ID: 1107957622

View in Genome Browser
Species Human (GRCh38)
Location 13:45531826-45531848
Sequence TGTAGTGGAGAGGAGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 850
Summary {0: 1, 1: 0, 2: 4, 3: 75, 4: 770}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107957619_1107957622 1 Left 1107957619 13:45531802-45531824 CCAGAATCTTTTGAGGAGTGTTA 0: 1
1: 0
2: 0
3: 15
4: 150
Right 1107957622 13:45531826-45531848 TGTAGTGGAGAGGAGAAAGATGG 0: 1
1: 0
2: 4
3: 75
4: 770
1107957618_1107957622 5 Left 1107957618 13:45531798-45531820 CCAGCCAGAATCTTTTGAGGAGT 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1107957622 13:45531826-45531848 TGTAGTGGAGAGGAGAAAGATGG 0: 1
1: 0
2: 4
3: 75
4: 770
1107957615_1107957622 11 Left 1107957615 13:45531792-45531814 CCATACCCAGCCAGAATCTTTTG 0: 1
1: 1
2: 5
3: 85
4: 744
Right 1107957622 13:45531826-45531848 TGTAGTGGAGAGGAGAAAGATGG 0: 1
1: 0
2: 4
3: 75
4: 770
1107957614_1107957622 14 Left 1107957614 13:45531789-45531811 CCACCATACCCAGCCAGAATCTT 0: 1
1: 5
2: 103
3: 808
4: 4733
Right 1107957622 13:45531826-45531848 TGTAGTGGAGAGGAGAAAGATGG 0: 1
1: 0
2: 4
3: 75
4: 770
1107957617_1107957622 6 Left 1107957617 13:45531797-45531819 CCCAGCCAGAATCTTTTGAGGAG 0: 1
1: 0
2: 3
3: 10
4: 161
Right 1107957622 13:45531826-45531848 TGTAGTGGAGAGGAGAAAGATGG 0: 1
1: 0
2: 4
3: 75
4: 770

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107957622 Original CRISPR TGTAGTGGAGAGGAGAAAGA TGG Intronic
900091060 1:920933-920955 TGGGGTGGGGAGGAGAGAGATGG - Intergenic
900343673 1:2200744-2200766 TGTGGTGGACAGGAGACCGAGGG - Intronic
900608165 1:3533035-3533057 TGTAGTGGAGAGTGGAGAGAAGG - Intronic
900655244 1:3753685-3753707 TGTGCTGGAGAGGGGACAGAGGG + Intronic
901103318 1:6736210-6736232 AGGAGTGGAGAGGAGAAGGAGGG - Intergenic
901155873 1:7137831-7137853 GGCAGTGGAGAGGAGGGAGATGG - Intronic
901164894 1:7212750-7212772 TGTAGGGGAGGGGAGGAAGTGGG - Intronic
902977859 1:20101838-20101860 CCTAGGGGAGAGGAGAAAGCTGG + Intergenic
904460542 1:30676857-30676879 TGTAAGGGAGTGGAAAAAGAAGG - Intergenic
904859592 1:33525510-33525532 TGGAGTAGAGAGTAGAATGATGG + Intronic
905865401 1:41373776-41373798 TGCAGTGGAGAAGGGATAGAAGG - Intronic
906039583 1:42777876-42777898 TGGATTGGAGAGGGGACAGAGGG - Intronic
906444283 1:45881197-45881219 TTTAATGGAGAAGAAAAAGATGG + Intronic
906540041 1:46578362-46578384 AGTAGGGGAGAGAAGAAACATGG + Intronic
906915443 1:50004518-50004540 TCCAGAGGAGAGGAGAAGGAAGG + Intronic
907412426 1:54292147-54292169 GGCAGTGCAGGGGAGAAAGAGGG - Intronic
908036256 1:60057317-60057339 TGAAGTGGATTGAAGAAAGAAGG + Intronic
908352940 1:63303904-63303926 TGTGTTGGGGAGGAGGAAGAAGG + Intergenic
908484377 1:64576159-64576181 TGAAGGGGAAAGGATAAAGAAGG + Intronic
908572740 1:65426298-65426320 TGTAGTGGAGTGGCAAAAGAAGG + Intronic
908688669 1:66752694-66752716 TGTTGGGGAGAGGAGGAATAAGG - Intronic
909204757 1:72741473-72741495 AGAAGAGGAGGGGAGAAAGAAGG - Intergenic
910847900 1:91621416-91621438 TGTGGTGGAAAGGAGGAAGGAGG - Intergenic
911139364 1:94482099-94482121 AGGTGTGGAGAGGAGATAGAAGG + Intronic
911329894 1:96514884-96514906 TAAAGTGGACAGGAAAAAGAGGG + Intergenic
912030861 1:105241779-105241801 TGAAGAAGAGAGGAGAAATATGG + Intergenic
912661053 1:111530925-111530947 TCTAAAGGAGAGGAGAAATAGGG - Intronic
913197320 1:116468412-116468434 TGTGGGGGAGAGGGGAAGGAGGG - Intergenic
913281188 1:117186649-117186671 TGAAGTGGAGAGGGAAAATAAGG - Intronic
913374695 1:118138058-118138080 TATATTGGAAAGGAGAAGGAGGG - Intronic
914439456 1:147691103-147691125 AGGAGAGGAGAGGAGAAAGGGGG - Intergenic
914855246 1:151345963-151345985 TGTGGGGAAGAGGAGAAAGCTGG + Intronic
915518663 1:156428867-156428889 TGTAGTGGAGATGGGAAGGAAGG - Intronic
915669063 1:157472185-157472207 TGACGTGGAGAGGATAAGGATGG - Intergenic
915736809 1:158090372-158090394 TGTGGGGGAGAGGAGAAAGGAGG - Intronic
915912661 1:159924312-159924334 TGTAGTGGGGAGGAGAAACTGGG + Intronic
916193780 1:162204212-162204234 TGTAGGGCAGCAGAGAAAGAAGG - Intronic
916616692 1:166448976-166448998 TGCACTGGAGAGGAGAGCGAAGG - Intergenic
916633180 1:166638522-166638544 CTTAGTGAAGAGAAGAAAGATGG - Intergenic
916931520 1:169582965-169582987 TCTAGTTGAGAGGTGAGAGATGG + Intronic
917659008 1:177159399-177159421 TGTAGTGGAGAGAAAAAAGAAGG + Intronic
918505342 1:185247658-185247680 TGTAGGGGAAAGCATAAAGAAGG + Intronic
918518847 1:185392373-185392395 GGCAGTGGAGAGGTGACAGATGG - Intergenic
918881551 1:190130515-190130537 TGTGGTGGACAGGAGGCAGAAGG - Intronic
919218093 1:194587268-194587290 AGCTGAGGAGAGGAGAAAGAGGG - Intergenic
920048598 1:203149729-203149751 TGTTGTTGAGATGAGCAAGAAGG + Intronic
920171049 1:204072877-204072899 TGTAGAGAAGAGAAGAAAGAAGG - Intergenic
920270724 1:204761748-204761770 TCTAGAGGAGAGGAAAAAGAGGG + Intergenic
920496804 1:206460719-206460741 TCTAGTGGGGAAGAGAAACACGG - Intronic
921451813 1:215317533-215317555 TGTAGTGGAGTGGGGAGAGAGGG - Intergenic
921615494 1:217261390-217261412 TGAAGAGGAGAAGAAAAAGAAGG + Intergenic
922426007 1:225494158-225494180 AGAAGTGGAGAGGAGAATGGAGG + Exonic
922757589 1:228105203-228105225 TGTGGTGGAGAGGGGATAGCAGG + Intronic
923096251 1:230777591-230777613 TGTAGAGGACAGGAGAGAGCTGG - Intronic
923115686 1:230935585-230935607 TGCAGTGGAGAGGGAAAAGATGG + Intronic
923142490 1:231172488-231172510 TGTGGTGTGGAGGAGAGAGAGGG + Intronic
923592099 1:235328210-235328232 TCTAGGGGAGGGGAGAAAGGGGG - Exonic
923746548 1:236706011-236706033 TTAAGTGGAGAGGTTAAAGATGG - Intronic
923871313 1:237997125-237997147 TGTAAGGAAGAGAAGAAAGAAGG - Intergenic
924178503 1:241417625-241417647 TGGACTGGAGAGAAGAAATAGGG - Intergenic
924392262 1:243575350-243575372 GGCACTGGAGAAGAGAAAGAGGG + Intronic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1064041779 10:11972528-11972550 TGTCGTGGAGTGGAGGGAGAGGG - Intronic
1064687038 10:17873610-17873632 TGTTGTGGAGGGCAGAATGAAGG - Intronic
1065107025 10:22399301-22399323 TATAATTGAGAGGAGGAAGAGGG - Intronic
1065117477 10:22496847-22496869 TGGAGTTGAGAGGAGAAGGCAGG - Intergenic
1065291852 10:24238394-24238416 TTTAGAGGTGAGAAGAAAGAGGG + Intronic
1065399908 10:25287336-25287358 TGTAGGGGAGAAAAGAAAGGTGG + Intronic
1065761143 10:28984421-28984443 ATTAGTGGAGAGGAGAGAGAAGG + Intergenic
1065862167 10:29881112-29881134 AGGAGTGGACAGGAGACAGATGG + Intergenic
1066199803 10:33133882-33133904 TAAAATAGAGAGGAGAAAGATGG + Intergenic
1066446962 10:35492178-35492200 TCCAGTGGTGAGGAGACAGACGG - Intronic
1068017267 10:51532847-51532869 AGAAGGGGAGAGGGGAAAGAGGG - Intronic
1068030333 10:51698235-51698257 TGTAATGGAGAGGAGAGGAATGG - Exonic
1068056903 10:52022722-52022744 GGCAGTGGACAAGAGAAAGAGGG + Intronic
1068762330 10:60726295-60726317 TGGAGTGGAAAGGAGAAACCTGG - Intronic
1068763400 10:60736339-60736361 TGTAGTGGAGATGTATAAGAAGG - Intergenic
1068949889 10:62766217-62766239 TTTAGCAGAGAGGAGAGAGAGGG - Intergenic
1069940559 10:71952452-71952474 AGAAGGGGAGAGGAGAAATAAGG + Intergenic
1069940963 10:71954956-71954978 ACTAGTGGAGAGGAGCAGGAGGG + Intergenic
1070399238 10:76038527-76038549 AGTAGAGCAGAGGAGAAAAAAGG - Intronic
1070489997 10:76967339-76967361 TTTACTGGAGAGTAGAAAGCAGG + Intronic
1070544023 10:77438739-77438761 TGTTGTGGAGAGAAGGAATAAGG - Intronic
1070961403 10:80502544-80502566 TGTAGGGCAAAAGAGAAAGAAGG + Intronic
1070963659 10:80516492-80516514 TGTATTGGGGAGGAGAATGGTGG + Intronic
1071033896 10:81218757-81218779 AGTAGAAGGGAGGAGAAAGAGGG - Intergenic
1071229784 10:83572103-83572125 GGTAGTGGAGAGGAAAGAGAGGG + Intergenic
1071573277 10:86709578-86709600 GGTAGGGGAGAGGAGAGAGATGG - Intronic
1072344367 10:94488896-94488918 ACTTGAGGAGAGGAGAAAGAAGG - Intronic
1072773337 10:98163604-98163626 TGTAGTAGAGAGGAGAACAGGGG + Intronic
