ID: 1107962361

View in Genome Browser
Species Human (GRCh38)
Location 13:45569919-45569941
Sequence AGTCACTTCATCCCAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107962361_1107962364 -8 Left 1107962361 13:45569919-45569941 CCCTCCTTTGGGATGAAGTGACT 0: 1
1: 0
2: 0
3: 14
4: 161
Right 1107962364 13:45569934-45569956 AAGTGACTTTCTGTTTGCCTAGG 0: 1
1: 0
2: 1
3: 21
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107962361 Original CRISPR AGTCACTTCATCCCAAAGGA GGG (reversed) Intronic
902665308 1:17933521-17933543 CGTCATTTCTTCCCCAAGGAGGG + Intergenic
905469247 1:38179475-38179497 AGTGCCTTCTTCCCAAAGAAGGG - Intergenic
906073788 1:43036534-43036556 ATTCACTTCATCCCCAAGCAGGG - Intergenic
906469285 1:46114232-46114254 AGCCACATCATTCCAAATGAAGG + Intronic
913988234 1:143585084-143585106 AATTCCTTCATCCCATAGGATGG + Intergenic
916016359 1:160753393-160753415 AATCACTTCATCCCAAAAATGGG + Exonic
916560457 1:165930409-165930431 AGTTTCTTCATCCCACATGATGG + Intergenic
919173578 1:193990117-193990139 AATCACTTAATCACAAATGAAGG + Intergenic
921127849 1:212194084-212194106 AGTTACTCCACCCCAAAGGATGG + Intergenic
921800624 1:219398953-219398975 AGTCACTACACTCCAATGGATGG + Intergenic
922794858 1:228334984-228335006 ACTCACATCATCCCGAGGGAAGG + Intronic
924579275 1:245309474-245309496 CGTCATTCCATCCCAAAGGCTGG - Intronic
1065096983 10:22290893-22290915 AATCACTTGAACCCAAAGGGCGG + Intergenic
1065118251 10:22503080-22503102 AATCATTTTAACCCAAAGGATGG - Intergenic
1067043540 10:42971033-42971055 AGGCCTGTCATCCCAAAGGAAGG + Intergenic
1067339729 10:45391668-45391690 CCTCACTTCATCCCAGACGATGG - Intronic
1070492900 10:76993978-76994000 AGTCACTTAATCTCCAAGGGAGG - Intronic
1071450958 10:85791033-85791055 AGTGACTTCATCCCTAGCGATGG + Intronic
1073808507 10:107126570-107126592 TCTGACTTCATCCCAAAGGCTGG - Intronic
1075210108 10:120483700-120483722 ACTCACCCCATCCCCAAGGAGGG - Intronic
1076648897 10:131973604-131973626 GGTCACTGCATCCCCAAAGAGGG + Intronic
1076718540 10:132381571-132381593 AGTCTCTTCAAACAAAAGGAAGG + Intergenic
1081761469 11:45579347-45579369 ACTCACTACATTCTAAAGGAAGG + Intergenic
1082782930 11:57301159-57301181 AGTCCTTTCACCCCAAAGGATGG + Intronic
1085443097 11:76580578-76580600 AGTCGCAGCATCCCAGAGGAGGG + Intergenic
1087613405 11:100461152-100461174 AGCCACTTCTTTACAAAGGAGGG - Intergenic
1089205958 11:116763012-116763034 AGACACTTCACCCCCAAGGAGGG - Exonic
1089280572 11:117371470-117371492 AGTCACTGTATCCCATAGGCAGG + Intronic
1089955834 11:122570171-122570193 AATCACTTGAACCCAGAGGATGG + Intergenic
1091600004 12:1912367-1912389 AGACACTTCACCCCAGAGAAGGG + Intronic
1092941510 12:13412064-13412086 AATCACTTAACCACAAAGGAAGG + Intergenic
1096415422 12:51408314-51408336 AGTCACTTGAACCCAGGGGACGG - Intronic
1098674912 12:73277335-73277357 AGTCAATTCTTGCCCAAGGAAGG + Intergenic
1099193045 12:79580722-79580744 AGTACCTCCATCCAAAAGGAAGG - Intronic
1101835915 12:108295398-108295420 GGTCATTTCTTCCAAAAGGAAGG - Intronic
1102706881 12:114889040-114889062 AGTCTCTTCATCTCAAAAGTGGG + Intergenic
1105240575 13:18605213-18605235 AATCACTTAATCACAAAGGAAGG + Intergenic
1107962361 13:45569919-45569941 AGTCACTTCATCCCAAAGGAGGG - Intronic
