ID: 1107959517

View in Genome Browser
Species Human (GRCh38)
Location 13:45545745-45545767
Sequence GACACAGGTGTCCCTACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107959517_1107959521 -4 Left 1107959517 13:45545745-45545767 CCCTGTGTAGGGACACCTGTGTC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1107959521 13:45545764-45545786 TGTCCTCTGGTTGCCTCTGCAGG 0: 1
1: 0
2: 1
3: 26
4: 256
1107959517_1107959526 23 Left 1107959517 13:45545745-45545767 CCCTGTGTAGGGACACCTGTGTC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1107959526 13:45545791-45545813 CTGAGCAGAAGGGCAGAGCGTGG 0: 1
1: 0
2: 3
3: 36
4: 365
1107959517_1107959525 13 Left 1107959517 13:45545745-45545767 CCCTGTGTAGGGACACCTGTGTC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1107959525 13:45545781-45545803 TGCAGGAGAGCTGAGCAGAAGGG 0: 1
1: 0
2: 5
3: 49
4: 433
1107959517_1107959524 12 Left 1107959517 13:45545745-45545767 CCCTGTGTAGGGACACCTGTGTC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1107959524 13:45545780-45545802 CTGCAGGAGAGCTGAGCAGAAGG 0: 1
1: 0
2: 3
3: 64
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107959517 Original CRISPR GACACAGGTGTCCCTACACA GGG (reversed) Intronic
901022463 1:6262086-6262108 GACACAGGGGTGCCTAGTCATGG - Intergenic
901884248 1:12211596-12211618 ATTACAGGTGTCCCTACACTTGG - Intergenic
902342607 1:15793960-15793982 GACACAGGTCTCCCTCCAAAAGG - Intergenic
903154445 1:21434565-21434587 GAGGCAGGTGTCCCTGCAGAAGG + Intergenic
903938013 1:26910037-26910059 GACACAGGTCTGCCTACTTAGGG + Intronic
907475723 1:54704031-54704053 CACTCAGATGTCCCTTCACACGG - Intronic
908259106 1:62325888-62325910 GACTCAGGAGCACCTACACATGG + Intergenic
918543056 1:185652521-185652543 GACTCAGGTCTCCCCACGCATGG + Intergenic
919023092 1:192134334-192134356 GTCACAGGTGTCTCTAAATATGG + Intergenic
922534703 1:226371223-226371245 TACACAGGTGTCTCCACGCAGGG - Intronic
1064264026 10:13809890-13809912 CAACCAGGTGTCCCTGCACATGG - Intronic
1065512035 10:26488924-26488946 GAATCAGGTGTACATACACATGG - Intronic
1067667759 10:48292817-48292839 AAAACAGGTGTCCCTATCCATGG + Intergenic
1073094457 10:100971308-100971330 TAAACAGGTGTGCCTCCACAGGG + Intronic
1076110136 10:127853905-127853927 GTCAAAGATGTCCCTTCACACGG - Intergenic
1076122241 10:127945411-127945433 GACACAGGTGTCCACAGGCAAGG - Intronic
1078270742 11:9792524-9792546 ACCACAGGTGTTCCTAAACAAGG + Intronic
1079658913 11:23016867-23016889 GCCACAGGTATCCCTAGACCTGG - Intergenic
1083925633 11:65804328-65804350 CCCACAGAGGTCCCTACACAAGG - Intergenic
1084506022 11:69568774-69568796 CACACAGGTTTCCATACTCAGGG - Intergenic
1089176659 11:116553389-116553411 GTCACAGGTGTCCCTAGCCAGGG + Intergenic
1089320469 11:117623153-117623175 GACACAGATGCCCTTAAACATGG - Intronic
1091668037 12:2433282-2433304 GCCACAGGTGGTCCTACTCAGGG + Intronic
1093852362 12:24056015-24056037 GGCACATGTGACCCTAGACATGG - Intergenic
1094439162 12:30455962-30455984 GGCACAGGTGTTCCCACAGAAGG + Intergenic
1096544124 12:52325423-52325445 GACAAAGGTGTCCATTCTCAAGG + Intergenic
1096592881 12:52673619-52673641 GACACTGGGGTCCCTACAGAAGG + Intergenic
1097052209 12:56230374-56230396 GACCCAGGTGTCCCTAACCTGGG - Intronic
1102303889 12:111790635-111790657 GTCTCAGGGGTCCCTAAACAGGG + Intronic
1102541840 12:113625900-113625922 GAGACAGGTGTCTCTACACTGGG + Intergenic
1103908133 12:124337778-124337800 GGCACAGCTGCCCCTGCACAGGG + Intronic
1106773471 13:32985401-32985423 CACACAGCTGTCCCTCCACAGGG - Intergenic
