ID: 1107957441

View in Genome Browser
Species Human (GRCh38)
Location 13:45529804-45529826
Sequence TCTTATATGCAGTTGCCGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107957441 Original CRISPR TCTTATATGCAGTTGCCGCA AGG (reversed) Exonic
901408030 1:9063057-9063079 TTTTATTTGCATTTGCCTCATGG - Intronic
914776284 1:150738748-150738770 TCTTATATGCACGTGGCTCATGG - Intronic
917195793 1:172464487-172464509 GCTTATATGCATTTTCCTCAAGG + Intronic
921869845 1:220128179-220128201 TCATATATGCAGTTTCAGCAGGG + Intronic
922057788 1:222057948-222057970 TTTTATGTGCAGATGCCACAGGG + Intergenic
1069468482 10:68663926-68663948 TCTTAGCTGCAGTTGCCTCTTGG + Intronic
1073641220 10:105254575-105254597 TCTTACATGCAGGTTCTGCAGGG - Intronic
1074817269 10:117151827-117151849 TCTTAGATTCAGATGCCTCAAGG - Intergenic
1084638253 11:70407720-70407742 TCTTATATTCATTTACTGCATGG - Intronic
1093925406 12:24903828-24903850 TCTTATATGCAGTGTTCGCCTGG + Intronic
1094324732 12:29224889-29224911 TTTTATATGCCTTTGCCTCAAGG - Intronic
1098266574 12:68727789-68727811 TCGTATATGCAGGTTCTGCAGGG - Intronic
1098961936 12:76747954-76747976 GCTGATATGCAGTTGCACCAGGG - Intergenic
1107957441 13:45529804-45529826 TCTTATATGCAGTTGCCGCAAGG - Exonic
1114480464 14:23030621-23030643 TCATATATGCAGGTTCTGCAGGG - Intronic
1117348741 14:54860071-54860093 TCATATATGCAGGTTCTGCAGGG - Intronic
1118064190 14:62172888-62172910 TCTGATATGCAGGTACCGAAGGG + Intergenic
1128761652 15:70220149-70220171 TCATATATGCAGGTTCTGCAGGG - Intergenic
1136656555 16:31712736-31712758 TCTTTTATCCAGTTGGCTCAGGG - Intergenic
1149134002 17:53343017-53343039 ACTTATATGTAGTTGGCTCAAGG - Intergenic
1152889779 17:82873903-82873925 TCTTTTGTGCAGTTTCCACAGGG + Intronic
1158626402 18:59075492-59075514 TCATATATGAAGTTGCCATAGGG - Intergenic
929727734 2:44448175-44448197 TCATATATGCAGTTTCTGCAGGG - Intronic
942887949 2:180951551-180951573 TCTTATATGCTCTTGCTGCTGGG - Intergenic
944509902 2:200454133-200454155 TCTTCCATGCATTTGCCTCAGGG - Intronic
947811407 2:233006358-233006380 TCTAATGTGCAGGTGCCTCAAGG + Intronic
1170007003 20:11680512-11680534 TCTTATAAGCAGTTGACTCCTGG - Intergenic
1171319369 20:24226564-24226586 TATTATATCCAGTTGACTCATGG - Intergenic
1173431992 20:42996347-42996369 TCTCATATGCAGTCGCTGCAGGG - Intronic
1180938363 22:19640901-19640923 TCTTGTGTGCAGTTGTCTCATGG + Intergenic
1184325145 22:43777281-43777303 TCGTATATCCAGTTGCCTCGCGG - Intronic
957026556 3:75188864-75188886 TCTTTTATGCACTTACCTCAAGG + Intergenic
957417520 3:79925612-79925634 TCGAATATGCAATTGCCACAGGG - Intergenic
965728002 3:171739936-171739958 TCTTACATGGACTTGCCCCAGGG - Intronic
969326900 4:6449315-6449337 TGTTCTCTGCAGCTGCCGCAGGG - Intronic
975362470 4:73486969-73486991 TTTTATATGAAGTTGCCAGAAGG + Exonic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
977546274 4:98383544-98383566 TCTTATATTTATTTGTCGCATGG + Intronic
979326783 4:119389635-119389657 TCTTATATGCAGTCACACCATGG - Intergenic
982971305 4:161991661-161991683 TCATATATGCAGTTTCCACAGGG + Intronic
985585931 5:734164-734186 TCTGATATGCAGCTCCCACATGG + Intronic
985600348 5:825576-825598 TCTGATATGCAGCTCCCACATGG + Intronic
985972087 5:3386367-3386389 TCTAATATGCAGCTGCTGCTGGG + Intergenic
986473610 5:8100754-8100776 TCCTATATGCAGGTCCCACAGGG - Intergenic
994314505 5:98316643-98316665 TTTTAAATGCAGTTGCCCCAAGG + Intergenic
1001361682 5:171091936-171091958 TCATATATGCAGGTTCCACAGGG + Intronic
1004486717 6:16073128-16073150 TCATATATGCAGGTTCCTCAGGG - Intergenic
1006552126 6:34833205-34833227 TCATATATGCAGGTCCCTCAGGG + Intronic
1009383892 6:63066422-63066444 ACTTCAATGCAGTTGCAGCAGGG + Intergenic
1030008278 7:105139886-105139908 TCTGATATGCAGGTGCCTCTCGG + Intronic
1030416636 7:109252391-109252413 TCTCATATGCAGTTTCCATAGGG + Intergenic
1034507414 7:151504428-151504450 TCATATATGCAGATTCTGCAGGG - Intronic
1045315323 8:101038964-101038986 TCTTCTTTGCAGTTGGCTCAAGG + Intergenic
1046440844 8:114252127-114252149 TCTTGTATGCTGTAGCTGCAGGG + Intergenic
1048873624 8:138818844-138818866 TTTTATATGCAGTTGCTGAGGGG - Intronic
1050694903 9:8267872-8267894 TCTCATATTCATTTGCCGCAAGG + Intergenic
1051769987 9:20567009-20567031 TCCTATATGCGGTTGCTGGACGG - Intronic
1054791036 9:69256928-69256950 TCATAGATGCAGGTGCCGCTGGG - Intergenic
1056098376 9:83277022-83277044 TGTTATATCCAGTTTTCGCAGGG + Intronic
1186786227 X:12958115-12958137 TCTTATATGCTGTTGTTGGAAGG - Intergenic
1187768582 X:22670166-22670188 TCTTGTGTGCAGTTGCAGAAAGG - Intergenic
1190755487 X:53397869-53397891 TCTTAAATGCAGTTGTAGCTTGG - Intronic
1197146414 X:123177417-123177439 TCTTATATGTGGTTGCTTCAAGG - Intergenic