGAACACATCAAGATGCTGG + Intronic
1129293471 15:74586158-74586180 TGGGCCACACAGCAGGGTGCAGG + Intronic
1129468873 15:75739106-75739128 TGGGGAACAGAACACGCTGATGG - Intergenic
1129940835 15:79495389-79495411 TGGGGAACTCAGCAGGGAGCGGG + Intergenic
1132181270 15:99754475-99754497 TGGGAATCACTGCCTGCTGCAGG + Intergenic
1132877789 16:2148133-2148155 TGGCAAACACACCAGGCTGCTGG - Intronic
1134055479 16:11167275-11167297 TGGGGCACAGAACATCCTGCTGG - Intronic
1134511013 16:14846818-14846840 TGGGGAACTCAGCACTCTGACGG - Intronic
1134698656 16:16245314-16245336 TGGGGAACTCAGCACTCTGACGG - Intronic
1134973179 16:18549359-18549381 TGGGGAACTCAGCACTCTGACGG + Intronic
1136515615 16:30766420-30766442 GGGGGAGTACCGCATGCTGCAGG + Exonic
1139594863 16:67951604-67951626 TGGGGAAGACAGGCTGCTGCAGG + Intronic
1140955783 16:79863756-79863778 TGATGAACACAGCATGCTAGGGG + Intergenic
1141556295 16:84838786-84838808 TGGGGAACAGAGCAGGCTGGTGG - Intronic
1142594496 17:1022942-1022964 TGGGGAAGGCAGGTTGCTGCGGG - Intronic
1144426987 17:15152306-15152328 TGGTGAACACATCAAGGTGCTGG + Intergenic
1144850361 17:18241058-18241080 AGGGGAACTCAGCAGGCTGAGGG - Intronic
1146504234 17:33390972-33390994 TGGAGAAAGCAGCATGCAGCAGG - Intronic
1147259248 17:39198821-39198843 TGCGGAACACAGCAAGGTGGTGG - Intergenic
1147478981 17:40741078-40741100 TGGTGAACACATCAAGGTGCTGG + Intergenic
1148458925 17:47826706-47826728 TGTGGGGCACAACATGCTGCTGG - Exonic
1149468459 17:56897715-56897737 TGGGGAACACACCTGCCTGCTGG + Intronic
1150257324 17:63758025-63758047 TGGTGAACACATCAACCTGCTGG + Intronic
1150430444 17:65111578-65111600 TGGTGAACACATCAAGGTGCTGG - Intergenic
1151340533 17:73467993-73468015 TGGGCAGCACAGCATGGTCCTGG + Intronic
1152409235 17:80113441-80113463 TGGGGAACACAGCCCACAGCAGG - Intergenic
1152667254 17:81578235-81578257 TGGAGAGCACAGCATGCACCCGG - Intronic
1152919500 17:83058914-83058936 CGGGGCTCACAGCAGGCTGCCGG + Intergenic
1153581294 18:6576276-6576298 TGGGGAAAACTGCTTGCTCCAGG - Intronic
1153764298 18:8360686-8360708 TGGGGAACACTGCCTGCAGAAGG + Intronic
1157677048 18:49576769-49576791 TGGGCAACATAGCAAGCTTCTGG - Intronic
1158263618 18:55636027-55636049 TGTGTAACCCAGCATGCTGTTGG + Intronic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1163691249 19:18739625-18739647 TGGGGAGCACAGCATGGTGGGGG + Intronic
1165938016 19:39401270-39401292 TGGTGCACACTGCATGCTCCAGG + Intergenic
1166729812 19:45052670-45052692 TGGGGACCAAAGCAGGCTGAGGG + Intronic
1167357220 19:49011333-49011355 TGGGGAAAACAGGATGCTCTGGG + Intronic
1167904100 19:52644035-52644057 TGGGGAACACGGGAAGCTGGTGG + Intronic
1167910926 19:52700993-52701015 TGGGGAACACGGGAAGCTGGTGG + Intergenic
1167934025 19:52891715-52891737 TGGGGAACACGGGAAGCTGGTGG + Intronic
1167964091 19:53129313-53129335 TGGGGAACACAGGAAGCTGGTGG + Intronic
1168000970 19:53445836-53445858 TGGGGAACACGGGAAGCTGGTGG - Intronic
1168005335 19:53482335-53482357 TGGGGAACACGGGAAGCTGGTGG - Intronic
1168164449 19:54537177-54537199 TGGGCACCAGAGCATGCAGCAGG - Intronic
925130067 2:1488461-1488483 TGGGGAGCACAGGGGGCTGCTGG - Intronic
