ID: 1107951181

View in Genome Browser
Species Human (GRCh38)
Location 13:45463832-45463854
Sequence ATTGTCTGGGTAAAGTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107951181_1107951185 22 Left 1107951181 13:45463832-45463854 CCTTCAGACTTTACCCAGACAAT 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1107951185 13:45463877-45463899 TTTCCACCTGCCTTGACTCCAGG 0: 1
1: 0
2: 7
3: 24
4: 274
1107951181_1107951188 26 Left 1107951181 13:45463832-45463854 CCTTCAGACTTTACCCAGACAAT 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1107951188 13:45463881-45463903 CACCTGCCTTGACTCCAGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 217
1107951181_1107951186 23 Left 1107951181 13:45463832-45463854 CCTTCAGACTTTACCCAGACAAT 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1107951186 13:45463878-45463900 TTCCACCTGCCTTGACTCCAGGG 0: 1
1: 0
2: 5
3: 24
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107951181 Original CRISPR ATTGTCTGGGTAAAGTCTGA AGG (reversed) Intergenic
900649115 1:3722415-3722437 GTGGTCTGGGCAGAGTCTGAGGG + Intronic
904488725 1:30844843-30844865 ATTATCTGGCTAAAGACTGCAGG + Intergenic
907193536 1:52668214-52668236 AATAGCTGGGGAAAGTCTGAAGG + Intronic
909505524 1:76385167-76385189 ATTTTCTGGGTAAAGAAAGATGG + Intronic
912900951 1:113647877-113647899 ATTTTATGGGTGAAGCCTGATGG - Intronic
915514555 1:156405322-156405344 AGTGTAGGGGTAAAGTCTGAGGG - Intronic
915993257 1:160538881-160538903 ATTGTCTGGGTAAGAGATGATGG + Intergenic
916416001 1:164592538-164592560 AGTGTCTGAGCAGAGTCTGAGGG + Intronic
917236824 1:172901789-172901811 AGTGACTGGGAAAATTCTGATGG - Intergenic
917819251 1:178744900-178744922 ATTGTCTGTAGAAAATCTGATGG + Intronic
919351517 1:196461158-196461180 ATTTACTGGTTAAAGTCTAACGG - Intronic
921560574 1:216653551-216653573 ATTCTCAGAGGAAAGTCTGAAGG - Intronic
923022597 1:230176288-230176310 ATTTTCTGGGAAAACACTGATGG + Intronic
924331278 1:242943171-242943193 TTTGTAGGGGTAAAATCTGAGGG - Intergenic
1064927762 10:20588374-20588396 ATTGTCTTGGTAAAGGCTAGAGG - Intergenic
1068811577 10:61261224-61261246 ATGGTATGGGTAAAATCCGAAGG + Intergenic
1069402006 10:68058126-68058148 ATTGTATCTTTAAAGTCTGAAGG + Intronic
1071015345 10:80990355-80990377 ATTTTCTGGAAAAAGTATGATGG - Intergenic
1071929366 10:90450110-90450132 ATTATCTGGTTAAAAACTGAAGG - Intergenic
1074025418 10:109628629-109628651 ATTGTCTGATTTAAGGCTGATGG + Intergenic
1075187337 10:120274936-120274958 AATCTGGGGGTAAAGTCTGAAGG - Intergenic
1075250018 10:120859891-120859913 GTTGTCTGGTTAAACTCTCAAGG - Intronic
1076771282 10:132666618-132666640 ATTGTCTGGGAAAACCCTGAAGG + Intronic
1077740986 11:4845000-4845022 ATTGTTTTGGTAAAGTCTCTAGG - Intronic
