ID: 1107958176

View in Genome Browser
Species Human (GRCh38)
Location 13:45537776-45537798
Sequence ATGGCCCAGCACATCTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107958176_1107958181 21 Left 1107958176 13:45537776-45537798 CCAAGATAGATGTGCTGGGCCAT 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1107958181 13:45537820-45537842 CCAAGTATGACCTGCAGCAGTGG 0: 1
1: 0
2: 1
3: 16
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107958176 Original CRISPR ATGGCCCAGCACATCTATCT TGG (reversed) Intronic
902520090 1:17011244-17011266 GTGGCCCAGGACATCTACCCAGG + Intronic
903230662 1:21920471-21920493 ATGGCCCAGCGCCTCTTTTTAGG - Intronic
906244325 1:44262499-44262521 ATGGCACAGCACTTCCATCTGGG + Intronic
911695395 1:100885067-100885089 ATGACCCAGCTCTTCTATGTAGG - Intronic
911837957 1:102645393-102645415 AGGGCCCAGCACACATCTCTTGG - Intergenic
913563647 1:120048489-120048511 ATGCCACTGCACATCTGTCTGGG - Intronic
913634477 1:120745075-120745097 ATGCCACTGCACATCTGTCTGGG + Intergenic
914284241 1:146207862-146207884 ATGCCACTGCACATCTGTCTGGG - Intronic
914545272 1:148658603-148658625 ATGCCACTGCACATCTGTCTGGG - Intronic
914621296 1:149412071-149412093 ATGCCACTGCACATCTGTCTGGG + Intergenic
915832736 1:159146224-159146246 ATGTCCCATCAGATCTTTCTGGG + Intronic
918934190 1:190899024-190899046 AGGGACCAGCACATGGATCTTGG + Intergenic
920083349 1:203394101-203394123 ATGGCCCAGATGGTCTATCTTGG + Intergenic
922232689 1:223700320-223700342 AGGGCCCAGGACATCTCTATGGG - Intergenic
1065017254 10:21473617-21473639 TTGTCCCAGCAGTTCTATCTTGG + Intergenic
1069064445 10:63928034-63928056 ATGGCCCAGGATATATATTTGGG + Intergenic
1071266660 10:83970752-83970774 GTGGGCCATCACATCTAGCTAGG - Intergenic
1076083224 10:127602465-127602487 CTGTCCAAGCACATCTATATAGG - Intergenic
1078878308 11:15420890-15420912 ATGGACTAGCAGGTCTATCTAGG - Intergenic
1083863471 11:65439904-65439926 ATGATCCAGCACATCTAGCAGGG - Intergenic
1085877772 11:80429485-80429507 AAGGCCCAGCATAACTTTCTAGG + Intergenic
1088652405 11:111969535-111969557 ATAGCCCAGCAAACCCATCTGGG - Intronic
1088926693 11:114310123-114310145 ATGACCCAGGAAATCTGTCTAGG - Intronic
1092237365 12:6818720-6818742 ATGGCCCAGGCCATCTATCCTGG - Intronic
1092933553 12:13339574-13339596 AGAGGCCTGCACATCTATCTTGG - Intergenic
1100334531 12:93617042-93617064 ACGGCCCAGCACAGCCACCTCGG - Intergenic
1100775527 12:97969062-97969084 ATAGCCCAGCAAATATATATTGG - Intergenic
1107958176 13:45537776-45537798 ATGGCCCAGCACATCTATCTTGG - Intronic
1110169034 13:72478132-72478154 ATGGCCTACCATATCTATCCTGG - Intergenic
1116469939 14:45275239-45275261 ATTGGCCAGCACCTCTATCTGGG + Intergenic
1120110931 14:80555249-80555271 TTTGCCTAGCACATCTGTCTGGG + Intronic
1120507741 14:85374552-85374574 ATGGGCCAGCACCTTGATCTTGG + Intergenic
1124340065 15:28885119-28885141 ATGGCTCATCACATCTGCCTGGG + Intronic
1127344107 15:58077389-58077411 ATAGCACTGCACATCTATTTAGG - Intronic