1109518782 13:63481436-63481458 AGTTGCTTCATCTCCAAGGAAGG + Intergenic
1110774423 13:79391315-79391337 AGTAACTTCATCTCAAAATAGGG + Intronic
1116290653 14:43033661-43033683 AATCACTTGAACCCAGAGGAAGG + Intergenic
1117240508 14:53827878-53827900 ACTCACTTAATCCAAAAGCAGGG + Intergenic
1121064497 14:90949886-90949908 AGTCAATCCATCCCAAAAGTAGG - Intronic
1130149509 15:81300366-81300388 ACTCCCTGCATCCCCAAGGAAGG + Exonic
1134987412 16:18665527-18665549 AATCACTTGAACCCAAAAGACGG + Intergenic
1138835083 16:60424625-60424647 AGTCCCTTCATACCTAATGAAGG - Intergenic
1139181747 16:64756066-64756088 AATCACTTGAACCCAGAGGAGGG + Intergenic
1140326420 16:74007329-74007351 AGTGAATTCAACTCAAAGGATGG + Intergenic
1140346047 16:74214077-74214099 AGTCACTTCATCCCTTATCAGGG - Intergenic
1140699434 16:77567543-77567565 CCTCACTTCATCCCTAAGGCTGG + Intergenic
1141544819 16:84758854-84758876 AGTCACATGCACCCAAAGGAGGG - Intronic
1143581651 17:7831102-7831124 ACTTATTTCATCCCCAAGGATGG + Exonic
1144996291 17:19271478-19271500 AGCTCCTTCATCCCAAAGGTGGG - Intronic
1150013860 17:61533397-61533419 AGTCACATCAGCCCATAGGAAGG - Intergenic
1150499518 17:65637141-65637163 AGTCAGTTCTTCCTGAAGGATGG + Exonic
1151096130 17:71500932-71500954 AGTTACTTAATCCCAAATGTGGG + Intergenic
1151325422 17:73376990-73377012 AGGCACCTCATCCCACAGGTGGG - Intronic
1151325431 17:73377029-73377051 AGGCACCTCATCCCACAGGTGGG - Intronic
1153834146 18:8949322-8949344 AGCCACTTCTCCCCAGAGGAAGG + Intergenic
1157691578 18:49686751-49686773 CCTCATTTCATCCCAAATGAGGG - Intergenic
1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG + Intergenic
1163186508 19:15642574-15642596 AGTCATTTCAGCCCAGAGGTGGG - Intronic
1163921724 19:20296337-20296359 CCTCACTTCATCCCAGACGATGG - Intergenic
1164071786 19:21775769-21775791 TCTCACTTCATCCCAGACGATGG - Intergenic
1164904433 19:31955448-31955470 TGTGACTTCATACCAAAAGAAGG + Intergenic
1167009031 19:46794419-46794441 AATCACTTGAACCCAGAGGACGG + Intergenic
1167456476 19:49598971-49598993 AGTTTCTATATCCCAAAGGATGG + Intronic
1168664140 19:58190232-58190254 AATCACTTGAACCCAGAGGATGG - Intronic
925411687 2:3643284-3643306 ACCCACTTCATCCTAAAGGCAGG - Intronic
929002804 2:37364689-37364711 AGTCTCTTCAACCAAATGGATGG - Intronic
930102447 2:47613837-47613859 AGTCACTTGAACCCAAAAGGAGG + Intergenic
932745284 2:74329047-74329069 TGTCACTCCAGCCAAAAGGATGG + Intronic
934105766 2:88693078-88693100 AGGCACTGAATCCCAAAGGTAGG - Intronic
936451752 2:112639105-112639127 AAGCACTTCATCCTAAAAGATGG + Intergenic
940668397 2:156637488-156637510 AGTCACTTCAAGTCAAAGGAAGG + Intergenic
943472920 2:188317177-188317199 CCTCATTTCATCCCATAGGAAGG + Intronic
943964798 2:194319804-194319826 AGTCACTTCCTGCCAAATGTGGG + Intergenic
944880496 2:204008016-204008038 AGTCGATTCTTCCCAAAGGTTGG - Intergenic
945877733 2:215295968-215295990 AATCACTTGAACCCACAGGATGG - Intergenic
946661164 2:222001382-222001404 AGTCACTTTATGACAAAGAAGGG + Intergenic
946676014 2:222160358-222160380 GGTAACTTCCTCCCAAAGAATGG - Intergenic
946689893 2:222301902-222301924 AGTCACTGCCTCCCAAACCAGGG - Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947467602 2:230367064-230367086 AATCACTTAATCACAAACGAAGG - Intronic