1073072548 10:100803729-100803751 GGAAGTGGGGAGGAGAAAGGAGG - Intronic
1073936014 10:108632912-108632934 AGAAGTAGAGAGGAGAAAGATGG - Intergenic
1074435504 10:113430927-113430949 TGTATTGGAGAGAAGAGAAAAGG + Intergenic
1074581512 10:114723593-114723615 GGTGGTGGAGAGGAGGAGGATGG - Intergenic
1075330947 10:121573656-121573678 GGAAGGGGAGAGGAGAAAGAGGG + Intronic
1075947809 10:126453440-126453462 GGGAGTGAAGGGGAGAAAGAAGG + Intronic
1076619131 10:131775797-131775819 GGGAGTGGAGAGGAGAAGGAGGG + Intergenic
1077359433 11:2134196-2134218 TGTGGGGGAGAGGGGGAAGACGG - Intronic
1077772513 11:5235509-5235531 TGGAGAGGAGAGGAGAAAAAAGG + Intergenic
1078025016 11:7686903-7686925 TCCTGTGGAGAGCAGAAAGATGG + Intergenic
1078610718 11:12816808-12816830 TTTAGTGGAGGGGACAAAGTGGG + Intronic
1078721036 11:13883348-13883370 TGCAGTGGGGAGGGGAGAGAAGG + Intergenic
1078869563 11:15330762-15330784 AGTAGTGGAGTAGAGAAGGATGG - Intergenic
1079333442 11:19551873-19551895 AGGAGAGGAGAGGAGAAGGAGGG - Intronic
1079523279 11:21354353-21354375 AGGAGAGGAGAGTAGAAAGAAGG - Intronic
1079897878 11:26145814-26145836 TGTTGTGGAGTGGGGGAAGAGGG - Intergenic
1080189845 11:29531384-29531406 AATAGTGAAGATGAGAAAGAAGG + Intergenic
1080230635 11:30015501-30015523 TTTGGTGTAGAGCAGAAAGAGGG - Intronic
1080816656 11:35764289-35764311 TGTAATGGTGAGCAGAAGGAAGG - Intronic
1080944632 11:36957886-36957908 TAGGGTGAAGAGGAGAAAGATGG + Intergenic
1081077993 11:38699579-38699601 AATAGAGGAAAGGAGAAAGAAGG - Intergenic
1081925908 11:46828094-46828116 TGTTGTGGATAGGAGAAATTGGG - Intronic
1083622223 11:64054915-64054937 TGAAGAGCAGGGGAGAAAGAGGG - Intronic
1083622594 11:64056479-64056501 TGTACTAGAGAGAAGACAGACGG + Intronic
1083629048 11:64086421-64086443 TGGACTGGAGAGTAGAAAGCTGG - Intronic
1083848543 11:65351835-65351857 TGTGAAGGAGAGGAGGAAGAAGG - Exonic
1083967032 11:66049270-66049292 AGTAGGGGAGAGGGGAGAGAGGG + Intergenic
1084551340 11:69844517-69844539 GTTAGTGGAGAAGAAAAAGATGG + Intergenic
1084902607 11:72321102-72321124 TTTGGAGAAGAGGAGAAAGAAGG + Intronic
1085348032 11:75780671-75780693 TGTTGTGGGGAGCAGAGAGAAGG + Intronic
1085547634 11:77334697-77334719 TTTAGTGGAGAGGAGGAAAATGG - Intronic
1085590481 11:77755188-77755210 TGGATTGCAGAGGAGCAAGAAGG + Intronic
1086217279 11:84399191-84399213 GGTAGTGAAGAGGATACAGAGGG - Intronic
1086329429 11:85738845-85738867 GGAAGGGGAAAGGAGAAAGATGG - Intronic
1086417785 11:86606378-86606400 TGTTGTGGACAGCAGAGAGATGG + Intronic
1086580234 11:88391063-88391085 TGTAGTGGAAGGGATACAGAGGG - Intergenic
1086874820 11:92082951-92082973 TGGAGTGGAGAGGAGAAGTTAGG + Intergenic
1087237390 11:95735115-95735137 GGTAGTGAAGTGGAGAAAGGAGG + Intergenic
1087812688 11:102625149-102625171 TCTAGGGCAGAGGAGCAAGAAGG + Intronic
1088246438 11:107822506-107822528 TGTTCTGGGGAGAAGAAAGAGGG - Intronic
1088322377 11:108567456-108567478 GGTTTTGGAGAAGAGAAAGATGG - Intronic
1088639710 11:111859631-111859653 TGCAGTGTAGAGGACAAAGGGGG + Intronic
1089786401 11:120910438-120910460 GGCAGTGGAGATGAGAAGGATGG + Intronic
1090410890 11:126508904-126508926 TCGAGTGGAGAGAAGAGAGAAGG - Intronic
1090518647 11:127455338-127455360 TGTATTTGAGAGGAGCATGAAGG - Intergenic
1091144412 11:133265134-133265156 AGGAGTGGAGAGGAGAGAGAGGG + Intronic
1091151329 11:133331023-133331045 TGTATTGGAAAGCAGATAGAGGG - Intronic
1091158305 11:133394584-133394606 TGGAGCGGAGAGCAGAAGGATGG - Intronic
1092856743 12:12681195-12681217 GGGAGGGGAGAGGAGAGAGAAGG - Intronic
1093254121 12:16844742-16844764 TGTGGTGGTGAGCAGAAACAAGG + Intergenic
1093796494 12:23319331-23319353 GGTAATAGAGAGTAGAAAGATGG - Intergenic
1094003629 12:25723788-25723810 TGTAGGTGAGAGGAGAAATACGG + Intergenic
1094456166 12:30636123-30636145 TGCTGTGGAGGGGAGAAAAAGGG + Intronic
1095787470 12:46125471-46125493 AGGGGAGGAGAGGAGAAAGAGGG + Intergenic
1095902035 12:47338012-47338034 AGGAGAGGAGAGGAGAAAGAAGG - Intergenic
1096306076 12:50477163-50477185 TTTAGTAAAGATGAGAAAGATGG + Exonic
1096710394 12:53451774-53451796 AGAAGTGGAGAGGAGGAAAAAGG - Intergenic
1097022758 12:56032537-56032559 TGTGGAGGAGAGTGGAAAGATGG - Intronic
1097036826 12:56129602-56129624 TGGAAAGGGGAGGAGAAAGAGGG + Intronic
1097223829 12:57465317-57465339 TGTAGGGGAAAGGTGAAGGAAGG + Intronic
1097982299 12:65746844-65746866 TTGAATGAAGAGGAGAAAGAAGG + Intergenic
1097992223 12:65848034-65848056 TTTAGTGGAGAGGCATAAGATGG - Intronic
1098470318 12:70835988-70836010 AGTAGTGGAAAGGGGAAAAAGGG - Intronic
1099186456 12:79520795-79520817 TGCTGTGGAGAGAAGACAGATGG + Intergenic
1099602310 12:84756689-84756711 GGTATTGAAGATGAGAAAGAGGG - Intergenic
1099833053 12:87870066-87870088 AGAAGAGGAGAGGAAAAAGAAGG + Intergenic
1100158028 12:91824544-91824566 TCAAATGGAGAAGAGAAAGAAGG + Intergenic
1100247242 12:92771539-92771561 TGAGGTGGAGGGGAGAAAAAGGG + Exonic
1100293975 12:93243689-93243711 TGTGGTCTAGAGGAGAAACACGG - Intergenic
1100582813 12:95951219-95951241 AGAAGGGGAGAGGAGAAAAATGG - Intronic
1100663942 12:96729866-96729888 TGAAGGGGAGTAGAGAAAGAGGG + Intronic
1100935250 12:99657300-99657322 TGTAGTGGTGAGGGGAGAGTAGG - Intronic
1101058398 12:100944535-100944557 TGTGGAGGAAAGGAGAAATATGG - Intronic
1101209874 12:102525061-102525083 TGTTGTGGAGAGGAGATGGAGGG + Intergenic
1102394234 12:112574151-112574173 GGTAGTGGAGAAGAAAAAGGGGG + Intronic
1102568294 12:113811644-113811666 GGGAGTGGGGAGGAAAAAGAGGG - Intergenic
1102592823 12:113969862-113969884 TGCAGTTGGGAAGAGAAAGAGGG - Intergenic
1102642146 12:114376451-114376473 AGCAGTGGAGAGGAGAATGGTGG + Intronic
1103085063 12:118056455-118056477 CCTAGTGGAGGGGAGACAGATGG - Intronic
1104085927 12:125474250-125474272 GGGAGGGGAGGGGAGAAAGAAGG - Intronic
1104517708 12:129443150-129443172 TGTAGAGGAGAGGAGGAAGCCGG - Intronic
1104950422 12:132437476-132437498 TGGAGGGGAGAGAAGAAGGAAGG + Intergenic
1105329671 13:19403880-19403902 TTTGGTAGAGAGGACAAAGATGG + Intergenic
1106086628 13:26548485-26548507 TGCGTTGGAGAGGAGAAAGGAGG - Intergenic
1106122084 13:26868672-26868694 TGTAAAGGAGAGCAGAAAAATGG - Intergenic
1106323052 13:28659775-28659797 AGTGGTGGGGAGGAGAAGGAGGG - Intronic
1106375566 13:29183481-29183503 TGGAGTTCAGAGGAGAAAGTTGG + Intronic
1106452892 13:29899701-29899723 TGAAGTAGAGAGGAGAATGGTGG - Intergenic
1106935105 13:34709605-34709627 AGTAGTGGGGAGGGGAGAGAGGG + Intergenic
1107072583 13:36286914-36286936 AGGAGTGGAGAGGAGAAAGGAGG - Intronic
1107381501 13:39861513-39861535 GGTAGTGGAGAGGAGGGAAAGGG + Intergenic
1107763661 13:43710138-43710160 AGGAGGGGAGAGGAAAAAGAGGG + Intronic
1107957622 13:45531826-45531848 TGTAGTGGAGAGGAGAAAGATGG + Intronic
1108507684 13:51127460-51127482 GGTAGTAGAGAGGATAAAAAGGG - Intergenic
1108513686 13:51177557-51177579 TCTAGTGTAGGGGACAAAGATGG - Intergenic
1108552579 13:51561129-51561151 TCTATTGGATAGGAGAAATATGG + Intergenic
1108810374 13:54215839-54215861 TTTAGTGGACAGGGTAAAGATGG - Intergenic
1108862876 13:54883824-54883846 TGAAGTGGACAGTGGAAAGAAGG - Intergenic
1108973859 13:56411642-56411664 TGTGGTAGAGAGCAGAATGATGG + Intergenic
1109032728 13:57214032-57214054 AGAAGTGGAGAGTAGAATGATGG + Intergenic
1109183573 13:59243582-59243604 TGAAGTGGAGGAGAGAATGAAGG - Intergenic
1109531602 13:63655910-63655932 TGTAGTGGAAATGAGGGAGATGG - Intergenic
1109642685 13:65211070-65211092 TGCAGTGCAGAGGAGAAATTAGG - Intergenic
1110111370 13:71750142-71750164 TGGAGTGGGGAGGAGAAGCAGGG - Intronic
1110127573 13:71966019-71966041 GGAAGAGGAGAGGAGGAAGAGGG + Intergenic
1110189514 13:72714898-72714920 AGTAGTGCAGAGGGGAAATATGG + Intronic
1110782157 13:79479137-79479159 TGTAATGAGGAAGAGAAAGAGGG - Intergenic
1111076955 13:83249195-83249217 GTTAGAGGAGAGGAGAAGGAAGG - Intergenic
1111478380 13:88785197-88785219 TGAAGAGGAGTGGTGAAAGAGGG + Intergenic