925640437 2:5981575-5981597 CGGGGATCACAGGATGCTGCCGG - Intergenic
925723170 2:6847539-6847561 TGGGGAAAAAATCAAGCTGCAGG - Intronic
926587076 2:14698628-14698650 TGTGCAACACAGCATCCTGCAGG - Intergenic
927149232 2:20186230-20186252 TGGAGATCACAGCATCCTGCCGG - Intergenic
927199919 2:20571749-20571771 TGGGGCACTCAGCAGGCTCCAGG - Intronic
931613099 2:64125153-64125175 TGGTGAACACATCAAGTTGCTGG - Intronic
931737129 2:65206057-65206079 GGGGGAAAAAAGCCTGCTGCTGG - Intergenic
932419716 2:71594387-71594409 TGGGAAACACTGCACGCTTCGGG + Intronic
934922764 2:98359379-98359401 TGGGTTACCCAGCATGCAGCTGG + Intronic
935343691 2:102083366-102083388 TGGGGAACACACCATCCATCTGG - Intronic
937317998 2:120944121-120944143 TGTGTAACTCAGCATGCAGCTGG - Intronic
938930877 2:136086071-136086093 TGGGGATCACAGGATAATGCAGG + Intergenic
938978315 2:136501001-136501023 TGTGGAACACAGCATGATTAAGG - Intergenic
939242416 2:139578298-139578320 TGGCCAAAACAGCATGGTGCTGG + Intergenic
941016220 2:160360193-160360215 TGGGGAACACAGGGAGATGCTGG + Intronic
942655927 2:178213973-178213995 TGGGAAATACAGGATGCTGTTGG - Intronic
943086488 2:183318150-183318172 TGGGGAACAGAGCATGGGTCAGG + Intergenic
943349329 2:186779114-186779136 TGAGGCACACAGCAGTCTGCTGG - Intergenic
944659581 2:201910257-201910279 TGGAGAGCACAGCATGATGGGGG - Intergenic
945354196 2:208818076-208818098 TGGGGAACACAGCATGTTGAGGG - Intronic
945671114 2:212803840-212803862 AGGGGAACACAGAAAACTGCTGG - Intergenic
946455232 2:219820235-219820257 TGAAGAACACAGCATGATGTGGG - Intergenic
948686694 2:239674799-239674821 TGGAGAACACTGCAGGCTACAGG - Intergenic
1168935179 20:1658787-1658809 TGGGCAACTCAGCATGCAGGAGG - Intergenic
1171293303 20:23994809-23994831 TGGGGAACGCAGCGTTCTCCAGG - Intergenic
1172512503 20:35510221-35510243 TGGGGAAGAAAGCATGATCCTGG + Intronic
1172702366 20:36861580-36861602 TGGAGCTCACAGCATGCTGCTGG - Intronic
1173464799 20:43272222-43272244 TGGGGAAAAGATAATGCTGCGGG + Intergenic
1173518069 20:43679094-43679116 TGGGGAACACAGAAGGAAGCAGG + Intronic
1175346041 20:58276799-58276821 TGGGGCACAGAGGGTGCTGCTGG - Intergenic
1175656133 20:60772699-60772721 TGGGGAAAAATGCATCCTGCAGG - Intergenic
1176309205 21:5140891-5140913 TGGGTGTGACAGCATGCTGCTGG + Intronic
1178240780 21:30897757-30897779 AGAGGAACAAAGCAGGCTGCTGG + Intergenic
1179044057 21:37829496-37829518 CTGGGAACACATCCTGCTGCTGG + Intronic
1179847856 21:44121142-44121164 TGGGTGTGACAGCATGCTGCTGG - Intronic
1180126379 21:45793067-45793089 TGGGAACCACAGCACGCTGGAGG + Intronic
1180731372 22:17984950-17984972 TGAGCAACACAGCATGCTAGAGG + Intronic
1180824364 22:18852524-18852546 TGGGGAACGCAGCGTTCTCCAGG - Intronic
1181124790 22:20695678-20695700 TGGGGAACGCAGCGTTCTCCAGG - Intergenic
1181188370 22:21122024-21122046 TGGGGAACGCAGCGTTCTCCAGG + Intergenic
1181210828 22:21288469-21288491 TGGGGAACGCAGCGTTCTCCAGG - Intergenic
1181348179 22:22235776-22235798 TGGGGAATACTGCCTCCTGCTGG + Intergenic
1181398681 22:22638419-22638441 TGGGGAACGCAGCGTTCTCCAGG + Intergenic
1181501413 22:23317775-23317797 TGGGGAACGCAGCGTTCTCCAGG + Exonic