947753836 2:232546826-232546848 AGGCCCTTCTTCCCAAAGGATGG + Intergenic
1170322462 20:15115314-15115336 AATCACTTGAACCCAAGGGAGGG - Intronic
1170361838 20:15554820-15554842 AGTCATTTCCTTCCAAATGAAGG - Intronic
1171322913 20:24262233-24262255 AGCCCCTTCATCCCTCAGGAGGG + Intergenic
1173359306 20:42326146-42326168 AGCCGCTTTTTCCCAAAGGAAGG - Intronic
1176068316 20:63212174-63212196 AGTCAGTTCTGCCCAGAGGAAGG + Intronic
1178481883 21:32986790-32986812 ACTCCCTTCACCCCAAATGAAGG + Intergenic
1179266232 21:39805893-39805915 AATGGCTTCATCCCTAAGGAAGG - Intergenic
1183187644 22:36301103-36301125 AGCCACTCCATCCTCAAGGACGG + Intronic
1185020366 22:48371032-48371054 AGTCACTTCATCCTCAGGCAGGG + Intergenic
949134982 3:553854-553876 AGTCACTACAGCCCAAAGTAGGG - Intergenic
951093660 3:18603139-18603161 AGTTACTGAATCCCAAAAGAAGG + Intergenic
952594755 3:35002745-35002767 AACAACATCATCCCAAAGGAAGG + Intergenic
953688324 3:45095378-45095400 TGTCAGATCATCACAAAGGAAGG + Exonic
955541386 3:59980267-59980289 ACTCACTTCAGGCCAGAGGAAGG + Intronic
959673540 3:109007591-109007613 AGTCATTTCAGGCCAAAGTATGG - Intronic
960394811 3:117123602-117123624 AGTCACTTTCTCCCAAATGATGG + Intronic
961570526 3:127794834-127794856 AGACTCTGCAGCCCAAAGGAGGG - Intronic
962182380 3:133221604-133221626 AGACACCTGATCACAAAGGAAGG - Intronic
964664226 3:159154490-159154512 AGTCTCTTCATCCAAAAAAAAGG - Intronic
970566540 4:17337377-17337399 AGTCATTGCTTCCCAAAGGCTGG - Intergenic
970597049 4:17610104-17610126 AGTCACTTCATCAGGAAAGATGG + Intergenic
970628701 4:17917910-17917932 TGTAACTTCAGCGCAAAGGAAGG - Intronic
971506234 4:27369250-27369272 GGACACTTCATCACAAAAGATGG + Intergenic
971632704 4:29014737-29014759 AGTCACGTGATGCCAAAAGAAGG - Intergenic
973048815 4:45569166-45569188 AGTCACTTAATCTCAAAGTTAGG + Intergenic
974003589 4:56534418-56534440 GGTCACTTCAACCTAAAGGCTGG - Intronic
974275031 4:59708421-59708443 AGTCTCTTCATCACTGAGGATGG - Intergenic
980217014 4:129865507-129865529 AGTCACTTTATCCTAATAGAGGG - Intergenic
980948228 4:139345295-139345317 AGTCTGTTAATCACAAAGGAAGG + Intronic
981340368 4:143615445-143615467 AGTCACCTCATGCCCCAGGAGGG + Intronic
982799679 4:159688566-159688588 AGTAACTTCAGCCAAACGGAGGG - Intergenic
983970578 4:173867092-173867114 AGTCACTTAATATCAAAAGAAGG + Intergenic
985864019 5:2497706-2497728 AGTCATTTAAACCCAAAGAATGG + Intergenic
993115790 5:83719057-83719079 TGTTACTTGCTCCCAAAGGAAGG + Intronic
995708187 5:115007103-115007125 AGCCACTTCATCACAAGGGTAGG - Intergenic
995972250 5:117986470-117986492 AGTACCTTGGTCCCAAAGGATGG + Intergenic
998098488 5:139412236-139412258 AGTTTCTTCATCCCAATGCATGG - Exonic
998458492 5:142292207-142292229 AGTCTCTGCATCTAAAAGGAGGG - Intergenic
1000043015 5:157499363-157499385 ATTCAGATCATCCCAGAGGAGGG - Intronic
1007336029 6:41155762-41155784 ACTCCCTTGTTCCCAAAGGAAGG - Intergenic
1007552722 6:42742502-42742524 TGTCCCTTCAGCCCTAAGGATGG + Intergenic
1007625716 6:43245171-43245193 AGTTATTTCATCCCAAGGAAAGG + Intronic
1009439950 6:63665948-63665970 AGTCAATTTATCCAAAAGGAAGG - Intronic
1009693970 6:67072360-67072382 AATCACTTGAACCCAAAAGACGG - Intergenic
1011906366 6:92373920-92373942 AGAAACTTAATCCCAAAGGAAGG + Intergenic
1013844743 6:114435826-114435848 AGTCACATCATCCTAAGTGAAGG - Intergenic