1111745470 13:92263420-92263442 TGTATTGGAGAGGAAAAAGAAGG - Intronic
1113110229 13:106814743-106814765 TGTAGAGGAGAGGAAACACATGG + Intergenic
1113285275 13:108839723-108839745 TGTAGTGAGGAGGAGGAAGTAGG - Intronic
1113424857 13:110199551-110199573 TCTAATGGAGAGGAAAATGAAGG + Intronic
1113683967 13:112266364-112266386 TGAATAGGAGTGGAGAAAGAGGG - Intergenic
1113993494 14:16048215-16048237 TGTAGTGGTGAGAAGGTAGATGG + Intergenic
1113998049 14:16104303-16104325 TGGAGTGGAGAGGAGGGAAACGG - Intergenic
1114647496 14:24263739-24263761 TGTAGAGCAGCTGAGAAAGAAGG - Intronic
1115006969 14:28497970-28497992 TTTACTGTAGGGGAGAAAGAAGG - Intergenic
1115363741 14:32533223-32533245 TGTAATGTAGAGGAGTAAAAGGG + Intronic
1115603924 14:34981850-34981872 TGTAGTGGGGAGGGGAAAAGAGG - Intergenic
1115962151 14:38847221-38847243 TGTAGGGGAATGAAGAAAGAAGG + Intergenic
1116014433 14:39389279-39389301 TGGACTGAAGGGGAGAAAGATGG + Intergenic
1116732701 14:48644768-48644790 TGTCGTGGTAAGGAGAAGGAGGG + Intergenic
1117419803 14:55533019-55533041 TGGGGTGGAGAGGGGAGAGAAGG + Intergenic
1117804215 14:59473793-59473815 TGTAGAAGAGATGAGAAGGAAGG + Intronic
1118198553 14:63650889-63650911 TGGAGTTAAGAGGAGAAAAAAGG + Intergenic
1120200471 14:81533474-81533496 TGGAGTGGGGTGGAAAAAGAAGG - Intronic
1120760074 14:88276824-88276846 TGTAGCTGAGCAGAGAAAGAGGG - Intronic
1121020228 14:90575481-90575503 TGTAGGGAAGAGGACAGAGAGGG + Intronic
1121398423 14:93648669-93648691 GGTAGAGGAGGGGAGAATGAGGG + Intronic
1121482614 14:94290647-94290669 TGGAGAGGAGAGGATAGAGATGG + Intronic
1124716994 15:32072933-32072955 GGTAGTGCTGAGGGGAAAGATGG + Intronic
1125158928 15:36620926-36620948 TTTAGTAAAGATGAGAAAGATGG + Intronic
1125178418 15:36852565-36852587 AGGAGAGGAGAGGAGAAAAAAGG + Intergenic
1125526323 15:40377651-40377673 GGTACTGGAGAGGAGAAAGGTGG + Intergenic
1126105703 15:45145594-45145616 GGTAGTGGAGTGGAGAAACATGG + Intronic
1126674430 15:51147122-51147144 TGTAGGGGAGAGGATAAAGTTGG - Intergenic
1126729891 15:51672066-51672088 AGTACAGGAGTGGAGAAAGAGGG + Intergenic
1128445671 15:67757904-67757926 TGCAGAGGAGAGGAGACTGAAGG + Intronic
1129177881 15:73853024-73853046 TGTAGGGGAGGGGAGGAAGCAGG - Intergenic
1129254181 15:74324886-74324908 TGGAGTGGGAAGGAGGAAGAGGG - Intronic
1130693171 15:86104178-86104200 GGTATTGGGGAGGATAAAGATGG + Intergenic
1130969354 15:88720067-88720089 TATAGCGGAGAGGAGCCAGAAGG - Intergenic
1131382607 15:91976183-91976205 TGTACTGGGGAGAAGATAGATGG + Intronic
1131660099 15:94505194-94505216 TGGAGGGGAGAGGTGGAAGAGGG - Intergenic
1131902285 15:97100855-97100877 TGTAATGGAGAGCAGAACCATGG - Intergenic
1131996977 15:98142749-98142771 GGTAGTGGGGAGGGGAGAGAGGG - Intergenic
1132330106 15:101006736-101006758 TGTATTTGTGTGGAGAAAGAGGG + Intronic
1133214532 16:4283566-4283588 TTGAGGGGAGAGGAGAAGGAAGG - Intergenic
1133502036 16:6375818-6375840 TGCAGGGGACAGGAGAGAGAAGG - Intronic
1133900345 16:9968213-9968235 TGCAGGGGAGAGAAGAAGGAAGG - Intronic
1134593561 16:15476709-15476731 TGAAGGGGAGGGGAGAGAGACGG + Intronic
1134846994 16:17448685-17448707 TGGAGGGGGGAGGAGGAAGAGGG + Intronic
1135864320 16:26086946-26086968 AGTGGAGGAGAAGAGAAAGAAGG - Intronic
1135979668 16:27138180-27138202 ATGTGTGGAGAGGAGAAAGAAGG + Intergenic
1137314189 16:47299452-47299474 TGTTGGGTAGAGGAGAAAGCAGG + Intronic
1137380033 16:47989473-47989495 AGAAGTGGAGAGTAGAATGATGG + Intergenic
1137524098 16:49218717-49218739 TGTAAGTGAAAGGAGAAAGAGGG - Intergenic
1137554967 16:49464768-49464790 TGGTGTGGAGTGGAGCAAGAAGG + Intergenic
1137643300 16:50052646-50052668 GGAAGTGGAGAGTAGAATGATGG + Intergenic
1137982407 16:53081040-53081062 TGGAGTGGGAAGGAGAAGGAAGG - Intronic
1138403894 16:56772631-56772653 TGTAGGGCAGTGGAGAAACAAGG - Intronic
1138784329 16:59828609-59828631 AGGAGGGGAGAGGAGAAAAAAGG + Intergenic
1139529133 16:67533734-67533756 TTGAAAGGAGAGGAGAAAGATGG + Intronic
1139846596 16:69925588-69925610 TGTGCTGGAGAGGGGAGAGATGG - Intronic
1140337207 16:74118739-74118761 GGGAGGGGAGAGGAGAAGGAGGG + Intergenic
1140376119 16:74446672-74446694 TGAAGAGTAGAGGAGGAAGAAGG - Intergenic
1140419295 16:74804949-74804971 TGGAGGGGAGGGGAGAAGGAGGG - Intergenic
1140903610 16:79392323-79392345 AGGAGGGGAGAGGAGAGAGAAGG + Intergenic
1141164362 16:81650584-81650606 AATAATGGAGAGGAGGAAGATGG + Intronic
1141221932 16:82078876-82078898 AGTAGTGGAGAGGACTAAGGAGG + Intronic
1141331275 16:83113692-83113714 TTGAGTGGAGAGTAGAAGGATGG + Intronic
1141692784 16:85606055-85606077 TGTGGTGGAGGTGAGAAGGAGGG - Intergenic
1141808478 16:86357988-86358010 GGTGGTGGGGAGGGGAAAGAGGG - Intergenic
1142254373 16:89006815-89006837 GGGAGTGGGGAGGAGATAGAGGG - Intergenic
1142281220 16:89148693-89148715 GGCAGTGAAGAGGAGAAAGATGG - Intronic
1143180370 17:4980623-4980645 TGGAGTGGAGAGGAGTAGGAGGG + Intronic
1143939988 17:10530461-10530483 TATTGTGGAGAGGAGCAGGAGGG + Intronic
1143994457 17:10994533-10994555 AGTAGGGCAGAGGGGAAAGAAGG + Intergenic
1144322116 17:14136727-14136749 TATAGTGAAGATGACAAAGATGG + Intronic
1144387808 17:14766138-14766160 GGCAGTGGAGAGGAGAGAAATGG - Intergenic
1144769707 17:17752704-17752726 TGTGGTGGTGAGGAGAGGGAGGG - Intronic
1145217993 17:21066574-21066596 TGTGGTGCAGAGGAGAGAGGAGG + Intergenic
1145339214 17:21939483-21939505 TGTAATGGAAAGGAGAAGAATGG + Intergenic
1145344286 17:21979131-21979153 TGCAGTGGAGTGGAGAAAAGTGG + Intergenic
1145707002 17:26879924-26879946 TGTAGTGGAGTGGAGTAGTATGG + Intergenic
1145969412 17:28947961-28947983 TTTAGATGAAAGGAGAAAGAAGG - Intronic
1146400254 17:32495793-32495815 GGGAGGGGAGAGGAGAAAGGAGG + Intronic
1146424702 17:32725674-32725696 TCTAAAGGAGAGGAGACAGAAGG + Intronic
1146666688 17:34709863-34709885 GCAGGTGGAGAGGAGAAAGATGG - Intergenic
1146940616 17:36841913-36841935 TGTTGGGGTGAGGAGAGAGATGG - Intergenic
1147389141 17:40098899-40098921 TGAAGTGGAAAGGAGTGAGAAGG + Intronic
1148375544 17:47141915-47141937 TGTAGTGGTGAGAAGGTAGATGG + Exonic
1148435892 17:47684752-47684774 AGTGGTGGAGAGGAGGAAAATGG + Exonic
1149021432 17:51970035-51970057 AGGAGTGGAAAGGGGAAAGATGG + Intronic
1149125663 17:53228164-53228186 TACAGTGGAAAAGAGAAAGAAGG - Intergenic
1149813476 17:59700904-59700926 TGGAGTAGAGAAGAGAAAGGCGG + Exonic
1149857422 17:60095023-60095045 TTCAGTGAAGAGGAGAAAAAGGG + Intergenic
1149878501 17:60263736-60263758 TCTGGCAGAGAGGAGAAAGAAGG + Intronic
1150073629 17:62173594-62173616 GGGAGTTGAGAGAAGAAAGATGG - Intergenic
1150503983 17:65680097-65680119 TTTAGAGGAGAGCAGAAAGGTGG + Intronic
1151052487 17:70994316-70994338 AGGTGTGGAGATGAGAAAGATGG - Intergenic
1151809106 17:76425957-76425979 TCTTGTGGGGAGGAGATAGAAGG - Intronic
1152008474 17:77696720-77696742 TGTAATGGACAGGAAAAAGCAGG + Intergenic
1152095539 17:78269738-78269760 GGGAGGGGAGAGGAGGAAGAGGG - Intergenic
1152505285 17:80745823-80745845 TGTATTTGAGAAGGGAAAGAAGG + Intronic
1152834901 17:82523127-82523149 TGCAGTAGAGATGAGTAAGAAGG + Intronic
1152993808 18:387407-387429 TGATGGGGAGATGAGAAAGAAGG - Intronic
1153601438 18:6784472-6784494 TGTAGTGGAGGGTAGGAAGGTGG - Intronic
1153669450 18:7396574-7396596 TAGAGTGGAGAGCAGAAAGCGGG - Intergenic
1153881952 18:9428868-9428890 TGAAGAGGAGAGAAGAAAGGAGG - Intergenic
1155599109 18:27523757-27523779 TGTAGAGGAGTGGAAAGAGATGG - Intergenic
1156476292 18:37407768-37407790 TGTCCTGGAGAGCAGACAGAAGG - Intronic
1156631173 18:38971135-38971157 TGGAGTGCAGAGGGGAATGAGGG - Intergenic
1157137341 18:45069538-45069560 GGAGGAGGAGAGGAGAAAGAAGG - Intergenic
1157931773 18:51831539-51831561 TGTCGTGGGGTGGAGGAAGAGGG + Intergenic
1158270595 18:55710786-55710808 TGAAGTGGGAAGGAGAAAGTGGG - Intergenic
1158323851 18:56293324-56293346 TGTACAGGAGAGCAGAAAGATGG + Intergenic