1107959517 13:45545745-45545767 GACACAGGTGTCCCTACACAGGG - Intronic
1108010075 13:45997715-45997737 GGCATAGGTGTGCATACACATGG - Intronic
1109421192 13:62115136-62115158 GCCACAGGAGTCCCTACACCTGG - Intergenic
1112269365 13:97954148-97954170 AAAACAGTTGTGCCTACACATGG - Exonic
1115787261 14:36840085-36840107 CACACAGGTGGCCTTCCACAGGG + Intronic
1120076074 14:80159873-80159895 GACACAGGTATCACTGCACATGG - Intergenic
1124416263 15:29475333-29475355 GCCACAGCGGTCCCTGCACAGGG + Intronic
1129774735 15:78229391-78229413 AACACAAGTGTCCTTAAACATGG - Intronic
1130445855 15:84001223-84001245 GACACAGGTGTCCCGAGGCTAGG + Intronic
1138032467 16:53570725-53570747 GAAGTAGGTGGCCCTACACAAGG + Intergenic
1139326464 16:66156240-66156262 CACCCAGGTGGCCCTGCACAGGG + Intergenic
1140176635 16:72667209-72667231 GACACAGGTGTGCACACACATGG - Intergenic
1141697249 16:85625922-85625944 GCCACAGGAGTCCCTACCCCAGG - Intronic
1141928807 16:87186737-87186759 GACACAGGGGCCCCTTCTCAGGG + Intronic
1146787518 17:35732272-35732294 GACCCAGGTGTCCAGACGCAGGG + Intronic
1150699715 17:67436390-67436412 GAGACAGCTGTCCAGACACAGGG + Intronic
1152186543 17:78860236-78860258 GACACCTGTGTCTCTTCACAAGG - Intronic
1153979808 18:10298965-10298987 GACAAGGGTGTCCCTTGACAAGG - Intergenic
1154067155 18:11118157-11118179 GGTACAGATGTCCCTACAAATGG + Intronic
1156496166 18:37526551-37526573 GACACAGGTGGCTCTACCCCAGG - Intronic
1156698979 18:39800238-39800260 GACACAGGTATTCCCTCACAAGG + Intergenic
1157094484 18:44675137-44675159 TGCATAGGTGTCCCTAAACAAGG - Intergenic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1160160521 18:76466829-76466851 GACACAGAAGTCCCTCCACCAGG + Intronic
1160248714 18:77182577-77182599 GACACATGTGCCCCTGCACGGGG - Intergenic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1163481766 19:17560700-17560722 GACCCAAGTGTCCAAACACAGGG - Intronic
1165392566 19:35546836-35546858 AACCCAGGTGTCCCTTCTCAGGG - Intronic
1166048645 19:40244797-40244819 GACACTGGGGCCCCTACCCAAGG + Intronic
1167496890 19:49824793-49824815 GACCAAGGGCTCCCTACACACGG - Intronic
925094410 2:1184585-1184607 GAAGCAGGTGTGCCTTCACATGG + Intronic
925688886 2:6499857-6499879 CACACATGATTCCCTACACACGG + Intergenic
928862279 2:35873861-35873883 GGCACAGGAGTCCTTAGACAAGG + Intergenic
937295153 2:120805682-120805704 GACACAGCTGTCCCTCAACCTGG + Intronic
937596758 2:123683505-123683527 GCCGTAGGTTTCCCTACACAAGG - Intergenic
939539463 2:143475583-143475605 GACACAGTGGGCCCTACAGAGGG + Intronic
942413781 2:175737419-175737441 GCCACAGGAGTTACTACACATGG - Intergenic
947230060 2:227875519-227875541 GGCAGAGGTGTCCCCACCCAGGG + Intronic
1171078095 20:22149522-22149544 GACACAGGTGTCCCTAAGTTTGG - Intergenic
1173173952 20:40750179-40750201 GACTCAGATGTCCCAACTCATGG - Intergenic
1175759887 20:61555012-61555034 CACACAGGTGTGCACACACATGG - Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1179165952 21:38935309-38935331 GATTCAGGTGGCGCTACACAGGG - Intergenic
1179382241 21:40910594-40910616 ACCACATGTGTCCCTACACACGG - Intergenic
1180803825 22:18650087-18650109 GTCACTGGTGTCCCTGCCCAAGG + Intergenic
1180806939 22:18719362-18719384 GTCACTGGTGTCCCTGCCCAAGG - Intergenic
1181027002 22:20132260-20132282 CGCACTGGTGTCCCCACACAAGG - Intronic
1181278787 22:21703745-21703767 GACCCAGGTGATTCTACACAGGG + Intronic
1184388177 22:44187983-44188005 GAGACAGGTGTCCCTAAACCCGG - Intronic
1184725370 22:46341932-46341954 GTCAGAGGCTTCCCTACACAAGG - Intronic
1184774130 22:46615063-46615085 CACACAGGGGAACCTACACACGG - Intronic