1014419826 6:121229816-121229838 AATCCCTACATGCCAAAGGAAGG + Intronic
1015707597 6:136105009-136105031 TGTCTCTTCTTCCCAAAGTAGGG + Intronic
1016149689 6:140724564-140724586 AGTCACTTCATGCTAAATCAGGG + Intergenic
1016419260 6:143867585-143867607 ACTCATTTCACCCCATAGGAAGG - Intronic
1018139156 6:160810007-160810029 AAGCTCTTCATCTCAAAGGAGGG + Intergenic
1018565631 6:165148455-165148477 TGCCACTTCATTCTAAAGGAAGG + Intergenic
1019337780 7:493505-493527 AATCACTTGATCCCGAAAGACGG + Intergenic
1023129343 7:36987051-36987073 AATCGCTTCATTCCAAAGGTTGG - Intronic
1025718682 7:63988862-63988884 AATCACTTGAACCCAGAGGATGG + Intergenic
1026469456 7:70682539-70682561 TGTCACTTCCTCCCAGAGGCAGG + Intronic
1030641734 7:112013822-112013844 AGTCCCTCCATCCTCAAGGAAGG + Intronic
1030922710 7:115412067-115412089 AGTCACATCTTTCCACAGGAAGG - Intergenic
1031542436 7:123010765-123010787 ATATACTACATCCCAAAGGATGG - Intergenic
1033413424 7:141141037-141141059 AGATACTGCATCCTAAAGGAGGG - Intronic
1033656157 7:143376047-143376069 AGTCCCCTCATCCCAAGGGCTGG - Intergenic
1033728629 7:144149139-144149161 AATCACTTAACCACAAAGGAAGG + Intergenic
1034389777 7:150776670-150776692 AGTCACTTAAAACCCAAGGACGG + Intergenic
1035293310 7:157853741-157853763 ACTCAATTCATCCCAAAACACGG - Intronic
1035376517 7:158410412-158410434 TGTCACTTCATCCCACGAGAAGG - Intronic
1035443558 7:158923823-158923845 ATTCACATTATCCCAGAGGACGG + Intronic
1038150489 8:24939100-24939122 AGTCACTTCTTGCCACAGCATGG + Intergenic
1038615283 8:29088300-29088322 ACTCACTTCATCCAAAATGATGG + Intronic
1041447341 8:57966808-57966830 TGTCACTTCATCCCCCAGGCTGG - Intergenic
1043827409 8:84946132-84946154 AATCACTCCAACCCAAAAGATGG + Intergenic
1047678413 8:127227856-127227878 ACTCACTTCTCCCCAAGGGAGGG - Intergenic
1048748852 8:137648096-137648118 AGTCTCATCAGACCAAAGGAAGG + Intergenic
1051460865 9:17313392-17313414 AGTTAATTAATCCAAAAGGAAGG - Intronic
1052388069 9:27845550-27845572 CTTAACTTAATCCCAAAGGAGGG - Intergenic
1055923439 9:81485945-81485967 AATCACTTGAACCCAAAAGATGG + Intergenic
1056099809 9:83290573-83290595 TGTCTCTTCATCCCAAATGCTGG - Intronic
1058651733 9:107181386-107181408 ACTCACTTCCTCCACAAGGAAGG + Intergenic
1060623117 9:125085398-125085420 AATCACTTGAACCCAAAGGGCGG + Intronic
1185841038 X:3391443-3391465 AGTGACATCAAACCAAAGGAGGG - Intergenic
1186762889 X:12741749-12741771 AGCCACTTCAGCCTTAAGGAAGG + Intergenic
1187634204 X:21209245-21209267 ACTCACTTAATTACAAAGGAAGG + Intergenic
1187706838 X:22017685-22017707 AATCACTTGAACCCAAAAGACGG - Intergenic
1187808338 X:23146359-23146381 AGTCACTACATCCCAGGGGCTGG - Intergenic
1190338279 X:49276353-49276375 AGTTACCTCATCTCTAAGGAGGG - Intronic
1191228500 X:58072894-58072916 AGTGAATTCATCTCACAGGATGG - Intergenic
1192155964 X:68746853-68746875 ACTCCCTTCATCCCCAGGGAAGG - Intergenic
1193421592 X:81289769-81289791 AATCACTTCAACCCAAAAGGTGG + Intronic
1194338111 X:92674356-92674378 ATTCACTTATTCCTAAAGGAGGG - Intergenic
1195160561 X:102166750-102166772 AGTCACTTCATAGTAAAGAAGGG + Intergenic
1197199257 X:123734102-123734124 CCTCACTTCATCCCAGACGATGG - Intergenic
1200646512 Y:5791091-5791113 ATTCACTTATTCCCAAAGGAGGG - Intergenic