1158905665 18:62008941-62008963 TGCAGAGGAAAGGAGAAAGCGGG - Intergenic
1159688326 18:71452408-71452430 TGAAGTAGAGAGGAAAATGATGG + Intergenic
1159709785 18:71742660-71742682 GGTTGTGGAAAGGAGAAACAAGG + Intronic
1159981723 18:74789466-74789488 TGTAGTGGAGAGGAGAATATGGG + Intronic
1160062924 18:75548956-75548978 TGTCGGGGAGAGGAGAGGGAAGG + Intergenic
1160146532 18:76370269-76370291 TGTATTGGGGAGGAGGAAGTCGG - Intronic
1160193511 18:76734603-76734625 TGTCGAGGAGAGGAGAAGAAGGG + Intergenic
1161101979 19:2425903-2425925 TGTTGGGGAGAGAAGAAAGGGGG - Exonic
1161754165 19:6119428-6119450 TGGAGAGGAGAGGAGAGGGAGGG - Intronic
1161762094 19:6181285-6181307 GGGAGGGGAGGGGAGAAAGAAGG + Intronic
1162205650 19:9054320-9054342 GGAAGTGAGGAGGAGAAAGAAGG - Intergenic
1163288409 19:16363652-16363674 TGAAGTGGAAATGAGAAGGAGGG + Intronic
1164037386 19:21466794-21466816 TGTAGTGGGGAGGAGCAAGGAGG - Intronic
1164292707 19:23881891-23881913 GGTGGAGGAGAGGAGAAAAAGGG + Intergenic
1166152158 19:40882304-40882326 TGTAGTTGGGAGGTGAAATAAGG - Exonic
1167161284 19:47768897-47768919 AGTAGGAGAGAGGAGAAAGAAGG + Intergenic
1168115776 19:54220827-54220849 TGTCCTGGAGAGAAGAAGGATGG + Exonic
1168118760 19:54240573-54240595 TGTCCTGGAGAGAAGAAGGATGG + Exonic
1168125091 19:54278559-54278581 TGTCCTGGAGAGAAGAAGGATGG + Exonic
1168172168 19:54596170-54596192 TGTCCTGGAGAGAAGAAGGATGG - Exonic
1168176891 19:54632997-54633019 TGTCCTGGAGAGAAGAAGGATGG - Exonic
1168182610 19:54672329-54672351 TGTCCTGGAGAGAAGAAGGATGG - Intronic
1168187681 19:54710088-54710110 TGTCCTGGAGAGAAGAAGGATGG - Intergenic
925110202 2:1328549-1328571 TGAACGGGACAGGAGAAAGAAGG + Intronic
925554440 2:5114430-5114452 AGCAGTGGAGAGGAGAAATGTGG + Intergenic
925594556 2:5542649-5542671 TGCACTGAACAGGAGAAAGATGG + Intergenic
925797301 2:7560302-7560324 GGAAGTAGAGAGTAGAAAGATGG + Intergenic
926019953 2:9486063-9486085 TTTAGGGGAGAGGAAAAAGTTGG - Intronic
926563657 2:14445502-14445524 GGTAGTGCAGAGGACGAAGATGG - Intergenic
926659371 2:15446101-15446123 TGTATTGGGAAGGAGAAACAAGG + Intronic
927236985 2:20883474-20883496 TGGAGGAGAGGGGAGAAAGAAGG - Intergenic
927932465 2:27053872-27053894 TGAAGAGCAGAGGAGGAAGAGGG - Intronic
928137561 2:28699648-28699670 TGTAGTGGGAAGGAGATTGATGG - Intergenic
928157482 2:28889954-28889976 TGAAGGGTAGAGGAGAAAAAGGG - Intergenic
928404391 2:31003590-31003612 AGTGGTGGGGAGGAGAGAGATGG - Intronic
928429357 2:31205103-31205125 TTGAGTGGAGAGGAGAGAGTAGG + Intronic
928690775 2:33796486-33796508 TGTAGTTGATAGGAAAAAAAAGG + Intergenic
929126776 2:38529549-38529571 TGCAGGGGAGAGGAGAACTATGG - Intergenic
929141923 2:38674074-38674096 GGGAGTGGAGAGGTGAAGGAAGG + Intronic
929184905 2:39083552-39083574 AGTAGATGGGAGGAGAAAGATGG + Intronic
929687793 2:44049312-44049334 AGGAGAGGAGTGGAGAAAGAGGG + Intergenic
929865713 2:45715731-45715753 TGTAGTGCAAAGAAGACAGAGGG - Intronic
929915415 2:46131542-46131564 TGGAGTGGGGAGGAAAGAGAGGG + Intronic
930021377 2:47004041-47004063 AGGAGAGGAGTGGAGAAAGAAGG - Intronic
930327718 2:49941372-49941394 GGTAGAGGAGAGGAGAGAAAAGG - Intronic
930484608 2:51996781-51996803 TGCAGTGGAGGGCAGAAGGATGG - Intergenic
931060895 2:58528641-58528663 AGTGGGGTAGAGGAGAAAGAAGG + Intergenic
931093998 2:58919413-58919435 GGTAGGGGAGAAGGGAAAGAGGG - Intergenic
931879706 2:66555731-66555753 TGTAAGTGAGAGGAGAGAGAGGG - Intronic
931994179 2:67824011-67824033 AGGAGTGGAGAGGAGAGGGAAGG - Intergenic
932091183 2:68807763-68807785 TGCAGAGGAGGGGAGAAAGATGG + Intronic
932631141 2:73344523-73344545 TGTAGTGGACAAGAGACGGAGGG - Intergenic
932684110 2:73853283-73853305 TCTAGAGGAAAGGAGAAACATGG + Intronic
933343131 2:81048252-81048274 TATGGTGGAGAGTAGAAAAAGGG + Intergenic
933545668 2:83708135-83708157 TGAATAGGAGTGGAGAAAGAGGG + Intergenic
933706792 2:85297383-85297405 TGCAGCAGAGAGGAGAATGAGGG - Intronic
933711357 2:85328169-85328191 TGTGGTGGAGACGAGAAACCAGG - Intronic
933875740 2:86620120-86620142 AGTAGTGGGAAAGAGAAAGATGG - Intronic
935220830 2:101011094-101011116 TGTAGGAGAGAGGAGCAAGGGGG + Intronic
935456952 2:103281381-103281403 AGGAGAGGACAGGAGAAAGAAGG + Intergenic
935585021 2:104792815-104792837 CCTATTGGAGGGGAGAAAGAGGG + Intergenic
936156631 2:110051255-110051277 TGGAGTCCAGTGGAGAAAGACGG - Intergenic
936188061 2:110320189-110320211 TGGAGTCCAGTGGAGAAAGACGG + Intergenic
936580367 2:113695090-113695112 AGAAGTGGAGAGTAGAATGATGG + Intergenic
937000666 2:118464362-118464384 TGATGAGGAGAGGGGAAAGAAGG + Intergenic
937170415 2:119860462-119860484 TGGAATGCAGATGAGAAAGATGG + Intronic
937202060 2:120210094-120210116 TGGTGTGGAGAGAAGAAGGAAGG + Intergenic
938323210 2:130379555-130379577 GGCATTGGGGAGGAGAAAGAAGG - Intergenic
938538192 2:132262649-132262671 TGTAGTGGTGAGAAGGTAGATGG - Intergenic
938815848 2:134903490-134903512 GGTAGTGACTAGGAGAAAGATGG + Intergenic
939649856 2:144746766-144746788 TGGAGTGAAGGAGAGAAAGAAGG - Intergenic
939739436 2:145887355-145887377 TGTGGTGGAGAGGAGGAAAACGG - Intergenic
939956626 2:148532833-148532855 CGTGGTGGGGAGGACAAAGATGG + Intergenic
940026901 2:149218018-149218040 AGTAGTGGAGTGAGGAAAGACGG + Intergenic
941044055 2:160652754-160652776 TTTGGGGGAGAGGAGAAAGAAGG + Intergenic
941456668 2:165717465-165717487 TATAGTCCAGAGGAGAAGGATGG - Intergenic
941936623 2:170986768-170986790 TGTACTGGAGTGGGAAAAGAAGG + Intergenic
942345104 2:174994692-174994714 TGTAGAGGTGAGGGCAAAGAAGG + Intronic
942370677 2:175280874-175280896 TATAGTGTAGGGGAGAAAAAGGG + Intergenic
943191576 2:184685070-184685092 TGTAGTGGGGAGGAGTATGGGGG + Intronic
943530218 2:189070453-189070475 TATGGTGGAGAGAAGCAAGAAGG + Intronic
944835577 2:203576010-203576032 TTTAGAGCACAGGAGAAAGAAGG + Intergenic
945335362 2:208586088-208586110 TGTAGTCCAGTGGAGAAAGGAGG + Intronic
945349825 2:208764217-208764239 TGAATTGGAGTGGTGAAAGAGGG - Intronic
945742625 2:213681842-213681864 GGGAGTGGAAAGAAGAAAGAGGG - Intronic
946139744 2:217680122-217680144 TGCAGTTCAGTGGAGAAAGAAGG - Intronic
946308555 2:218870326-218870348 TGAACTGGAGAGCAGGAAGAAGG - Intronic
946735325 2:222748250-222748272 TGTAGGGGACAGGAGATATATGG - Intergenic
946900143 2:224364418-224364440 TGCAGAGGAGAGGAGAAGGAAGG - Intergenic
947644584 2:231729075-231729097 TGTGTTGGGGAGGAGAAAGGGGG - Intergenic
948538877 2:238670947-238670969 TGTAGGGGAGATGAGTAGGAGGG - Intergenic
948565516 2:238883949-238883971 TTTAATGCAGAGGAGAAGGAAGG - Intronic
1168842494 20:918395-918417 AGTAGTGAAGAGGTGACAGAGGG - Intergenic
1169453981 20:5736074-5736096 AGGAGAGGAGAGGAGAAGGAAGG + Intergenic
1170434221 20:16308567-16308589 TGTCTTGGGGAGGAGAAAGAGGG - Intronic
1171811540 20:29747644-29747666 TGTAGTGGTGAGAAGGTAGATGG - Intergenic
1171867094 20:30494436-30494458 TGTAGTGGTGAGAAGGTAGATGG - Intergenic
1172457014 20:35084962-35084984 ACTAGTGGAGACGAGTAAGAAGG + Intronic
1172628292 20:36361161-36361183 TCTTGCGGAGAGGAGAAACAAGG + Intronic
1172631167 20:36379136-36379158 TGTGCTTGAGAGGACAAAGAGGG - Intronic
1173112489 20:40205335-40205357 TAAAGTGGAGAGGAGACAGGAGG - Intergenic
1173690271 20:44955392-44955414 TGAAGTGAGGAGGAGAAAGAAGG + Intronic
1173724561 20:45288424-45288446 TGTGCTGGAGAGGAGAGGGAAGG - Intergenic
1173773705 20:45685372-45685394 TGGAGAGGAGAGGAGAAGGAGGG - Intronic
1174114041 20:48214714-48214736 TGTAGTGGAGGATAGAAAGGAGG - Intergenic
1174151138 20:48487128-48487150 AGGAGAGGAGAGGAGAAAGAAGG + Intergenic
1174264752 20:49323298-49323320 TGTGGTTCAGAGGAGAAAGCGGG + Intergenic
1175412627 20:58780847-58780869 TGGAGGGGAGAGGAGAAAGAGGG + Intergenic
1176321136 21:5327268-5327290 GGTAGTGGAGTGGAGAAAAGTGG + Intergenic
1176478521 21:7257289-7257311 GGTAGTGGAGTGGAGAAAAGTGG + Intergenic
1176528987 21:7943543-7943565 TGTAGTGGAGTGGAGAAGAATGG - Intergenic