1079871077 11:25798670-25798692 ATGGTATGGTTGAAGTCTGAAGG + Intergenic
1084683644 11:70681231-70681253 TTTCTCTTGGCAAAGTCTGACGG + Intronic
1085002115 11:73047796-73047818 ATTTACTGAGTAAATTCTGAGGG - Intronic
1086581459 11:88404433-88404455 AGGGTCTGGGAAAAGCCTGAGGG + Intergenic
1087996937 11:104821137-104821159 CTTGTCTGGGGAAAGATTGATGG + Intergenic
1088082514 11:105935841-105935863 ATTGTTTGGGGAAAAGCTGAAGG + Intronic
1088161894 11:106881950-106881972 ATAGTCTGGGAATATTCTGAAGG - Intronic
1089254619 11:117187743-117187765 GTTGTCTGGGTAAAATGTCACGG + Intronic
1089553354 11:119299180-119299202 ATTGTCTGTTTTAATTCTGAGGG - Intronic
1092218053 12:6696035-6696057 ATTCTCTCAGTAAAGTGTGAAGG + Intronic
1093776373 12:23079720-23079742 ATTGACTGGGTAGAGGATGAAGG + Intergenic
1093846532 12:23978844-23978866 ATTGTCTGGATAGTGTCTAAAGG - Intergenic
1094946379 12:35851488-35851510 ACTGTCTTTGTAAAGTCTGCAGG + Intergenic
1094951486 12:35934725-35934747 ACTGTCTTTGTAAAGTCTGCAGG + Intergenic
1094971257 12:36253699-36253721 ACTGTCTTTGTAAAGTCTGCAGG + Intergenic
1094983361 12:36449378-36449400 ACTGTCTTTGTAAAGTCTGCAGG + Intergenic
1095018255 12:37014143-37014165 ACTGTCTTTGTAAAGTCTGCAGG + Intergenic
1096171917 12:49478520-49478542 ATTGGCTGTGTTCAGTCTGAAGG + Intronic
1096199112 12:49668645-49668667 AGTGTCAGGGTGAAGTCTGAGGG - Intronic
1097865448 12:64556120-64556142 ATTGGGTGGGAAGAGTCTGAGGG + Intergenic
1098067799 12:66638028-66638050 ATGGTGTATGTAAAGTCTGAGGG + Intronic
1098435338 12:70462859-70462881 ATTGTAAGGGCAAACTCTGAGGG - Intergenic
1099186370 12:79519883-79519905 ACTGGCTGGGTAAAGGCAGATGG + Intergenic
1099967855 12:89469744-89469766 ATTGACTGGGTAAATGGTGATGG - Intronic
1102651845 12:114447846-114447868 ACTGTCTGGGGAAAGTCAGCCGG - Intergenic
1107951181 13:45463832-45463854 ATTGTCTGGGTAAAGTCTGAAGG - Intergenic
1108912527 13:55574647-55574669 ATTTTCTGTGTAAAGTGTTATGG - Intergenic
1110466910 13:75812920-75812942 ATTGTTTGGGAAAACTATGAAGG - Intronic
1111936715 13:94565413-94565435 ATTGTATGAGTACAGTGTGATGG + Intergenic
1112023856 13:95394757-95394779 GTGGTCTGGGAAAAGTCTGTTGG + Intergenic
1117077723 14:52121592-52121614 ATGGTCTGGGTAGAGTCAGTTGG - Intergenic
1117413244 14:55469510-55469532 ATTTTCATGGTGAAGTCTGAGGG + Intergenic
1120600369 14:86497372-86497394 ATTGTATGTGTAAAGTCTTCAGG + Intergenic
1126192214 15:45889615-45889637 ATTGTCTAGGTGAAGTCTGGGGG - Intergenic
1127376592 15:58390687-58390709 ACTGTTTGGGAAAAGACTGAAGG + Intronic
1128652659 15:69430480-69430502 ATTGTTTGAGTAGAGTATGATGG + Intronic
1129144519 15:73634432-73634454 AGTGTCTGTGGAAACTCTGAGGG + Intergenic
1130074468 15:80676772-80676794 AATGTCTGGGTCAAGATTGAGGG - Intergenic
