ID: 1107952923

View in Genome Browser
Species Human (GRCh38)
Location 13:45481071-45481093
Sequence CTACAATCATGAACTAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107952923 Original CRISPR CTACAATCATGAACTAAAAG GGG (reversed) Intronic
906735857 1:48126838-48126860 GTACAAAGATGAACTAAAAATGG + Intergenic
907063975 1:51461007-51461029 CTCTAAGGATGAACTAAAAGAGG + Intronic
907096349 1:51784813-51784835 TTGCAATGTTGAACTAAAAGAGG + Intronic
907570839 1:55482102-55482124 CCACAATGATGACCTAAATGGGG + Intergenic
913362328 1:117995383-117995405 ATACAATGGTGAACTAAAACAGG - Intronic
915075179 1:153302360-153302382 CTACAATCCTGAAGAAAAAGAGG + Intronic
915368253 1:155327248-155327270 CTACAGCCATGAGCTAAAAATGG + Intronic
916006708 1:160668011-160668033 CCAAAATCAAGAATTAAAAGGGG - Intergenic
919268007 1:195298301-195298323 CTAGAATCATGAACTATTATTGG + Intergenic
920565260 1:206967908-206967930 CTACCATCATGCTCTGAAAGGGG + Intronic
921464549 1:215471081-215471103 CTACAAACATGGAATAAATGAGG + Intergenic
923389835 1:233503092-233503114 CTACATTCATGAAGATAAAGAGG - Intergenic
923708689 1:236367527-236367549 CTACAAAAATGAAATAAAATGGG - Intronic
923754956 1:236783780-236783802 CTACAATCATTGTCTAAAATTGG - Intergenic
923985773 1:239380230-239380252 TTAAAATCATCATCTAAAAGAGG + Intergenic
924005392 1:239604435-239604457 TTTCAGTCATAAACTAAAAGAGG - Intronic
1073174130 10:101541169-101541191 CTAAGATCATGAACAAAAAAGGG - Intronic
1074292345 10:112147642-112147664 CTAGAATCATGAAATAGAAGTGG + Intergenic
1074963428 10:118468520-118468542 CACCCATCATGAACTAGAAGGGG + Intergenic
1078632921 11:13019906-13019928 CTACAAAAATTAACTAAAAATGG - Intergenic
1079534092 11:21490139-21490161 CAACAATGATGAACTAGCAGAGG + Intronic
1080072794 11:28109966-28109988 CTCCAATTTTTAACTAAAAGTGG - Intronic
1080150386 11:29045689-29045711 CAACAATCAAGAGCTAACAGGGG - Intergenic
1082892125 11:58151064-58151086 ATACAAAAATGAACTAAAAATGG - Intronic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1085547403 11:77332655-77332677 TTACAAACATGAAGTAAAAAAGG + Intronic
1085569152 11:77544172-77544194 CTTAAATCATGAATTAAAAAGGG + Intronic
1085846699 11:80074198-80074220 ATAAAGTCAGGAACTAAAAGTGG + Intergenic
1086364441 11:86094194-86094216 TTACACTCATGAACTACAAAAGG - Intergenic
1087591004 11:100187774-100187796 ATACAATAATTAACTAAAAATGG + Intronic
1089336575 11:117728358-117728380 CTAAAATCAGGAACAAAACGAGG + Intronic
1092437163 12:8458795-8458817 CTCAAAACATGAACTAAGAGCGG + Intronic
1094164415 12:27427687-27427709 CAACCATCATGAATTACAAGAGG - Intergenic
1098518418 12:71406462-71406484 CTACAATCAAGAACAAAACAAGG + Intronic
1099493010 12:83309018-83309040 CTACAATGATGAAAGAAAGGGGG - Intergenic
1099583585 12:84485507-84485529 ATAGAATTATTAACTAAAAGAGG - Intergenic
1100683421 12:96956745-96956767 CTACAAAAATAAACTCAAAGTGG + Intergenic
1100761587 12:97813159-97813181 ATACAATCATGAGCTAAATAAGG + Intergenic
1101033523 12:100682975-100682997 CAAAACTTATGAACTAAAAGTGG - Intergenic
1101945783 12:109135698-109135720 ATACAATCATTAACTCAAAATGG - Intronic
1106666643 13:31858272-31858294 CTATTTTCATGATCTAAAAGGGG + Intergenic