1176752313 21:10700734-10700756 TGGAGTGGAGAGGAGAGAAATGG - Intergenic
1176752784 21:10704022-10704044 TGGAGTGGAGTGGAGAAAAGTGG - Intergenic
1176755112 21:10720135-10720157 TGGAGTGGAGTGGAGAAGAATGG - Intergenic
1176755161 21:10720509-10720531 TGTAGTGGAGTGGAGTAGAAAGG - Intergenic
1176926144 21:14751703-14751725 TGTAGATGAAAGGAGAAAAAAGG + Intergenic
1177751676 21:25292738-25292760 TGTAGGGAAGAGGAGAGAGAGGG - Intergenic
1177827482 21:26100630-26100652 TGTATTTTAGAGGAGAAAGTTGG + Intronic
1177947159 21:27485009-27485031 AGAAGTGGAGAGTAGAATGATGG + Intergenic
1179106274 21:38403515-38403537 GGTAGTGGAGATGTGAGAGAAGG + Exonic
1179179748 21:39035380-39035402 CAAAGTGGAGATGAGAAAGAAGG - Intergenic
1179359775 21:40694952-40694974 TGGAGGACAGAGGAGAAAGAGGG + Intronic
1179603260 21:42495531-42495553 GGCAGCAGAGAGGAGAAAGAGGG - Intronic
1179772313 21:43631417-43631439 TGCAGGGGAGATGGGAAAGAAGG - Intronic
1180094806 21:45550978-45551000 TGTTGTGGGGAGGAGAATGGAGG - Intergenic
1180313775 22:11259298-11259320 TGTAGTGGTGAGAAGGTAGATGG - Intergenic
1181132007 22:20737508-20737530 GGAAGTGGAGAGGAGAGAGGTGG + Intronic
1181856108 22:25782610-25782632 TGTCGGGGAGAGGAAAAAGTGGG + Intronic
1181976852 22:26736497-26736519 TGAAGTAGAGTGGAGAAACATGG - Intergenic
1181999052 22:26905182-26905204 TAGAGAAGAGAGGAGAAAGACGG + Intergenic
1182090150 22:27589022-27589044 TGAGGAGGAGAGGAGAATGAGGG - Intergenic
1182576150 22:31274350-31274372 GGTAGAGGAGAGGAGAGACAAGG + Intronic
1182793077 22:32969194-32969216 TGCACTGGAGATGAGAAGGAAGG - Intronic
1182945325 22:34316423-34316445 GGCAGTGCAGAGGAGAAATACGG + Intergenic
1182979588 22:34656328-34656350 GGAAATGGAGAGGAGATAGATGG + Intergenic
1183791759 22:40077074-40077096 AGAAGAGGAGAGGAGAAAGAGGG + Intronic
1184120355 22:42445919-42445941 TGCAGTGGAAAGAAGACAGAGGG + Intergenic
1184498320 22:44856691-44856713 TGTTGTGAAGAGGAGAATCATGG - Intronic
1203296533 22_KI270736v1_random:47727-47749 TGGAGTGGAGTGGAGTAAAATGG + Intergenic
1203301233 22_KI270736v1_random:78524-78546 TGGAGTGGAGTGGAGTAAAATGG + Intergenic
1203305770 22_KI270736v1_random:108032-108054 TGGAGTGGAGTGGAGTAAAATGG + Intergenic
1203306960 22_KI270736v1_random:115965-115987 TGTAGTGGAGTGGAGAGGAATGG + Intergenic
1203307017 22_KI270736v1_random:116321-116343 TGTAGTGGAGTGGAGAGGAATGG + Intergenic
1203307330 22_KI270736v1_random:118441-118463 TGTATTGGAGTGGAGTGAGATGG + Intergenic
1203308487 22_KI270736v1_random:126092-126114 TGGAGAGGAGTGGAGAAAAATGG + Intergenic
1203308942 22_KI270736v1_random:129012-129034 TGTAGTGGAGTGGAGTAGAATGG + Intergenic
1203309446 22_KI270736v1_random:132376-132398 TAGAGTGGAGAGGAGAGAAATGG + Intergenic
1203310173 22_KI270736v1_random:137232-137254 TGGAGTGGAAAGGAGAGAAATGG + Intergenic
1203310940 22_KI270736v1_random:142315-142337 TGGAGTGGAGTGGAGAGAAACGG + Intergenic
1203311940 22_KI270736v1_random:148868-148890 TGTAGTGGAGTGGAGTGAAATGG + Intergenic
1203313007 22_KI270736v1_random:155956-155978 TGTAGTGGAGTGGAGTACAATGG + Intergenic
1203313770 22_KI270736v1_random:166118-166140 TGGAGTGGAAAGGAGTAAAATGG + Intergenic
949155930 3:827263-827285 TGGAATGGAGAGGAAAAAGTGGG + Intergenic
949258746 3:2081576-2081598 TTCAGTGGAGAGGAGACACAAGG - Intergenic
949938043 3:9132163-9132185 TGCAGTGGAGAGGGGATATATGG - Intronic
950075931 3:10187263-10187285 TGGAGAGGAGAGGATAAAAAGGG - Intronic
950137436 3:10591505-10591527 TCCAGTGGAGAGGAGCATGAGGG - Intronic
950317551 3:12017485-12017507 TTCAGTGGAAAGGAGAAATATGG - Intronic
950465806 3:13153104-13153126 TGGAGGGGAGAGGAGAGGGAGGG - Intergenic
952004160 3:28822872-28822894 GGTAGGGGAGAAGAGAGAGAGGG + Intergenic
952470886 3:33650531-33650553 TATAATGGAGATGGGAAAGAAGG + Intronic
952773447 3:37022485-37022507 TGGATTGGAGAGGAGCAAGATGG + Intronic
952962274 3:38599895-38599917 TGTGGGGGAGGGGAAAAAGAGGG + Intronic
953091501 3:39730857-39730879 TGAAGTGGAGAGTAGAATGGTGG - Intergenic
953397685 3:42586048-42586070 TAAAGGGGAGAGGGGAAAGAAGG - Intronic
953870193 3:46619557-46619579 TGTAGTGGACAGGCGGGAGACGG - Intronic
953971542 3:47352314-47352336 GTTATTGGAGAGGAGGAAGAAGG - Intergenic
953996594 3:47524549-47524571 TGAACTGGGAAGGAGAAAGAAGG - Intergenic
954443967 3:50536658-50536680 CCTAGTGGAGAGGAGAGACAGGG - Intergenic
954747408 3:52794975-52794997 TGGAGTGAAGAGGAGGCAGAGGG + Intronic
955020073 3:55111373-55111395 TGTTGTAAAAAGGAGAAAGAAGG + Intergenic
955572747 3:60325790-60325812 TGTAGTGGAGAGGACCAGGAAGG + Intronic
956345020 3:68269025-68269047 TGTGTTAGAGATGAGAAAGAAGG - Intronic
956620561 3:71217598-71217620 GGGAGTGGAGAAGAGAGAGATGG + Intronic
956769097 3:72509334-72509356 GGTTGTGGAGAGGAGAAATGTGG + Intergenic
957146129 3:76426118-76426140 TGAAGAGGAGAGGAGAAATCCGG + Intronic
958433665 3:94071953-94071975 TGTTGTGGGGAGGAGAATGGAGG + Intronic
959549118 3:107634310-107634332 GGTAGAGGAGAGGACTAAGAGGG - Intronic
959913520 3:111792007-111792029 GGAAGTAGAGAGGAGAATGATGG - Intronic
960339041 3:116452961-116452983 AGGAGAGGAGAGGAGCAAGAAGG + Intronic
960969574 3:123130035-123130057 GGCAGTGGAGGGGAGGAAGAGGG - Intronic
961703441 3:128765096-128765118 TGCAGTGAAGAGGGGACAGAGGG + Intronic
962349874 3:134648885-134648907 TGGAGTGTGGAGGAGAAAGGAGG + Intronic
962539753 3:136367984-136368006 TATAAGGGAGAGAAGAAAGAAGG - Intronic
962781898 3:138726998-138727020 TGGAGTGGAGTGGATAAACACGG - Intronic
962842830 3:139251395-139251417 AGAGGTAGAGAGGAGAAAGAGGG - Intronic
963500758 3:146122439-146122461 TGTAGTGGAAAGAACATAGAGGG - Intronic
963670194 3:148241827-148241849 TGTGGTGAAGAAGAGAAAGAAGG + Intergenic
964512616 3:157469457-157469479 GGGAGTGGGGAGGAGAAAGGAGG + Intronic
964808086 3:160633431-160633453 GGTAGTGGAGAGTACTAAGATGG + Intergenic
965408161 3:168296372-168296394 CATAGTAGAGAGGAGAATGATGG - Intergenic
965665573 3:171090112-171090134 GGAAGTGGAGAGGTGAAAGCAGG + Intronic
966906559 3:184530384-184530406 TGGAGGGGGGAGGAGGAAGATGG + Intronic
966906567 3:184530404-184530426 TGGAGGGGGGAGGAGGAAGATGG + Intronic
968168281 3:196486708-196486730 GGGAGTGGAGAGGTGGAAGAAGG + Intronic
968683269 4:1936865-1936887 TGTAGTTGAGAGGAGCAGGCAGG + Intronic
968947621 4:3673867-3673889 GGAAGTGGAGAGGAGTGAGAAGG + Intergenic
969489513 4:7491107-7491129 AGGAGGGGAGAGGAGAGAGATGG - Intronic
969949936 4:10825335-10825357 TGAATAGGAGTGGAGAAAGAGGG + Intergenic
970173382 4:13311367-13311389 TGAATAGGAGAGGTGAAAGAGGG - Intergenic
970176562 4:13345607-13345629 GGTGGAGGAGAGGAGAAAGGAGG + Intergenic
970362696 4:15325716-15325738 TGTGGTGCAGTGGAGAGAGAAGG - Intergenic
971655576 4:29340205-29340227 GGTAGTGGGGAGGGGACAGAAGG - Intergenic
972167620 4:36306953-36306975 TGTAGGGCAAAGGAGGAAGATGG + Intronic
972840560 4:42925244-42925266 TTTAATGGAGAGGAGAGAGTTGG + Intronic
975114966 4:70670284-70670306 TGTAGGGGAGAGGAAAAGAAAGG - Intronic
975261268 4:72302533-72302555 AGGAGTGAAGAAGAGAAAGATGG + Intronic
975778421 4:77815446-77815468 TGGTGGGGAGAGGAGAAAGGAGG - Intronic
976033408 4:80786267-80786289 TGGGGTGGAGAGGAGGTAGAAGG + Intronic
976416258 4:84779680-84779702 TGAGGTGGAGGGGAGAGAGAAGG + Intronic
976536517 4:86223665-86223687 TGTGGTGCAGAGGAAGAAGAGGG - Intronic
977093173 4:92704821-92704843 TGAAGAGGTGGGGAGAAAGAAGG - Intronic
977264155 4:94834455-94834477 GGAGGTGGAGAGGAAAAAGAAGG - Intronic
978279021 4:106987524-106987546 GGCAGGGGAGAGGAGAAAGCAGG - Intronic
980490744 4:133524748-133524770 TCTTCTGCAGAGGAGAAAGATGG + Intergenic
980894056 4:138844612-138844634 TGGGGTGGTGAAGAGAAAGAAGG + Intergenic
981012533 4:139940194-139940216 GGTAGTGGAGAGGAGAAGAAAGG - Intronic
981356858 4:143799088-143799110 GGTAGTGCAGAGGAGAAATGTGG - Intergenic
981396455 4:144255586-144255608 GGGAGAGGAGAGGAGAAGGATGG - Intergenic