1130990293 15:88871985-88872007 ATTGTCTGGGGAAAGGGTGAGGG - Exonic
1135581996 16:23636014-23636036 ATTGTCTGGGAAAAGACTAAAGG - Exonic
1135591465 16:23707950-23707972 CTTGTCTGGGTTATGTCTGTGGG + Intronic
1135793706 16:25422053-25422075 ATTAGCTGGGTACAGCCTGAGGG - Intergenic
1137618583 16:49860811-49860833 ATTCTCTGGGGAAAAGCTGAAGG - Intergenic
1140230994 16:73116964-73116986 AGTGTCTGGGAACAGTCTGAGGG + Intergenic
1144230391 17:13197268-13197290 ATTGAATGGGCAAAATCTGAAGG + Intergenic
1146808952 17:35888302-35888324 CTTGTCTGGGAAAAGTCTTTCGG - Intergenic
1153080285 18:1215313-1215335 ATTTGCTGGGTAAATTATGAGGG - Intergenic
1154130023 18:11728671-11728693 AATGTCTGTGCAAAGACTGAGGG - Intronic
1157576039 18:48744123-48744145 AGTGTCTGGGCACAGTCTGAAGG - Intronic
1159549885 18:69883961-69883983 ACTGCCTGGGCAAAGTCAGAAGG + Intronic
1160820874 19:1057171-1057193 ATGGCCTGGGTAAAGTCTTGAGG + Intronic
1161375366 19:3937088-3937110 ATGGTCTGGGGAAAATCTGAGGG + Intronic
1162342811 19:10102199-10102221 AGTGTCAGGGCAAAGTGTGAAGG + Intronic
1164485136 19:28649629-28649651 ATTGTCTGCTTAAAGCCTGGAGG - Intergenic
1165337156 19:35179094-35179116 ATTGCTTCGGTAAAGTCTGTTGG + Intergenic
1165407124 19:35637758-35637780 TTTGCCTGGGTAAACTCTCAAGG - Intergenic
926882492 2:17562362-17562384 ATTGCTGGGGTGAAGTCTGAAGG - Intronic
928645756 2:33350862-33350884 ATTTTGTGGGTAAGGTCTGAAGG - Intronic
928809773 2:35208852-35208874 AATGTCTGAGGAAAGTGTGAAGG - Intergenic
932144040 2:69303504-69303526 TTTGTCTGTTTAAAATCTGAAGG - Intergenic
932731680 2:74226272-74226294 AATGCCTGGGGAAAGCCTGAGGG - Intronic
933247195 2:79988996-79989018 ATTGTTTGGTTAATGTCTGATGG + Intronic
935848766 2:107196046-107196068 GTTGTTTAGGTAAAGTCTTATGG - Intergenic
937386911 2:121442943-121442965 GTTTTCTAGGTAAAGTCTGCAGG - Intronic
937774788 2:125763337-125763359 AGAGTCTGAGTAGAGTCTGAGGG + Intergenic
940320689 2:152373275-152373297 ATGGTATGGGTGAAGTCTGGTGG + Intronic
940769501 2:157825311-157825333 GTTAACTGGGTAAAGGCTGATGG - Intronic
941646115 2:168043087-168043109 ATTGACTGGGTAAAGTTGGGCGG - Intronic
947051738 2:226052156-226052178 ATTGTATGGGAAAACTGTGAAGG - Intergenic
947094597 2:226551573-226551595 ATCTTCTGAGTAAAGTCTAAGGG + Intergenic
948076924 2:235172293-235172315 GTTTTGTGAGTAAAGTCTGATGG + Intergenic
1169415028 20:5408828-5408850 TTGGTCTGGGAAAAGTCTGTTGG - Intergenic
1170162866 20:13333059-13333081 ATTGTGTAAGTGAAGTCTGATGG - Intergenic
1171236080 20:23526234-23526256 CCTGTCTGTGTAAAGACTGAGGG + Intergenic
1173062629 20:39676577-39676599 ATTGTCTGTGATAAGGCTGATGG + Intergenic
1174392584 20:50226950-50226972 CTTGTCTGGGTATAGGCTGGTGG + Intergenic