1133164392 16:3936257-3936279 AGCGCCCAGCACATATGTCTTGG + Intergenic
1135831266 16:25775863-25775885 ATGGCACAGACCATTTATCTTGG + Intronic
1137389714 16:48071149-48071171 AGGGCCTAGCACATCTGTCTGGG - Intergenic
1138880804 16:61013064-61013086 AGGGCCCATCACTTCTCTCTGGG + Intergenic
1139373367 16:66481657-66481679 AGGGCCCTGCCCATCTACCTGGG - Exonic
1139991528 16:70943729-70943751 ATGGCCCAGAACCTCTGTCCAGG + Intronic
1140122950 16:72099128-72099150 ATGGCCCTGCAGATCTGTCTGGG + Intronic
1140984647 16:80146584-80146606 ATGACCCAGCAAACCTATCCTGG + Intergenic
1141615988 16:85209673-85209695 ATGGCCATGCACCTCGATCTAGG - Intergenic
1141843654 16:86591976-86591998 ATGGCACATCACAACCATCTAGG + Intergenic
1147860828 17:43521961-43521983 AGTGCCCAACACATCCATCTTGG - Intronic
1151949983 17:77346580-77346602 ATGGCCCAGAATGTGTATCTTGG + Intronic
1157207290 18:45711444-45711466 ATGGCCCAGCAATTCCTTCTTGG - Intergenic
1158690589 18:59656831-59656853 AGGGTCAAGAACATCTATCTTGG + Intronic
1161572593 19:5038637-5038659 ATGGCCCAGGACCTCTAGCCTGG - Intronic
1163161722 19:15468891-15468913 ATTGACTAGCACATCCATCTCGG - Intronic
1163988749 19:20978000-20978022 ATGGCACTGCACTTCAATCTGGG - Intergenic
927444452 2:23145645-23145667 ATGGCCCAGCAGATACCTCTAGG + Intergenic
930421477 2:51158196-51158218 ATGGCACAGCACATCCAACCTGG - Intergenic
932930270 2:76027937-76027959 GAGGCCCAACACAGCTATCTAGG - Intergenic
935559166 2:104543313-104543335 ATGGGCCAGCACCTTGATCTTGG + Intergenic
942375611 2:175333693-175333715 ATCACCCAGCACATTGATCTTGG - Intergenic
943784544 2:191862560-191862582 ATGACCCACCACATATATTTTGG + Intergenic
1171722855 20:28582382-28582404 ATGGCACAGCACTACAATCTGGG + Intergenic
1173009126 20:39165398-39165420 ATGGCCCAGCTCATCCATCATGG + Intergenic
1173748719 20:45458810-45458832 ATGGCCCAGAAACTCTTTCTTGG + Intergenic
1178942005 21:36914184-36914206 AGGGGCCAGCACATCTGGCTGGG + Intronic
1179953851 21:44727144-44727166 AAGGGCCAGCACAGCCATCTGGG + Intergenic
1180254215 21:46611993-46612015 ATGGCCCAGAATGTGTATCTTGG + Intergenic
1181829669 22:25550140-25550162 ATGGCACAGCACATCCAGCAGGG - Intergenic
1185006870 22:48283651-48283673 GTGGCCCAGAATGTCTATCTTGG - Intergenic
953379933 3:42462187-42462209 ATGGGCCTGTACATGTATCTGGG - Intergenic
954545113 3:51427464-51427486 ATGGCCCAGCGCAGCTATATTGG - Exonic
955543818 3:60005769-60005791 ATGGCAAATCACATCTCTCTTGG + Intronic
956261217 3:67343924-67343946 ATGGCCCAACCCATCTATGAGGG - Intergenic
957004162 3:74924605-74924627 AGTGCCAAGCACATCTATTTTGG - Intergenic
958843519 3:99237905-99237927 ATGGCCAACCACATCTTCCTTGG + Intergenic
959558785 3:107755137-107755159 ATGGCCTTGCACATATATATTGG + Intronic
962347120 3:134626324-134626346 ATGGACCTGCACTTCTACCTTGG + Intronic
967600542 3:191382420-191382442 GTGGCCAAGCACACCCATCTAGG + Intronic
971395571 4:26224132-26224154 CTGACACAGAACATCTATCTTGG + Intronic
971924334 4:32987312-32987334 ATTGGCCAGCACATTGATCTGGG + Intergenic