981460714 4:145010668-145010690 TGTCGTGGGGTGGGGAAAGAGGG + Intronic
981701625 4:147613675-147613697 TGTGTTGGAAAGGAGAAAAAAGG + Intergenic
982121774 4:152150139-152150161 TGTGGTGGAGGGCAGAGAGAGGG + Intergenic
982451936 4:155563256-155563278 AGTGGTGGAGGGGAGACAGATGG + Intergenic
982506042 4:156219006-156219028 AGTAGTGCAAAGGAGAAACATGG + Intergenic
982878441 4:160677227-160677249 TTTAGAGGAGAGAAGAAAAAAGG + Intergenic
983231270 4:165131206-165131228 TGTGGAGCAGAGGAGAAGGAAGG - Intronic
983848869 4:172554572-172554594 TCTAGTGGGGAGGAGAAAGTAGG - Intronic
983923969 4:173376305-173376327 TGGAAATGAGAGGAGAAAGAGGG - Intronic
984477818 4:180259346-180259368 GGGAGTGGGGATGAGAAAGATGG - Intergenic
984640895 4:182163236-182163258 TGGATTGGAGAGACGAAAGACGG - Intronic
984703161 4:182831854-182831876 AGGAGGGGAGAGGAGAAGGAAGG - Intergenic
984703205 4:182831979-182832001 AGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703210 4:182831995-182832017 AGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703215 4:182832011-182832033 AGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703220 4:182832027-182832049 AGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703291 4:182832229-182832251 AGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703318 4:182832307-182832329 AGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703343 4:182832387-182832409 AGGAGGGGAGAGGAGAAGGAAGG - Intergenic
984703456 4:182833079-182833101 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703464 4:182833100-182833122 AGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703500 4:182833211-182833233 AGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703532 4:182833302-182833324 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703540 4:182833323-182833345 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703573 4:182833414-182833436 AGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703587 4:182833454-182833476 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703595 4:182833475-182833497 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703603 4:182833496-182833518 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703614 4:182833522-182833544 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703645 4:182833613-182833635 AGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703659 4:182833653-182833675 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703667 4:182833674-182833696 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703675 4:182833695-182833717 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703686 4:182833721-182833743 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703750 4:182833908-182833930 AGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703809 4:182834072-182834094 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703817 4:182834093-182834115 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703861 4:182834221-182834243 AGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703875 4:182834261-182834283 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703883 4:182834282-182834304 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703891 4:182834303-182834325 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
984703902 4:182834329-182834351 GGGAGGGGAGAGGAGAAGGAGGG - Intergenic
985141038 4:186840694-186840716 TGATGGGGAGGGGAGAAAGAAGG - Intergenic
985856255 5:2429608-2429630 TGTAGGGGAGAGGAGGAGAATGG + Intergenic
986399736 5:7369166-7369188 TGTGGTGGGGAGGAGGAAGAGGG + Intergenic
986637787 5:9840392-9840414 TGGATGGTAGAGGAGAAAGATGG - Intergenic
986774917 5:11005576-11005598 TAGAGTGGAGATAAGAAAGAAGG + Intronic
986953354 5:13119321-13119343 GGTAGGGAAGAGGAGAAGGAGGG + Intergenic
987147778 5:15009182-15009204 TGGAGGGCAGAGGAAAAAGATGG + Intergenic
987277881 5:16380674-16380696 CATAGTGGAGAGAAGAGAGAAGG - Intergenic
988247201 5:28702015-28702037 AGTTGTACAGAGGAGAAAGAGGG - Intergenic
988317724 5:29652305-29652327 TGGAATGGAAATGAGAAAGATGG + Intergenic
988346711 5:30046284-30046306 TTTAATGGAGAGGAGAGGGAAGG + Intergenic
988469822 5:31527451-31527473 TGTAAAGGGGAGGACAAAGAAGG - Intronic
988472838 5:31556705-31556727 GGCAGTGGAGAGGAGAAAATGGG - Intergenic
989003023 5:36781024-36781046 TGGAAAGGAGAGTAGAAAGATGG + Intergenic
989452589 5:41604436-41604458 GGGAGTTGAGAGGAGAAAAATGG - Intergenic
989466672 5:41764680-41764702 TGGAGAGAAGAAGAGAAAGAGGG - Intronic
990208188 5:53452808-53452830 TGGACTGGAGAACAGAAAGAAGG + Intergenic
990309335 5:54522963-54522985 TGGAGTTGAGCGAAGAAAGACGG + Intronic
990330163 5:54717996-54718018 AGAAGTGGAGAGTAGAATGACGG + Intergenic
990644560 5:57829609-57829631 TGTAGAGGAGAAGACACAGATGG + Intergenic
991149098 5:63345294-63345316 TGTGGAGGAGAGGGGAAGGAAGG + Intergenic
991665256 5:68993302-68993324 GGAAGTGGACAGGAAAAAGAAGG + Intergenic
991735170 5:69625171-69625193 TGGAGTGGGGTGGAGAGAGAAGG - Intergenic
991779808 5:70121548-70121570 TGGAGTGGGGTGGAGAGAGAAGG + Intergenic
991811604 5:70480307-70480329 TGGAGTGGGGTGGAGAGAGAAGG - Intergenic
991859095 5:70996977-70996999 TGGAGTGGGGTGGAGAGAGAAGG + Intronic
991872255 5:71121869-71121891 TGGAGTGGGGTGGAGAGAGAAGG + Intergenic
991944969 5:71890954-71890976 AGTTGAGGAGAGGAGAAAGCCGG + Intergenic
992269030 5:75047083-75047105 TATAGTGGATTGGAGAAAGTAGG - Intergenic
992434712 5:76744994-76745016 TCTAGAGGAGAGGAGAGACAAGG - Intergenic
992941774 5:81769617-81769639 TGCAGTGGCCAAGAGAAAGATGG - Intergenic
993322466 5:86489065-86489087 GGGAATGGAGAGGAGAATGAGGG + Intergenic
993458325 5:88151250-88151272 AATAGTGGAGAGGAGAGAGGAGG - Intergenic
993906779 5:93632230-93632252 TGAGGTGGGAAGGAGAAAGAAGG + Intronic
994044366 5:95291391-95291413 TTTAGTGGAGTGGAGCAAGTGGG - Intergenic
994147162 5:96408447-96408469 TGTGGTTTAGAGGAGAAAGTAGG - Intronic
994240917 5:97419594-97419616 TGATGTTGGGAGGAGAAAGAGGG + Intergenic
994265953 5:97717125-97717147 AGTAGTGGGGAGAAGAGAGAAGG + Intergenic
994327015 5:98459881-98459903 TGTATAGCAGAGCAGAAAGATGG - Intergenic
994629066 5:102259460-102259482 TGGTGTGGAGAGTTGAAAGATGG + Intronic
994822071 5:104666083-104666105 AGTACTAGAGAGGAGAGAGAAGG - Intergenic
996704115 5:126479372-126479394 TGTAGAGAGGAGAAGAAAGAAGG + Intronic
996750216 5:126880542-126880564 TCAAGTGGAGAGTAGAAATAGGG + Intronic
996847778 5:127919839-127919861 TGTAGTACAGAGCAGATAGAGGG - Intergenic
997024745 5:130045427-130045449 TGGAGTGGAGATGTGAATGAGGG + Intronic
997365992 5:133325468-133325490 TGTACTGGAGAGGGGAACGCAGG + Intronic
997633282 5:135385999-135386021 TGAAGAGGAGAGCAGAAAGAGGG + Intronic
997945361 5:138196027-138196049 GGAAGTGAAAAGGAGAAAGAAGG - Intronic
998373473 5:141675977-141675999 TGTAGGGGAGAGGAGAGTGAGGG - Intronic
998664633 5:144282648-144282670 TTGAGTGGAGAGTAGAAAGCAGG + Intronic
998891908 5:146755154-146755176 AGAAGTGGAGAGGAGAGGGATGG + Intronic
999404650 5:151296270-151296292 TGGAGGGGAGAGGAGAAAGGGGG + Intronic
999549039 5:152663663-152663685 TGTGTAGGAGAAGAGAAAGAGGG + Intergenic
1000167623 5:158669987-158670009 GGTAATGGAGAAGAGGAAGAGGG + Intergenic
1000686835 5:164260525-164260547 AGTAGAGGAGAGGAAAGAGAAGG + Intergenic
1000970194 5:167705576-167705598 TGTGGTGGGGAGGGGAAATAAGG + Intronic
1001162583 5:169334109-169334131 GGTTTTGGAGAGAAGAAAGAAGG - Intergenic
1001567043 5:172706601-172706623 TGTTGGGGAGAGGAGGAGGAGGG - Intergenic
1001641368 5:173246270-173246292 TGCAGGGCAGAGGGGAAAGAAGG + Intergenic
1001854047 5:174995399-174995421 TGAAGTGGAGGGGCAAAAGAGGG + Intergenic
1002565068 5:180108099-180108121 TGTGGAGGAGAGGAAAAAGAGGG - Intronic
1003385545 6:5664237-5664259 TGTGCTGGAGAGGAGAGAAAGGG + Intronic