1175468559 20:59209463-59209485 ATTGAGTGGATAAAGTCTCAGGG + Intronic
1178031822 21:28536504-28536526 ATTCTCTGGCTAAAACCTGAAGG + Intergenic
1184840161 22:47047958-47047980 ATGGTCTGGGGAAAGACTGAGGG - Intronic
958459587 3:94377986-94378008 ATTGTAGGGCTGAAGTCTGAGGG + Intergenic
960528761 3:118740058-118740080 ATGGTGCAGGTAAAGTCTGAAGG - Intergenic
965482892 3:169242391-169242413 TTTGTTTGGGTAGAGTCTAAGGG - Intronic
967553432 3:190826498-190826520 TTTGTGAGGGTAAATTCTGATGG - Intergenic
969124904 4:4939969-4939991 GTTTTGTGAGTAAAGTCTGATGG - Intergenic
971678102 4:29660731-29660753 ATTTTTTGTGTAAAATCTGAAGG - Intergenic
971998066 4:33993160-33993182 ATTGTCTGGGTTAAGTTAAAGGG + Intergenic
973692508 4:53452190-53452212 ATTCTTTTGGTAAAGTCTGTTGG + Intronic
980287449 4:130798791-130798813 ACTGTCTGGGAAAAATATGAAGG + Intergenic
980683092 4:136188863-136188885 CTTGTTTGGGTTAAGTCTGATGG - Intergenic
982163145 4:152590022-152590044 ATAATCTGTTTAAAGTCTGAAGG + Intergenic
982719388 4:158843951-158843973 ATTTCCTGGACAAAGTCTGAGGG + Intronic
987204729 5:15613463-15613485 ATTGTTTTGGTTAACTCTGAGGG + Intronic
987241463 5:16004331-16004353 ATAGTCTAGCTAAACTCTGAGGG - Intergenic
990827216 5:59914433-59914455 ATTGTCAGGACAAAGTCTGTGGG + Intronic
990905877 5:60802327-60802349 AATGTTTGGGAAAATTCTGATGG + Intronic
992927110 5:81599553-81599575 TTTTCCTTGGTAAAGTCTGAGGG + Intronic
993775927 5:91995529-91995551 ATTGTCATGGGGAAGTCTGAAGG - Intergenic
994037811 5:95222958-95222980 ATGGTGTGGATGAAGTCTGAAGG + Intronic
995646461 5:114318265-114318287 AAAGTATGGGTAAAATCTGAAGG - Intergenic
996994804 5:129682604-129682626 ATAGTCTGGGTATAGTCGTAAGG + Intronic
998944302 5:147321036-147321058 ATGGTCTGGGTCAAGCATGATGG + Intronic
999216418 5:149939241-149939263 GTTTCCTGGGTAAACTCTGACGG + Intronic
999856251 5:155597598-155597620 ATTGTCTGGATAATGTCTGCAGG - Intergenic
1001028242 5:168242452-168242474 GTTAACTGGTTAAAGTCTGAAGG + Intronic
1002257971 5:177973104-177973126 ATTATCTGGGTAATCTCTTATGG + Intergenic
1008034228 6:46729397-46729419 AGTGGGTGGGTAAAGTTTGAGGG - Intronic
1009814406 6:68712522-68712544 AATGTATGAGTAAAGTCAGAGGG + Intronic
1011915678 6:92503406-92503428 ATTGTCCTGGTAAAGTCTCCTGG + Intergenic
1012292397 6:97473457-97473479 AGTGTCTAGGTAATGTCTGAAGG + Intergenic
1014624327 6:123707503-123707525 ATTGTCTGCATAAAATATGAAGG - Intergenic
1015108352 6:129563986-129564008 ATTGTATGGGTAAAATGTAATGG - Intergenic
1015671755 6:135698799-135698821 ATTATCTGGGTAAAATCTATAGG - Intergenic
1017614734 6:156233154-156233176 ATTTCCTGGGAAAACTCTGAAGG - Intergenic
1019120640 6:169801218-169801240 ATTCTCTTGGCAAAATCTGAGGG - Intergenic