1106791538 13:33160283-33160305 CTATAAAAATGAACTAAAAATGG + Intronic
1106927564 13:34629573-34629595 ATACAAGGATGAACAAAAAGGGG - Intergenic
1106954155 13:34917154-34917176 CTACAATCACAATCTAAAATGGG - Intergenic
1107850649 13:44569369-44569391 CCACAATAATCATCTAAAAGAGG + Intronic
1107952923 13:45481071-45481093 CTACAATCATGAACTAAAAGGGG - Intronic
1108370567 13:49763352-49763374 CGTCAATTATGAAATAAAAGAGG + Intronic
1109258624 13:60115621-60115643 ATACAAACATGAACTAAAGATGG - Intronic
1110884020 13:80610015-80610037 CGAAAATCATGAACTAGTAGTGG + Intergenic
1111626828 13:90798411-90798433 ATAAAATCTTGTACTAAAAGGGG + Intergenic
1112399882 13:99067379-99067401 CTAAGATCCTCAACTAAAAGAGG + Intronic
1112930258 13:104726569-104726591 ATACAAAAATGAACTCAAAGTGG - Intergenic
1114138190 14:19877802-19877824 CTTTGATGATGAACTAAAAGTGG - Intergenic
1114916782 14:27277837-27277859 CTACATTCAGTAACTAAAACTGG + Intergenic
1114952252 14:27770046-27770068 CTACAAAAATGAACTCAAAGTGG + Intergenic
1116657370 14:47669614-47669636 CCACGATCATGAAAGAAAAGTGG - Intronic
1118208433 14:63745031-63745053 CTACAAAAAGGAACAAAAAGAGG + Intergenic
1124389797 15:29244161-29244183 CTACATTAATAAACTAAAGGAGG + Intronic
1127247117 15:57189088-57189110 CTACAGTAATGAACTCAAAATGG + Intronic
1128198053 15:65778274-65778296 CTACAATTTTGACCAAAAAGGGG + Intronic
1129417780 15:75397307-75397329 CTCCAATTATGAACAAAAAATGG + Intronic
1134439664 16:14291336-14291358 CTACATTCAAGAATTAAAAATGG + Intergenic
1136658971 16:31737471-31737493 TTACAAACATGAACTCAAAATGG - Intronic
1138816087 16:60204478-60204500 CCAGAAGCATGAACTGAAAGGGG + Intergenic
1138832044 16:60386246-60386268 CTACTATCCTGAACAAATAGAGG + Intergenic
1139148469 16:64351341-64351363 ACAGAATCATTAACTAAAAGAGG + Intergenic
1145749908 17:27348166-27348188 ATACAACCATGAACTTGAAGGGG + Intergenic
1150870204 17:68900242-68900264 CTAAGATCAGGAACAAAAAGAGG + Intronic
1151018055 17:70580016-70580038 ATACAATCATGAGCCTAAAGAGG + Intergenic
1151295767 17:73185112-73185134 CAAGGAGCATGAACTAAAAGGGG + Intergenic
1153274655 18:3356141-3356163 CTACAAAAATCAACTCAAAGTGG + Intergenic
1153279224 18:3398604-3398626 TCACAATAATAAACTAAAAGGGG - Intergenic
1155877727 18:31107067-31107089 ATACAAGCATGAACAAAAAAAGG - Intergenic
1156035694 18:32765333-32765355 ATACAAGCATGAATTAAAACTGG + Intronic
1156611323 18:38728473-38728495 CTACAATCATGAAGGAAATGAGG - Intergenic
1156961336 18:43035449-43035471 CTTCAGTCAGGAACTAAGAGAGG - Intronic
1159754794 18:72351083-72351105 TTTCAATCAAGCACTAAAAGGGG + Intergenic
1168065637 19:53918568-53918590 TTACATTCATGATCTAAATGAGG - Intronic
926643799 2:15266325-15266347 CTACAATTAAAAACTAAAAGAGG + Intronic
928428025 2:31194884-31194906 CTACCATCAAGAAATAAAAATGG + Intronic
928771674 2:34709510-34709532 CTAGAAGAATGAACTAAAATAGG + Intergenic
935129105 2:100247965-100247987 CTACCATCTTAAACAAAAAGAGG - Intergenic
940228487 2:151425501-151425523 CTACATTCAAGATCTAAAACTGG - Intronic
942382031 2:175401583-175401605 TTACAATTATGATCTAAATGTGG - Intergenic
943087570 2:183331700-183331722 CTACAAAAATTAACTCAAAGTGG + Intergenic