1003591038 6:7437016-7437038 TCTGGTTCAGAGGAGAAAGAAGG + Intergenic
1003754099 6:9096539-9096561 TGTAGTGGTGAAGAGAGAGGTGG + Intergenic
1003981956 6:11398130-11398152 TGTAAAGGAGAGGAGAAGAATGG + Intergenic
1004348490 6:14869951-14869973 GGGAGAGGAGAGGAGAGAGAAGG - Intergenic
1004755394 6:18605141-18605163 TGTAGTAGGGAGGAGAGAGAAGG + Intergenic
1005086071 6:22008135-22008157 TGTGGTGGACTGGAGAGAGAGGG - Intergenic
1005567678 6:27113135-27113157 TGTGCTGTAGAGGAGAAACAAGG - Intergenic
1006388444 6:33745252-33745274 TGTGGAGGGCAGGAGAAAGAAGG + Intronic
1006528046 6:34625258-34625280 TGTGGTGGAGATGAGAAGGAAGG - Intronic
1006620291 6:35359265-35359287 GGGGGAGGAGAGGAGAAAGAAGG - Intronic
1006825269 6:36930177-36930199 TATAGTGGGGTGGAGAAAGAAGG - Intergenic
1006921437 6:37630184-37630206 ACTAGAGGAGGGGAGAAAGAGGG + Intergenic
1007259770 6:40555371-40555393 TGGAGGGGAGAGGAGGAGGAGGG - Intronic
1007261554 6:40567542-40567564 AGAAGTGGAGAGGAGGAAGATGG - Intronic
1007265408 6:40591895-40591917 TGTACAGGAGAAGAGAAAGAAGG + Intergenic
1007368292 6:41409460-41409482 TGGAGTGGGGAGGAGAGAGAGGG + Intergenic
1007511000 6:42374341-42374363 TGTGGTGAAGAGGAGGAAGGGGG - Intronic
1008813571 6:55535620-55535642 GGTAGAGGAGAGGAGAATGTTGG - Intronic
1009242956 6:61202132-61202154 TGTAGTAGAGAGGACAGAGGAGG + Intergenic
1009274032 6:61652075-61652097 TGGAGTGGAGAGAAGAAAATTGG + Intergenic
1009477369 6:64110220-64110242 TGAAGTGGAGTGTAGAAAGAGGG - Intronic
1009555595 6:65160959-65160981 TGTAGATGAGAAGAGATAGAAGG - Intronic
1009602006 6:65813215-65813237 TGTTGGGGAGAGGATAAAGGAGG + Intergenic
1010068060 6:71709189-71709211 TGCAGTGAAGGAGAGAAAGACGG - Intergenic
1011973987 6:93269062-93269084 TGAGGTGGACAAGAGAAAGATGG - Intronic
1012119251 6:95343021-95343043 CTTAGTGGTGAGCAGAAAGAAGG - Intergenic
1012269340 6:97189165-97189187 TGTTGTGGAGAGGTCAAAGGTGG - Intronic
1012802994 6:103857846-103857868 TCTAGTGGTGAGGAAAAAAATGG - Intergenic
1012979048 6:105810811-105810833 GGTGGTGGGGAGCAGAAAGAGGG + Intergenic
1013165002 6:107581812-107581834 AGAATTGGAGAGGAGAAAAAAGG - Intronic
1013167211 6:107605040-107605062 TGGAGGGGGGAGGAGGAAGAGGG - Intronic
1013205378 6:107940102-107940124 TGTAGTGGATAGGTGTAAGTAGG - Intronic
1013824557 6:114195731-114195753 AGTTGGAGAGAGGAGAAAGAGGG + Intronic
1015146755 6:129995804-129995826 TCTAGTGGGGAGGATAAACAAGG - Intergenic
1016885598 6:148956761-148956783 TGTAGTGTATAGAAGAGAGAAGG - Intronic
1016977482 6:149823469-149823491 AGTACTGGAGGGGAGGAAGAGGG + Intronic
1017676516 6:156819984-156820006 TGTGGTGGAGAGGAGAGGAAGGG + Intronic
1018266251 6:162027831-162027853 GAAAGTGGAGAGGAGGAAGAAGG + Intronic
1018592641 6:165443620-165443642 TGCAGTGCAGAGGAGAAATGTGG - Intronic
1019573597 7:1725342-1725364 TGGAGAGGAGAGGAGACAGTGGG + Intronic
1019962635 7:4473634-4473656 AGGAGGGGAGAGGACAAAGAGGG + Intergenic
1020823033 7:12994253-12994275 CATAATGGGGAGGAGAAAGAAGG - Intergenic
1021096117 7:16538227-16538249 TGAAGTGGAGATAAGAAGGAAGG - Intronic
1021524933 7:21576393-21576415 TGTAGGGGAGAGGAGATAAAAGG + Intronic
1021697137 7:23286377-23286399 GGTAGTGGAAAGGGGAAGGAGGG - Intergenic
1021994559 7:26167100-26167122 TGTAGTGGAAAGGGGAAGAAAGG - Intronic
1022036978 7:26543783-26543805 TGGGGTGGAGAGGATGAAGACGG + Intergenic
1024494588 7:50030214-50030236 TCTGGTGAAGAGGAGAGAGAGGG + Intronic
1024607022 7:51029934-51029956 TCTAGTGGACATGAGAAACATGG - Intronic
1024981177 7:55158882-55158904 TGTAGGAGAAAGGAAAAAGATGG + Intronic
1025269048 7:57491944-57491966 TGTAGTGGAGTGGAGAAGAGTGG + Intergenic
1027178470 7:75920445-75920467 TGTAGTAATGAGGAGGAAGATGG + Intronic
1028343852 7:89756131-89756153 TGTATTGGAGGGGACAAAGTGGG - Intergenic
1028427598 7:90707448-90707470 TGGATTGGAGAGGTGAAGGAAGG - Intronic
1028455053 7:91029568-91029590 AGGAGAGGAGAGGAGAGAGAAGG - Intronic
1028551447 7:92071834-92071856 TGTAGATTAGAGGAGAAAAAAGG + Intronic
1028640203 7:93033865-93033887 TGAAGAGGAGTGGTGAAAGAGGG - Intergenic
1028684929 7:93581412-93581434 TGAAGTAGAGAAGAGAAAGCTGG - Intergenic
1028977299 7:96928466-96928488 TGAAGTGGGGAGTAGAATGAAGG - Intergenic
1029483261 7:100825175-100825197 TGCAGGAGAGAAGAGAAAGAGGG + Intronic
1029590627 7:101504503-101504525 TGGAGTGGAGAGGAGCGAGGCGG - Intronic
1030781695 7:113609135-113609157 TGAAGAGGAGGGAAGAAAGATGG + Intergenic
1031121652 7:117729038-117729060 TGTAGAGGAAGGGAGAAGGAGGG + Intronic
1031411910 7:121449331-121449353 TGTATAGGATAGGAGAAGGATGG + Intergenic
1031796019 7:126175425-126175447 GGTAGTGCAGAGGGGAAACATGG + Intergenic
1032342107 7:131083514-131083536 TTTAGTGGAGAGGACCAAAAAGG - Intergenic
1032441149 7:131944102-131944124 TGTGGTGGGGAGGAGGAAAAAGG - Intergenic
1032442813 7:131955079-131955101 TGTCCTGGGAAGGAGAAAGAGGG + Intergenic
1033185125 7:139220355-139220377 TGGACTGGAAAGGGGAAAGATGG + Intergenic
1033465217 7:141583379-141583401 GAAAGTGGAGAGGAGAGAGAGGG + Intronic
1033940945 7:146652811-146652833 TGTGGTTGGGAGGAAAAAGAAGG + Intronic
1033981279 7:147169427-147169449 AGTACTAGAGAGGGGAAAGAGGG - Intronic
1034455746 7:151168640-151168662 TGTAAAGGACGGGAGAAAGATGG - Intronic
1034558373 7:151864045-151864067 TCTAGAGGAGAGGAGAGAGGAGG + Intronic
1035076008 7:156178016-156178038 GGAAGAGGAGAGAAGAAAGAAGG + Intergenic
1035112826 7:156497603-156497625 GGCCGTGGAGAGGAGAGAGAAGG + Intergenic
1035630316 8:1102764-1102786 TGATGTGGGGAGGAGAAAAAGGG + Intergenic
1036157851 8:6359071-6359093 TTAAGTGGAGAGGAGAGAGAAGG - Intergenic
1036436990 8:8743660-8743682 TGTAGGGGAGAGGAGGAAGGAGG - Intergenic
1036446636 8:8826890-8826912 AGTACCGCAGAGGAGAAAGATGG + Intronic
1036977075 8:13425729-13425751 TTTAGTGGGGAGGAGGAAGTTGG - Intronic
1037992567 8:23331187-23331209 GGGAGGGGAGAGGGGAAAGAGGG + Intronic
1038459661 8:27705194-27705216 AGGAAGGGAGAGGAGAAAGAGGG + Intergenic
1038508671 8:28109219-28109241 TAGAGTGGAGACCAGAAAGAAGG + Intronic
1038537867 8:28367340-28367362 AGTAATGGAAAGGAGGAAGAAGG + Intronic
1039105120 8:33981856-33981878 GATAGAGGAGAGGAGCAAGAGGG + Intergenic
1039199990 8:35080838-35080860 TGTAGGGGAGAGGACCATGAAGG - Intergenic
1039975866 8:42364287-42364309 TGTAGTGCAGTGGCGAAACATGG + Intronic
1041194634 8:55388561-55388583 TGTGGCAGAGAGCAGAAAGAGGG + Intronic
1041887239 8:62824685-62824707 TATAGTGGAGAGGACAATCAGGG - Intronic
1042040954 8:64587738-64587760 AAAAGTGGAGAAGAGAAAGAAGG - Intergenic
1042059640 8:64802633-64802655 GGGAGTGGAGGGGAGGAAGAGGG + Intergenic
1042062932 8:64840727-64840749 TGTAGAAGGGAGGAGAAAAAAGG - Intergenic
1042131849 8:65595010-65595032 TGGATTGGAGAGGAGAAAAGTGG - Intergenic
1043089425 8:75878699-75878721 AGTAGTGGAGAGAAAAAATAGGG - Intergenic
1043180904 8:77085365-77085387 TGACAGGGAGAGGAGAAAGAAGG + Intergenic
1043261203 8:78199872-78199894 TAGAGTGGAGAAGAGAAAAAAGG + Intergenic
1044278158 8:90326058-90326080 TGTCTTGGAGTGGAGAATGAAGG + Intergenic
1044861093 8:96524733-96524755 TGTATTGGAAAGGAGAAAAAAGG - Intronic
1045078443 8:98597072-98597094 TGTTTTGGAGAGGTGAAAAAAGG + Intronic
1045364128 8:101459928-101459950 TGAAGTGGGGAGGAAACAGAAGG + Intergenic
1045561051 8:103263471-103263493 AGTTGTGGGGAGGAGAAAAAGGG + Intergenic
1045715054 8:105033335-105033357 TGTCTCTGAGAGGAGAAAGATGG - Intronic
1045791870 8:105993038-105993060 AGTCCTGGAGAGGAGAAAGCAGG - Intergenic
1046480444 8:114810069-114810091 AGAAGTGGAGAGCAGAATGATGG - Intergenic
1046865579 8:119146563-119146585 GGGAATGGAGAGGAGAAAGTGGG - Intergenic
1047286105 8:123488522-123488544 AGAAGGGGTGAGGAGAAAGAAGG - Intergenic
1047795445 8:128250434-128250456 TCCAGTGGAGTGGAAAAAGAAGG - Intergenic
1048020175 8:130531075-130531097 TGAAGTGGAGAGGAGTAGGGAGG + Intergenic
1048124798 8:131622060-131622082 TGAATAGGAGAGGAGAGAGAGGG + Intergenic