1181516405 22:23416166-23416188 TGAGCAACACAGCATGCTAGAGG + Intergenic
1181650740 22:24257640-24257662 TGGGGAACGCAGCGTTCTCCAGG - Intergenic
1181706642 22:24653099-24653121 TGGGGAACGCAGCGTTCTCCAGG + Intergenic
1181962488 22:26632756-26632778 TGGGGACCAGAACATTCTGCTGG + Intergenic
1182567913 22:31213276-31213298 TGGGGAAGGCAGGAAGCTGCAGG - Intronic
1183086103 22:35488237-35488259 TGGGGGACACAGGCAGCTGCTGG + Intergenic
1183482208 22:38071441-38071463 AGGGGTACACAGCCTGCTGTGGG - Intronic
1183986807 22:41574683-41574705 TGGGGCACAGGGCCTGCTGCTGG + Intronic
1184799667 22:46751912-46751934 TTTGGGACACAGCCTGCTGCAGG + Intergenic
1185135028 22:49065045-49065067 TGGGTAAGACAGCATCCTCCTGG + Intergenic
1203216119 22_KI270731v1_random:6961-6983 TGGGGAACACAGCATTCTCCAGG + Intergenic
1203274502 22_KI270734v1_random:78428-78450 TGGGGAACACAGCGTTCTCCAGG - Intergenic
950298772 3:11855740-11855762 TGGCGAACACATCAAGGTGCTGG + Intergenic
954286822 3:49625244-49625266 TATGGGACACAGCGTGCTGCTGG - Exonic
954448821 3:50560866-50560888 TGGAGGACAGAGGATGCTGCAGG + Intronic
960085125 3:113582299-113582321 TAGGGAACAGATCACGCTGCAGG - Intronic
960844501 3:121993789-121993811 CAGGGAGGACAGCATGCTGCAGG + Exonic
961388436 3:126537590-126537612 TGGGCCACACAGCAGGCTGACGG + Intronic
962909943 3:139838796-139838818 TCAGTTACACAGCATGCTGCTGG - Intergenic
962984189 3:140519724-140519746 TTGGGAAGACAGCATACTGATGG + Intronic
963168623 3:142229514-142229536 AGGGGAACACAGACTGCTGTTGG + Intergenic
964376899 3:156056825-156056847 TGGTCAACACAGCATGCTGCTGG + Intronic
965118662 3:164522325-164522347 TGCTGAACACAGCTTGGTGCGGG - Intergenic
965843998 3:172940032-172940054 TGGTGAACACATCATGGTGCAGG + Intronic
966315622 3:178642438-178642460 TGGGGAGCACAGGGTGGTGCTGG - Intronic
967136393 3:186516189-186516211 AGGGGACCACTGCATGTTGCAGG - Intergenic
968500416 4:947358-947380 AGAGGAACACAGCACCCTGCGGG - Intronic
969318424 4:6395840-6395862 TGGGGAACAAGGCCTGCAGCTGG - Intronic
969387765 4:6867223-6867245 AGGGGAGCACAGAATGCTGTGGG + Intronic
970614916 4:17760028-17760050 TAGGGGACACAGCATGATGCAGG - Intronic
971026448 4:22593401-22593423 TGGGGAACACAACATCTTTCAGG + Intergenic
971241253 4:24890991-24891013 TGGGGAGGCCTGCATGCTGCAGG - Intronic
971586951 4:28416363-28416385 TGGTGAACACAGCAATGTGCTGG + Intergenic
971593811 4:28501824-28501846 TAAGGAACACAGCATGATGCAGG - Intergenic
972763430 4:42129507-42129529 TAGGCAAAACAGCATGCTACTGG + Intronic
973191009 4:47385999-47386021 TGGTGAACACATCAAGGTGCTGG - Intronic
974100723 4:57412924-57412946 TGAGGAATACAGCTTTCTGCTGG + Intergenic
974145613 4:57943775-57943797 TGTGGAGCGCAGCAGGCTGCTGG - Intergenic
975632776 4:76419488-76419510 TGGGGAAGAAAGCATGGTGTTGG + Intronic
975770853 4:77720821-77720843 AGGGAAACACAGCATGCTATTGG + Intronic
977666177 4:99649677-99649699 TGGGAGCCACAGCCTGCTGCTGG + Exonic
979559339 4:122084381-122084403 TGGTGAACACATCAAGGTGCTGG + Intergenic
982397733 4:154930347-154930369 TGACCAACACAGCATTCTGCTGG + Intergenic
983279011 4:165656842-165656864 TGATGAACAGTGCATGCTGCAGG + Intergenic