943936303 2:193920421-193920443 TTACAATCATGAAAGCAAAGGGG - Intergenic
944502278 2:200374428-200374450 CTACAACCATGTACATAAAGTGG - Intronic
945872573 2:215244156-215244178 CTACTATCACAAACTTAAAGTGG - Intergenic
1169237785 20:3945933-3945955 TTACATTCCTGAACTAAAAATGG + Intronic
1169566163 20:6855819-6855841 CTTCAAGCAGGAAATAAAAGGGG - Intergenic
1169746568 20:8949249-8949271 ATAAAATCATGAGCTAAAATGGG - Intronic
1170235070 20:14094187-14094209 CTACAATTATGAGCTAGGAGGGG - Intronic
1171300632 20:24057056-24057078 CTACAAAAATTAACTAAAAATGG + Intergenic
1172059760 20:32179123-32179145 ATACAAACATGAACTCAAAATGG - Intergenic
1173186429 20:40843877-40843899 GTACAACAATGAACTAAAAGAGG - Intergenic
1173778649 20:45735150-45735172 ATACAAAAATGAACTAAAATGGG + Intergenic
1174892265 20:54408732-54408754 GTACATTCCTGAACCAAAAGTGG + Intergenic
1175427203 20:58875813-58875835 CAACAGTCAGGAAATAAAAGAGG + Intronic
1177074920 21:16559423-16559445 TTACAAACATGAAATAAATGGGG + Intergenic
1178186859 21:30232127-30232149 ATACAATCATGAACTCAAGATGG + Intergenic
1178211523 21:30539221-30539243 CTATAATCATTAACTAAAATGGG + Intergenic
952015136 3:28947735-28947757 CTACAATCATGAACTAAAGAGGG + Intergenic
954290479 3:49647365-49647387 GGACAATCATCAACTAACAGTGG - Intronic
954477351 3:50760153-50760175 ATACAAAAATGAACTAAAAATGG - Intronic
956639173 3:71398895-71398917 TTACACTCATGAAGTAAAAGCGG - Intronic
959036640 3:101374290-101374312 CTACAAAAATTAACTCAAAGTGG + Intronic
961334790 3:126166564-126166586 CTATAAACATGCACTAAAAGTGG - Intronic
961913316 3:130344193-130344215 TCACAATCATGAAATAAAAGTGG - Intergenic
962067511 3:131997363-131997385 CTACAAGCAGCAACAAAAAGGGG + Intronic
963232282 3:142920427-142920449 CTAATATCAGGAATTAAAAGAGG - Intergenic
964475419 3:157093396-157093418 CTAGCGTCATGAACTGAAAGTGG + Intergenic
965744621 3:171911941-171911963 CTAAAATCAGGAATGAAAAGGGG - Intronic
966065093 3:175811620-175811642 CTACTATCATGAATTAAACAAGG - Intergenic
967563276 3:190943158-190943180 CTACAATCATCCATTAAAACAGG - Intergenic
969271062 4:6102625-6102647 CAACAGTAATGAACTAAAACAGG + Intronic
972412034 4:38805040-38805062 CTACACTGATGAAGTAAATGAGG + Intronic
973748396 4:53987041-53987063 CCACAATGATGAACACAAAGGGG - Intronic
974977684 4:68911292-68911314 CTACAATCACCAACCAAAAAAGG - Intergenic
977303407 4:95294539-95294561 CTACAGTCATGAGCTATAATGGG - Intronic
977698777 4:99997056-99997078 CTTCAATTCTGAACTAAGAGAGG - Intergenic
981285497 4:143013695-143013717 CTATAAAAATCAACTAAAAGTGG - Intergenic
981383571 4:144100952-144100974 CTGCCATCTTGATCTAAAAGGGG + Intergenic
983882746 4:172951723-172951745 GTATAATCATGAAATAACAGAGG + Intronic
991946973 5:71907603-71907625 CTACACTGATGACCTAACAGAGG + Intergenic
994770733 5:103978267-103978289 ATACAAAAATCAACTAAAAGTGG + Intergenic
995919476 5:117294334-117294356 ATACAAACATGAACTCAAGGTGG - Intergenic
996049931 5:118920803-118920825 CTACATTCATAAAGTAAATGGGG + Intronic
1004535692 6:16499154-16499176 ATACAAAAATGAACTAAAAATGG - Intronic
1009370639 6:62896890-62896912 CTATAATCATGTAATAAAAGTGG - Intergenic
1009492248 6:64305725-64305747 ATACAATAATTAACTAAAAATGG + Intronic