1048148881 8:131873597-131873619 TGAAGTTGGGATGAGAAAGATGG + Intergenic
1048158857 8:131992683-131992705 TGTAGTGAAGAGGATGACGAAGG + Intronic
1048196468 8:132335845-132335867 ACTAGTGGAGAGGAGGAAAAAGG - Intronic
1048828430 8:138452553-138452575 TGTAGTGGAAAAGACACAGAAGG - Intronic
1048959178 8:139561786-139561808 AGCAGTGGTGAGGAGAAAAAAGG - Intergenic
1049227807 8:141466063-141466085 TGTAGATGAGAAGAGACAGAGGG + Intergenic
1049533169 8:143166606-143166628 GGAAGTGGAGAGGGGAAGGAAGG + Intergenic
1049533208 8:143166741-143166763 GGAAGTGGAGAGGGGAAGGAAGG + Intergenic
1049533217 8:143166775-143166797 GGAAGTGGAGAGGGGAAGGAAGG + Intergenic
1049533237 8:143166843-143166865 GGAAGTGGAGAGGGGAAGGAAGG + Intergenic
1049533246 8:143166877-143166899 GGAAGTGGAGAGGGGAAGGAAGG + Intergenic
1049533314 8:143167114-143167136 GGAAGTGGAGAGGGGAAGGAAGG + Intergenic
1049533349 8:143167249-143167271 GGAAGTGGAGAGGGGAAGGAAGG + Intergenic
1049533433 8:143167521-143167543 GGAAGTGGAGAGGGGAAGGAAGG + Intergenic
1049533473 8:143167657-143167679 GGAAGTGGAGAGGGGAAGGAAGG + Intergenic
1049533544 8:143167895-143167917 GGAAGTGGAGAGGGGAAGGAAGG + Intergenic
1049533574 8:143167997-143168019 GGAAGTGGAGAGGGGAAGGAAGG + Intergenic
1049533658 8:143168269-143168291 GGAAGTGGAGAGGGGAAGGAAGG + Intergenic
1049533727 8:143168508-143168530 GGAAGTGGAGAGGGGAAGGAAGG + Intergenic
1049533736 8:143168542-143168564 GGAAGTGGAGAGGGGAAGGAAGG + Intergenic
1050178308 9:2892748-2892770 TGTAGTTAAGAGGATAAAGATGG - Intergenic
1050230811 9:3524986-3525008 TGTGGGGGGGGGGAGAAAGAGGG + Intronic
1050353716 9:4763529-4763551 TGTGGTGGACAGGAAAAAGGGGG + Intergenic
1051172504 9:14332780-14332802 TCTAGTGTGGAGGAGAGAGACGG + Intronic
1051377867 9:16422598-16422620 TGAAGTGGAGATGGGAAGGATGG + Intronic
1051976731 9:22959142-22959164 TGAAGTGCAGAGGGGAAATAAGG - Intergenic
1051988508 9:23121411-23121433 AGTTTTGGAGAGGATAAAGATGG + Intergenic
1052255596 9:26452597-26452619 TGTAGTAGGAAGGAGAAACAAGG - Intergenic
1052274566 9:26662901-26662923 TGTAGAGCAGTGGAGAGAGAAGG + Intergenic
1052350791 9:27456315-27456337 TGTAGTGCAGTTGAGAAAGCTGG + Intronic
1052499215 9:29267817-29267839 TGTGGGGAAGAGGAGAGAGAGGG + Intergenic
1052791199 9:32876991-32877013 TATAAAGGAGAGGAGAATGAGGG - Intergenic
1053181855 9:35979331-35979353 TGGAAAGGAGATGAGAAAGATGG - Intergenic
1053291525 9:36882580-36882602 TGTTGAGGAGAGGAGAAGGGAGG - Intronic
1053308957 9:37003103-37003125 GGGGATGGAGAGGAGAAAGAGGG + Intronic
1053327740 9:37171271-37171293 TGTAGTGGAGAGAACCAAGGTGG + Intronic
1055904283 9:81274762-81274784 GATAGTGGAGAGGAGGAATAGGG + Intergenic
1056212314 9:84376258-84376280 GGTAGTGGAATGGAAAAAGAAGG - Intergenic
1056881231 9:90395853-90395875 GACAGTGGGGAGGAGAAAGAAGG - Intergenic
1057778313 9:98028544-98028566 GGTTGTGAAGAGGAGAGAGAAGG + Intergenic
1057931448 9:99196995-99197017 TGTAGTGGTGAGAAGAGAGAAGG + Intergenic
1058430540 9:104914639-104914661 TGTAGTGGAGAGTAGGAAGATGG - Intronic
1058665153 9:107306880-107306902 GGCAGTGGAAAGGAGAAAGCAGG + Intronic
1059407342 9:114109345-114109367 TGGAGCGGAGATGAGAAAGAAGG + Intergenic
1060586844 9:124791972-124791994 TCTGGAGGAGAGGAGAAGGATGG - Intronic
1060729266 9:126027078-126027100 AGTAGGGGAGGGGAGGAAGAGGG - Intergenic
1060816713 9:126639004-126639026 AGAATTGGAGAGGAGAGAGAAGG + Intronic
1060996165 9:127875835-127875857 CATAGTGGTGAGGAGACAGACGG - Intronic
1061006047 9:127928912-127928934 GGTAGTGGAGAGGAGGAGCAGGG + Intronic
1061006646 9:127931822-127931844 TGGAGTGAAGAGGGGAAAGCAGG + Intergenic
1062084979 9:134643720-134643742 AAAAGTGGAGAGGAGAAGGAAGG + Intronic
1203387965 Un_KI270438v1:72129-72151 TGTAGTGGAGTGGAGAAGAATGG + Intergenic
1203346353 Un_KI270442v1:37343-37365 TGGAGTGGAGAGGAGAGGCATGG + Intergenic
1203348676 Un_KI270442v1:58170-58192 TGTAGAGGAGTGGAGTAAAATGG + Intergenic
1203349218 Un_KI270442v1:61924-61946 TGGAGTGGAGAGGAGATAAATGG + Intergenic
1203403395 Un_KI270519v1:137572-137594 TGGAGTGGAGTGGAGCAGGATGG + Intergenic
1186156834 X:6734189-6734211 AGTAGTGGAGGGAAGAAACAGGG + Intergenic
1188697369 X:33211893-33211915 TGTTGTTGAGAGGATAAAAAAGG - Intronic
1188722633 X:33542507-33542529 TGTTGTGGAGAGGTGCAGGATGG - Intergenic
1189197469 X:39164414-39164436 TGGAGTGGAGAGGAGGATGGAGG + Intergenic
1189571418 X:42301931-42301953 AGGAAAGGAGAGGAGAAAGAGGG - Intergenic
1189639478 X:43052100-43052122 TGAAGTAGAGAGTAGAATGATGG - Intergenic
1190179204 X:48177446-48177468 TGTAGTTGAGAGAAGAAAAGAGG + Intergenic
1190455934 X:50627930-50627952 GGGAGGGGAGTGGAGAAAGAGGG - Intronic
1190959146 X:55228278-55228300 GGTAGTGCTGAGGAGAAATACGG + Intronic
1192124288 X:68487282-68487304 TGAAGTTTTGAGGAGAAAGAAGG + Intergenic
1192161402 X:68790832-68790854 GGTGGTAAAGAGGAGAAAGAGGG - Intergenic
1192219019 X:69184439-69184461 GGGAGTGGAGTGGAGAAGGAGGG - Intergenic
1192333545 X:70199471-70199493 GGTAGGGGAGAGGGGAAGGAAGG + Intronic
1193742979 X:85241267-85241289 ACTACTGGAGAGGAGAGAGAAGG + Intergenic
1193798180 X:85902557-85902579 AGAAGTGTAGAAGAGAAAGAAGG - Intronic
1194284237 X:91989876-91989898 AGTTCTGGAGAGAAGAAAGAGGG - Intronic
1194450422 X:94038881-94038903 TCTTGAGGAGAGAAGAAAGATGG - Intergenic
1194518847 X:94893318-94893340 TGAAGTAGAGAGTAGAATGATGG - Intergenic
1194572870 X:95574534-95574556 GGCAGTGCAGAGGGGAAAGATGG + Intergenic
1195177101 X:102322185-102322207 TGTAGAGGAGAGGAGAAGCAAGG - Intronic
1195181763 X:102364908-102364930 TGTAGAGGAGAGGAGAAGCAAGG + Intronic
1195200981 X:102549908-102549930 TGTAGAGGAGAGGAGAAGCAAGG - Intergenic
1195254518 X:103079476-103079498 TGTAGAGGAGAAGAGAAGCAAGG + Intronic
1195284429 X:103369955-103369977 CATAGTGGAAAGCAGAAAGAGGG - Intergenic
1195368667 X:104151436-104151458 TGTAAAGGAGAGGAGGAAAAGGG - Intronic
1195687459 X:107599786-107599808 TGGAGGGGAGGGGACAAAGAGGG - Intronic
1196222317 X:113126113-113126135 GGGAGGGGAGAGGAGAAGGAAGG - Intergenic
1197008124 X:121528509-121528531 TGTAGTGTACAGAAGAAAAATGG - Intergenic
1197154881 X:123259449-123259471 AGGAGTGGAGAGGAGAAAGGAGG - Intronic
1197484294 X:127028535-127028557 GGAAGTCGAGAGTAGAAAGATGG + Intergenic
1197556814 X:127965257-127965279 AGGAGTGGAAAGGAGAATGATGG - Intergenic
1197928717 X:131673807-131673829 TGTAATGGAGAGGCAAGAGAGGG - Intergenic
1198335447 X:135661552-135661574 TGAAGAGGAGTGGGGAAAGAGGG + Intergenic
1198688748 X:139257256-139257278 CCTAGAGGAGAGAAGAAAGAAGG - Intergenic
1199611744 X:149623155-149623177 TGGAGAGGGGAGGATAAAGAGGG - Intronic
1199718118 X:150521658-150521680 TGTATTTGGGAGAAGAAAGAGGG + Intergenic
1199869014 X:151879535-151879557 TGTGGTGGGGGGGAGAAAAACGG + Intergenic
1200079560 X:153569247-153569269 TGTGTTGGAGAGGAAAAACAAGG + Intronic
1200601803 Y:5214434-5214456 AGTTCTGGAGAGAAGAAAGAGGG - Intronic
1201076154 Y:10190813-10190835 TGTAGTGGTGAGAAGGTAGATGG + Intergenic
1201111415 Y:10802175-10802197 TGAAGTGGAGAGGAGTAAAGTGG - Intergenic
1201119533 Y:10862374-10862396 TGTAGTGGAATGGAGAGAAATGG - Intergenic
1201121342 Y:10875885-10875907 TGTAGTGTAGAGGAGAGGAATGG - Intergenic
1201122477 Y:10883806-10883828 TGGAGTGTAGTGGAGAAAAATGG - Intergenic
1201127526 Y:10928277-10928299 TGTAGTGGAAAGGAGAGGAATGG - Intergenic
1201129101 Y:10939246-10939268 TGGAGTGGAGAGGAGAGAAGTGG - Intergenic
1201129961 Y:10945005-10945027 TGTAGTGGAGGGGAGTGAAATGG - Intergenic
1201134749 Y:10982148-10982170 TGGAGTGGAAAGGAGAAGAATGG - Intergenic
1201136630 Y:10995015-10995037 TGGAGTGGAGAGGAGTGAAACGG - Intergenic
1201138586 Y:11009471-11009493 TGGAGTGGAAAGGAATAAGATGG - Intergenic
1201140427 Y:11023121-11023143 TGGAGTGGAGAGGAGTAGAATGG - Intergenic
1201618844 Y:15932255-15932277 TGAAATGGAGAGAAGAGAGAAGG - Intergenic
1202100746 Y:21305141-21305163 TGTAATGGACAGGACAAAAAGGG + Intergenic