1184774192 22:46615319-46615341 CACACAGGGGAACCTACACACGG - Intronic
1184774644 22:46617124-46617146 CACACAGGGGAACCTACACATGG - Intronic
1184842105 22:47058155-47058177 GACACAGGAGTCCGCACGCAGGG - Intronic
1203234286 22_KI270731v1_random:141459-141481 GTCACTGGTGTCCCTGCCCAAGG + Intergenic
952855870 3:37770433-37770455 GACACAGGTTTCCTCCCACAGGG - Intronic
955340443 3:58121345-58121367 GTCACAGGTGTCACTAGGCATGG - Exonic
958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG + Intergenic
961091264 3:124114588-124114610 GACACTGGTGTCCTCACAGAGGG + Intronic
961569188 3:127786004-127786026 CACACAGGTGTGCCTACTCCAGG + Intronic
965104478 3:164340044-164340066 GGCATAGGTTTCCCTACACAAGG + Intergenic
967942310 3:194775688-194775710 GACACAGGTGGCCATGCAAATGG - Intergenic
967942641 3:194777957-194777979 GACACAGGTGGCCATGCAAATGG - Intergenic
969107849 4:4821341-4821363 GACACAGGTGCATCTTCACATGG - Intergenic
972213108 4:36862351-36862373 AGCACAGGTGTCCCTATAGATGG - Intergenic
985833148 5:2250751-2250773 GCCAGATGTGTCGCTACACATGG + Intergenic
985969355 5:3362753-3362775 GGCACTGGTGTCCCTACTCCAGG - Intergenic
988101704 5:26688090-26688112 GAAACAGGTGTCCCTAACCACGG - Intergenic
999656036 5:153811488-153811510 GACACAGGTTTCATTAGACAGGG - Exonic
1001284123 5:170410139-170410161 GACTCAGGAGGCCCTGCACAGGG - Intronic
1001692951 5:173646388-173646410 GACACAGCTGTTCCTCCACTGGG + Intergenic
1014254788 6:119150154-119150176 GACACAGAGGTACCCACACAAGG + Intergenic
1017254522 6:152317846-152317868 GACAAAGGTGGTCCTACAAATGG - Intronic
1018483132 6:164212394-164212416 GACACAGGTCTCTGGACACAGGG - Intergenic
1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG + Intergenic
1019708674 7:2508439-2508461 GACACACGTGTCCCTGCACATGG + Intergenic
1022475097 7:30704886-30704908 GACACATGTGTCCCCAAGCAGGG + Intronic
1023402794 7:39802663-39802685 GACATAGGTCTCCCTCCAAAAGG - Intergenic
1023856085 7:44185274-44185296 GGGCCAGGTGTCCCAACACAGGG + Intronic
1024548919 7:50544185-50544207 TGCCCAGGTGTCCCTACCCACGG - Intronic
1024646836 7:51377974-51377996 GACATAGGTCTCCCTTCAAAAGG + Intergenic
1028639188 7:93024084-93024106 GACAGAGGGCTCCCTAGACAAGG - Intergenic
1035057481 7:156045756-156045778 GATGCAGGTGTCCCTACAGTGGG + Intergenic
1035099691 7:156386341-156386363 GCCACAGAAGTCCCTGCACAGGG + Intergenic
1036270946 8:7302300-7302322 GACACATGTGTCCCTATATCTGG - Intergenic
1036350403 8:8008044-8008066 GACACATGTGTCCCTATATCTGG + Intergenic
1039162151 8:34634264-34634286 AACACAGATGTCCCTACAACAGG + Intergenic
1042482424 8:69319281-69319303 GAGACAGGTGTGACTACAGAAGG - Intergenic
1042515078 8:69650745-69650767 GCCACTGGTGTCCCTGCACCTGG + Intronic
1042693169 8:71526625-71526647 GCCACATGTGCCCCTCCACAGGG + Intronic
1044537204 8:93370883-93370905 GACACAGATGTGGCTACACAGGG + Intergenic
1048437509 8:134432034-134432056 GACACTGGTGTCCAGACAGACGG - Intergenic
1048581617 8:135733719-135733741 GGCCCAGGTTTCACTACACATGG - Intergenic
1056894870 9:90535755-90535777 GCCAGTGGTGTCCCTACAGAAGG + Intergenic
1058765676 9:108180613-108180635 TAGACAGGTGTGCCTACAGATGG + Intergenic
1058975820 9:110124645-110124667 GACACTGATGTCTCTACTCAAGG + Intronic
1060962881 9:127693571-127693593 GAGACAGAAGTCCCTACAAAGGG - Intronic
1062651698 9:137581083-137581105 GACATATGTGTCCCTAGAGATGG - Intergenic
1187506474 X:19882393-19882415 ATCACAGGAGTCCATACACATGG + Intronic
1197760947 X:130027861-130027883 CACACAGTCGCCCCTACACACGG + Intronic
1200846012 Y:7832898-7832920 GTCGTAGGTTTCCCTACACAAGG - Intergenic