972300283 4:37779066-37779088 ATGGCCCAGCACCTCCCACTAGG - Intergenic
973915304 4:55628085-55628107 TTGGCACAGCATATTTATCTAGG + Intronic
977925272 4:102693534-102693556 ATGGGCCAACACCTTTATCTCGG + Intronic
980659033 4:135832133-135832155 ATTGGCCAGCACCTCGATCTTGG + Intergenic
981613103 4:146617772-146617794 CTGGGCCAGCAGGTCTATCTGGG + Intergenic
985483826 5:137767-137789 ATTGCCCAGCACAGCCATATTGG - Intergenic
996552257 5:124743457-124743479 ATGACCCAACACATCAAGCTTGG + Intronic
999893067 5:156000143-156000165 ATAGCCCAGTCCATGTATCTAGG + Intronic
1001702951 5:173720816-173720838 ATGGCCAGGCCCATCTGTCTGGG - Intergenic
1003016601 6:2473045-2473067 ATGCCCCTGGACATCTATGTAGG + Intergenic
1006978659 6:38127524-38127546 ATAGCCCAGGACAGCTATCTGGG - Intronic
1007270994 6:40637091-40637113 ATGGCCCAACACATTGACCTTGG + Intergenic
1017290725 6:152732954-152732976 ATGGCCCTTCACATGTATGTGGG + Intergenic
1027230299 7:76268245-76268267 CAGGCCCAGCCCATCCATCTGGG - Intronic
1029619093 7:101678941-101678963 AAGGCCCAGCCCAGCTGTCTGGG + Intergenic
1030669906 7:112324925-112324947 ATTTCCCAGCTCAACTATCTGGG + Intronic
1036294953 8:7528259-7528281 AGGGCCCAGCACCTCTTTGTTGG + Intergenic
1036296582 8:7542840-7542862 AGGGCCCAGCACCTCTTTGTTGG + Intergenic
1036325984 8:7778179-7778201 AGGGCCCAGCACCTCTTTGTTGG - Intergenic
1036327610 8:7792732-7792754 AGGGCCCAGCACCTCTTTGTTGG - Intergenic
1038664548 8:29526834-29526856 ATCGCCCAGCACCTTGATCTTGG - Intergenic
1039006403 8:33042553-33042575 ATACCACTGCACATCTATCTTGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1042052185 8:64723362-64723384 GTGGCATAGCACATCTATTTTGG - Intronic
1042618792 8:70680373-70680395 TTGGCCCAGCAATTCCATCTAGG - Intronic
1043739160 8:83787613-83787635 ATGGCCAAGCAGATTTATTTAGG + Intergenic
1045312020 8:101011079-101011101 ATGGCCCTGCACAAATATTTAGG + Intergenic
1052567802 9:30180780-30180802 ATACCCCAGCCCATCTCTCTGGG + Intergenic
1055651149 9:78408435-78408457 AATGCACAGCACATCTTTCTTGG + Intergenic
1055924940 9:81500184-81500206 ATGGACCATCATATCTGTCTTGG - Intergenic
1057196795 9:93119969-93119991 AGGGCCCAGCACAGTCATCTGGG + Intergenic
1058997873 9:110317521-110317543 ATGGCCTTCCAGATCTATCTGGG - Intronic
1059222357 9:112636296-112636318 ATGTCCCAGCATTTCTATGTTGG + Intronic
1061300162 9:129699724-129699746 ATGGTCCAGCCCAGCTTTCTGGG + Intronic
1186009413 X:5112534-5112556 AGGGCCCAGCACATATTTCTTGG - Intergenic
1187433867 X:19249065-19249087 ATGGAGCAGAACAGCTATCTGGG - Intergenic
1188114624 X:26227973-26227995 AGGGCCCAGAACATCTACCTTGG - Intergenic
1189153665 X:38733247-38733269 ATGCCACTGCACATCTTTCTAGG - Intergenic
1190226371 X:48548949-48548971 ATGGCCCAGTCCCTCTTTCTGGG + Intronic
1196608312 X:117681346-117681368 ATGTGATAGCACATCTATCTGGG + Intergenic
1198508022 X:137320382-137320404 ATGGCCCTCCTCATCTATGTTGG - Intergenic
1201943762 Y:19487899-19487921 AAGTCCCAGAACCTCTATCTGGG + Intergenic