985040688 4:185888736-185888758 GGGTGGACACAGCAGGCTGCTGG - Intronic
985499674 5:234874-234896 CAGGGATCACAGCCTGCTGCAGG - Intronic
986897832 5:12392392-12392414 TGAGGATCACAGCAGGATGCTGG - Intergenic
987239701 5:15982895-15982917 TGGGCAACACAGCAAGATTCTGG + Intergenic
988529695 5:32016818-32016840 TAGGGCACACTGCATGCTGGGGG - Intronic
992272186 5:75076506-75076528 TGGTGAACACATCAGGGTGCTGG - Intronic
992362325 5:76052641-76052663 TGCCCAACACATCATGCTGCTGG + Intergenic
995852882 5:116564538-116564560 TGCAGAACACAGCTTGCTTCTGG - Intronic
996121723 5:119680731-119680753 TGTGGGGCACAACATGCTGCTGG + Intergenic
996949406 5:129108187-129108209 TGGGGAACACAGTAGGCTAAAGG - Intronic
997465394 5:134084588-134084610 TGGGAACCACAGCAGGCTGGAGG - Intergenic
997815927 5:137017020-137017042 TGGGGGCCACAGCATGCTGCAGG - Intronic
998252434 5:140562034-140562056 TGGGGATCACAGCCTGCAGCCGG + Intronic
1001591955 5:172871737-172871759 TGGGGAACAAAGAATGTTGGCGG + Intronic
1001845130 5:174915656-174915678 TGTGGATCAAAGCATGCAGCGGG - Intergenic
1002335681 5:178476655-178476677 TGGAGTTCACAGAATGCTGCTGG - Intronic
1002937752 6:1687889-1687911 TGGAGAACACTGTAAGCTGCGGG + Intronic
1003378373 6:5600383-5600405 TGGCCAACACAGTATGCTCCTGG + Intronic
1003406305 6:5829703-5829725 CGGGGAACAAACAATGCTGCAGG - Intergenic
1005380482 6:25229288-25229310 TGGAGAACACAGCAAGATGATGG + Intergenic
1007765740 6:44158841-44158863 TGGGGAGTACAGCATGCTGGTGG - Exonic
1008554046 6:52657612-52657634 TGTGGAACAAAACATGCTGCAGG + Intergenic
1011511842 6:88109672-88109694 TGTGGAGCACATCATCCTGCAGG + Intergenic
1012494408 6:99818737-99818759 TGGGGAAAAAAGCATGGTGATGG + Intergenic
1016411562 6:143788511-143788533 TGGGGAAAATAGCATAATGCAGG + Intronic
1018035260 6:159876074-159876096 TGGGGAACAAACCATTCTGGAGG + Intergenic
1018759820 6:166884254-166884276 TGGTGAACACATCAAGGTGCTGG + Intronic
1018806575 6:167266483-167266505 TGGGGAACAAAGACAGCTGCTGG + Intergenic
1018872206 6:167791745-167791767 TGGGCAGCACAGGAAGCTGCTGG - Intronic
1019273992 7:166342-166364 TGGGGGACACAGCAGGACGCAGG + Intergenic
1019935103 7:4249629-4249651 TGGGGAGCACAGGATGGTCCAGG - Intronic
1021918925 7:25464324-25464346 TGGTGAACACATCAAGGTGCTGG - Intergenic
1022240825 7:28511184-28511206 AGGGGCACAGGGCATGCTGCGGG + Intronic
1022691243 7:32657326-32657348 TGGGGAAAACACAGTGCTGCTGG + Intergenic
1022918806 7:34991234-34991256 TGGGGAAAACACAGTGCTGCTGG + Intronic
1023999983 7:45183688-45183710 TGCGGAGCACAGGATGCAGCAGG - Exonic
1024656401 7:51454480-51454502 TGGTGAACACACCCTGGTGCTGG + Intergenic
1026626356 7:71995864-71995886 TGGGGAACAGAGCATTCCCCAGG - Intronic
1026776268 7:73232959-73232981 TGGGGAACACAGAATTCTAGCGG + Intergenic
1027017122 7:74786328-74786350 TGGGGAACACAGAATTCTAGCGG + Intronic
1027070903 7:75159604-75159626 TGGGGAACACAGAATTCTAGCGG - Intergenic
1029428801 7:100515819-100515841 TGGGGAACTCAGGAGGCTGTTGG - Intergenic
1029484230 7:100829444-100829466 TGGGGAACACCTCTTGCAGCAGG - Intronic
1029632399 7:101761187-101761209 TGGTGAACACATCAAGATGCGGG - Intergenic