1019255020 7:44064-44086 AGTGTCTGGGGAAAGGCTGAGGG - Intergenic
1026612516 7:71872934-71872956 AATGACTGGGTAAGGTTTGAAGG + Intronic
1027198956 7:76050377-76050399 GATGTTTGAGTAAAGTCTGAAGG + Intronic
1031250652 7:119376099-119376121 ATAGTTTGGTTCAAGTCTGAAGG + Intergenic
1033127817 7:138720410-138720432 ATTGTCTGGATATAGATTGAGGG + Intronic
1036097091 8:5736537-5736559 ATTTTCTAGTTCAAGTCTGATGG + Intergenic
1039600023 8:38828661-38828683 ATTTTCAGGGGAAGGTCTGAGGG + Intronic
1039615128 8:38949519-38949541 ATTGTTTGGGCAAAGTCAGTGGG + Intronic
1043608792 8:82035755-82035777 ATTATCTGTGTAAAGAATGAAGG - Intergenic
1044305737 8:90638542-90638564 ATAGTCTGGGAAAGGACTGAGGG - Intronic
1048827977 8:138448153-138448175 ATTGTTTGGGGAAGGTGTGATGG + Intronic
1050797473 9:9562275-9562297 ATTTTCTAGGTAAATTTTGAAGG - Intronic
1056467472 9:86871862-86871884 ATTTTGTAAGTAAAGTCTGATGG - Intergenic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1058275016 9:103029173-103029195 ATTATCTGGGTTTAGTATGAAGG - Intergenic
1058807035 9:108602706-108602728 ATTGGCAGGGGAAAGACTGAAGG + Intergenic
1060269087 9:122128518-122128540 GGTGTCTGGGTAGAGACTGATGG - Intergenic
1060411307 9:123402287-123402309 ACTTTCTGGGCAAAGTCTGAGGG + Intronic
1060411366 9:123402645-123402667 GTTGTCTGGATAGAGACTGAGGG + Intronic
1061357955 9:130120513-130120535 ATCTTCAAGGTAAAGTCTGACGG - Intronic
1061539838 9:131272284-131272306 ATTGTCTGGGTCAAGTCCAGTGG + Intronic
1187665045 X:21598224-21598246 CTTGTCTGTGTAAAATCTGTGGG + Intronic
1188611712 X:32107545-32107567 ATATTGTGGTTAAAGTCTGAAGG + Intronic
1190346757 X:49344744-49344766 ATTGTCTCGATAAAGTTTCAGGG + Intronic
1190348006 X:49535771-49535793 ATTGTCTCGATAAAGTTTCAGGG + Intronic
1190349107 X:49545327-49545349 ATTGTCTCGATAAAGTTTCAGGG + Intronic
1190350211 X:49554883-49554905 ATTGTCTCGATAAAGTTTCAGGG + Intronic
1190351313 X:49564442-49564464 ATTGTCTCGATAAAGTTTCAGGG + Intronic
1190352413 X:49573995-49574017 ATTGTCTCGATAAAGTTTCAGGG + Intronic
1190353514 X:49583543-49583565 ATTGTCTCGATAAAGTTTCAGGG + Intronic
1190354616 X:49593065-49593087 ATTGTCTCGATAAAGTTTCAGGG + Intronic
1190462280 X:50689452-50689474 ATGATGTGGGTAAAGTCTTAGGG - Intronic
1191169766 X:57431503-57431525 CTTCTCTGGGGACAGTCTGAGGG - Intronic
1195160671 X:102167679-102167701 ATTATCTAGGAGAAGTCTGAGGG - Intergenic
1195931144 X:110077901-110077923 ATTGTCCTTGGAAAGTCTGATGG + Intronic
1196114739 X:111986563-111986585 ATTGCCTGGGAAAAGTGTAACGG - Intronic
1197807267 X:130409846-130409868 ATTCTCTAGTTAAAATCTGATGG + Intronic
1198706401 X:139453338-139453360 CTTGTCTGGGTAAAGTATTTTGG - Intergenic
1202070472 Y:20986777-20986799 ATTCTCTGTGAAAAGACTGAAGG + Intergenic