1010272737 6:73932978-73933000 ATACAATCTTGAACTAAAAATGG + Intergenic
1013991148 6:116254841-116254863 TTACAATCTTAATCTAAAAGTGG + Intronic
1014689037 6:124538836-124538858 ATACAATCATTAAATAAAAGGGG - Intronic
1014733550 6:125064598-125064620 CTAAAATGAAGAAGTAAAAGAGG + Intronic
1018499300 6:164387900-164387922 CTACAATGATGATCTGAAATGGG - Intergenic
1023328683 7:39089296-39089318 ATACAGTCATGAACTGAAAAAGG - Intronic
1023658257 7:42448020-42448042 TTACATTCATTAACTAAAACAGG + Intergenic
1024620224 7:51150681-51150703 CTAGAATCATCTACTGAAAGTGG - Intronic
1034320994 7:150181669-150181691 CTACCATCATAAAATTAAAGAGG + Intergenic
1034745772 7:153522697-153522719 ATACCATCATGAAGTAAAACAGG + Intergenic
1034771752 7:153785572-153785594 CTACCATCATAAAATTAAAGAGG - Intergenic
1035688439 8:1543345-1543367 CTGCAAAAATGAACTCAAAGTGG - Intronic
1036706254 8:11049268-11049290 CTCCAAACAAGAATTAAAAGAGG - Intronic
1036713189 8:11095831-11095853 ATACAACCATGAATTAAATGTGG - Intronic
1036946701 8:13100874-13100896 TTAAAATCATGAAGTACAAGGGG - Intronic
1040746348 8:50647051-50647073 CTACAAACATTAACTCAAAATGG + Intronic
1044157484 8:88866034-88866056 ATACAATAATCAACTAAAAATGG - Intergenic
1046241774 8:111505827-111505849 TCACAAAAATGAACTAAAAGTGG - Intergenic
1046294925 8:112205189-112205211 CTACAAAAATCAACTCAAAGTGG + Intergenic
1046861678 8:119099825-119099847 ATACTATCATGTACTAACAGAGG - Intronic
1048316124 8:133363642-133363664 CTAAAAGAATGAAGTAAAAGAGG - Intergenic
1051303964 9:15687672-15687694 CTGAAATCATGAACGAAAGGGGG + Intronic
1052197719 9:25737680-25737702 ATACAATATTGAACCAAAAGTGG - Intergenic
1058584328 9:106491072-106491094 ATACAAAAATGAACTCAAAGTGG + Intergenic
1059823586 9:118001157-118001179 CTTCAATGATGAACAAGAAGAGG - Intergenic
1059969141 9:119646929-119646951 CTATAATCATGAAAGCAAAGGGG - Intergenic
1062604179 9:137336815-137336837 CTAAAAGCATGAAAAAAAAGAGG + Intronic
1187219889 X:17313928-17313950 CTAAAATATTGAACTTAAAGAGG + Intergenic
1189313840 X:40039541-40039563 CTACAAAAATTAACTAAAAATGG - Intergenic
1189749650 X:44207190-44207212 ATACAAAAATGAACTAAAAATGG + Intronic
1190257209 X:48772538-48772560 CTACAATAAATAAATAAAAGGGG + Intronic
1190988851 X:55524832-55524854 CTACCCTCATGAAGCAAAAGTGG + Intergenic
1191989879 X:67023294-67023316 ATACAATAATGAACTCAAACTGG - Intergenic
1192695545 X:73411704-73411726 CTAGACTGATGAACTAAATGTGG - Intergenic
1193018295 X:76760773-76760795 CTACATCAATGAAATAAAAGAGG + Intergenic
1193902752 X:87203332-87203354 CTACAAAAATGAACCAAAATAGG + Intergenic
1196583477 X:117402472-117402494 TTACAATCAGGCCCTAAAAGTGG + Intergenic
1196598098 X:117568418-117568440 CCACAATCAGAAACTGAAAGTGG - Intergenic
1196651040 X:118168689-118168711 CTAGAATCATGTGCCAAAAGTGG + Intergenic
1197413250 X:126143691-126143713 ATACAAAAATCAACTAAAAGTGG + Intergenic
1197852295 X:130875639-130875661 ATACAACAATGAACTAAAATCGG + Intronic
1198362961 X:135914007-135914029 CTAGAATCAAGAAGTAAAACTGG - Intergenic
1199584742 X:149402579-149402601 CTAAAATCAGGAACGAAAAAGGG - Intergenic
1199885205 X:152014157-152014179 CTACTATCATGGACTATAGGAGG + Intergenic