1031326728 7:120409115-120409137 TTTGGAAAACAGAATGCTGCTGG + Intronic
1032729861 7:134629842-134629864 TGGTGAACACATCAAGATGCTGG + Intergenic
1033133501 7:138765629-138765651 GGGGGAACACAGCTAACTGCAGG + Intronic
1033894865 7:146057119-146057141 TGGGAAAGACAGCATCCTCCAGG - Intergenic
1036386966 8:8290965-8290987 TGGGCAACACAGCAAGATCCTGG - Intergenic
1039979448 8:42395219-42395241 TGGGGAAGACAGCATGGTGCTGG - Intronic
1043398928 8:79864872-79864894 TGGGGAAGGGAGCCTGCTGCGGG + Intergenic
1046312555 8:112457434-112457456 TGGGTCACAGAGCATGCTGTAGG - Intronic
1046722897 8:117640745-117640767 AGGGGTACACAGCCTGCTACGGG - Intergenic
1046972806 8:120241362-120241384 AGGGGAACACAGCGAGATGCAGG + Intronic
1047524727 8:125623030-125623052 TGTGGAACACATCATTTTGCTGG + Intergenic
1049353650 8:142177328-142177350 TGGGGAGAACAGGCTGCTGCAGG + Intergenic
1049576189 8:143391001-143391023 TGGGCAACATAGGAGGCTGCTGG + Intergenic
1050038773 9:1465469-1465491 TGTGGAACAAAGGCTGCTGCAGG - Intergenic
1050702527 9:8357126-8357148 TGAGGAACCCAGCATGCTGTGGG + Intronic
1051997427 9:23234496-23234518 TGCTGAACACACCATGCTGCTGG - Intergenic
1052969954 9:34371303-34371325 TGGGTAGCCCAGCATGCTGACGG + Exonic
1054710456 9:68505700-68505722 TGGTGAACACATCAAGGTGCTGG - Intronic
1055853917 9:80663672-80663694 TGGGTATCCCAGCATGCAGCTGG - Intergenic
1056342594 9:85652552-85652574 TGGTGAACACATCATGGTGCTGG + Intronic
1056789933 9:89618663-89618685 TGGGGAACCCAGCCTGAGGCAGG + Intergenic
1056998332 9:91484565-91484587 TGGGGAACACGGGAGGCAGCAGG - Intergenic
1059978974 9:119748221-119748243 TGCTGAACACAGCTTGATGCTGG - Intergenic
1060702786 9:125773425-125773447 GGGGGAACACAGGATACTACTGG - Intronic
1060804097 9:126564051-126564073 TGGGGCACGCAGCAGGCAGCAGG + Intergenic
1062179141 9:135181320-135181342 TGGGGCACGCAGCCTGCAGCAGG - Intergenic
1062516740 9:136940675-136940697 TGGGGTACACAGGATACTGGGGG - Exonic
1062636457 9:137494081-137494103 TGTGGCCCACAGCATGTTGCAGG - Intronic
1062689966 9:137836591-137836613 TGGAGAACATAGCAGGCTGGAGG - Intronic
1185876716 X:3707984-3708006 TCTGTCACACAGCATGCTGCCGG - Intronic
1187186234 X:16988823-16988845 TGGGGAACATACCATGTTCCAGG + Intronic
1187464954 X:19518931-19518953 TGGGGACAACAGCAAGATGCTGG - Intergenic
1190845744 X:54188754-54188776 TGGGGAAAACAGCATGTTTATGG + Intergenic
1191841774 X:65518362-65518384 TGGAGAAAACAGCCTGGTGCAGG - Exonic
1195166288 X:102223855-102223877 AAGTGAACACACCATGCTGCAGG - Exonic
1195199992 X:102539458-102539480 TGGGGAACTCATCATCCTGAAGG - Intergenic
1195429817 X:104776171-104776193 TGGGGAACAAAGAATGTTGGGGG + Intronic
1197950457 X:131890349-131890371 TGGCAAGCACAGCATGCTGTTGG - Intergenic
1198073121 X:133169138-133169160 GGGGAAAGACAGCATGATGCTGG - Intergenic
1198115590 X:133542010-133542032 TGAGGGACATAGCCTGCTGCAGG + Intronic
1198559244 X:137830744-137830766 TCGGGAACACAGCAAGATGGCGG + Intergenic
1198675329 X:139124844-139124866 TGGGGAAGAAAGCAGGCTGAGGG + Intronic
1199971000 X:152860968-152860990 TGGGGAAAAAAGCAAGTTGCAGG - Intronic
1200179463 X:154141464-154141486 CGGGGCACACACCATGCTGCTGG + Intergenic