ID: 1107962527

View in Genome Browser
Species Human (GRCh38)
Location 13:45571135-45571157
Sequence TCCCCAAGCATTGAATGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107962527_1107962530 2 Left 1107962527 13:45571135-45571157 CCTGAGCATTCAATGCTTGGGGA 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1107962530 13:45571160-45571182 AGAGTGGCATAGATGTCAGGAGG 0: 1
1: 0
2: 1
3: 12
4: 146
1107962527_1107962529 -1 Left 1107962527 13:45571135-45571157 CCTGAGCATTCAATGCTTGGGGA 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1107962529 13:45571157-45571179 AACAGAGTGGCATAGATGTCAGG 0: 1
1: 0
2: 1
3: 9
4: 119
1107962527_1107962531 7 Left 1107962527 13:45571135-45571157 CCTGAGCATTCAATGCTTGGGGA 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1107962531 13:45571165-45571187 GGCATAGATGTCAGGAGGAAAGG 0: 1
1: 0
2: 1
3: 26
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107962527 Original CRISPR TCCCCAAGCATTGAATGCTC AGG (reversed) Intronic
900295145 1:1945276-1945298 TCCCCAAGCACTGACTCCTGGGG + Intronic
901643403 1:10704476-10704498 TCCCCCAGCATTGTCTGCGCTGG - Intronic
902528109 1:17072490-17072512 TCCCCAAACATTGTGGGCTCTGG + Intronic
903674986 1:25057891-25057913 TCTCTAAGCATTGAATGGGCTGG - Intergenic
903765016 1:25728495-25728517 TCTCCAAGCACTGAAGTCTCTGG - Intronic
909040275 1:70641145-70641167 TCCTAAAGCATTGAAGGATCAGG + Intergenic
912801520 1:112722694-112722716 TCCCCACGCATTGTAAGCCCTGG + Intronic
918378583 1:183933018-183933040 TCCCCAAGCATTGGGGGCACTGG + Intronic
919149503 1:193677846-193677868 TCCAAAAGCAGTGACTGCTCTGG + Intergenic
919592035 1:199516258-199516280 TCACCAAGATTTGAATCCTCAGG - Intergenic
919945420 1:202315750-202315772 TCACCAAGCACTGAAAACTCGGG - Intronic
920439331 1:205968376-205968398 TTCCACAGCATTGAATCCTCTGG + Intergenic
923503734 1:234587672-234587694 TACTCAAACATTGAAAGCTCTGG - Intergenic
923867358 1:237954147-237954169 TGCCCAACCATGGAAAGCTCTGG - Intergenic
924525215 1:244840367-244840389 TCCCCAAGGATGGGATGCTGGGG - Intronic
1066746661 10:38608172-38608194 TCCCCCACCAGTGAATGCTTTGG - Intergenic
1068438095 10:57017052-57017074 TCCCTAAACAGTGAAGGCTCAGG - Intergenic
1068786414 10:60980398-60980420 ACTTCAAGCATTGAATGCTAAGG + Intronic
1069583698 10:69582538-69582560 TCCCTAAGAAATGTATGCTCAGG + Intergenic
1073403401 10:103276902-103276924 TCCCCAAGAATCGACTGCTTCGG - Intergenic
1074863043 10:117527507-117527529 TGCCCAAACATACAATGCTCAGG - Intergenic
1083667518 11:64284086-64284108 TCCACAGGCACTGAATGCTTTGG - Intronic
1083942339 11:65903164-65903186 CCCCCAAGCAGTGGATGCTGGGG + Intergenic
1085035858 11:73299632-73299654 CATCCTAGCATTGAATGCTCTGG - Intergenic
1103943798 12:124515077-124515099 TCCCCCAGCCTGGGATGCTCTGG + Intronic
1105855904 13:24371572-24371594 TCCCACAGCAGTGACTGCTCAGG - Intergenic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1107887985 13:44890492-44890514 TACCCAAGCTTTGCCTGCTCAGG + Intergenic
1107962527 13:45571135-45571157 TCCCCAAGCATTGAATGCTCAGG - Intronic
1108046657 13:46389826-46389848 TTCCCAAGCACTAAATGCTGAGG + Intronic
1108292845 13:48977974-48977996 CTCCAAATCATTGAATGCTCCGG + Intronic
1112235343 13:97630892-97630914 TCCCCCAGCATTCAATGTGCAGG - Intergenic
1116701830 14:48254427-48254449 TTAACAAGAATTGAATGCTCTGG - Intergenic
1117788730 14:59315476-59315498 TTCCCCAGCATTGAATGTTTAGG - Intronic
1119932279 14:78559479-78559501 TCCCCAAGCAATTTTTGCTCAGG - Intronic
1124146065 15:27126586-27126608 CGCCCCAGCATTCAATGCTCAGG - Intronic
1125140890 15:36406402-36406424 TCCACAAACATTCAATTCTCTGG + Intergenic
1125770516 15:42162424-42162446 GCCCCAGGCAGTGAATGCTGGGG + Exonic
1126109978 15:45169351-45169373 TCCCCAGGCATGGAGTCCTCAGG + Intronic
1127206739 15:56728337-56728359 TGCCCAAGTATTGAATGCAGGGG + Intronic
1127726915 15:61759409-61759431 TCAGCAAGCATAGGATGCTCTGG - Intergenic
1129139862 15:73587840-73587862 TCCCTAACCTTAGAATGCTCTGG + Intronic
1129763315 15:78144842-78144864 TCCCCAAGAGTTTAATTCTCAGG + Intronic
1133099426 16:3470242-3470264 TCCCCCAGCATTGTCTGCTGGGG - Intronic
1133840438 16:9403248-9403270 TCCCCAATCAGGGAATGTTCAGG - Intergenic
1134016488 16:10891994-10892016 TCCCCAGGCAGTGAAAGCTGTGG + Intronic
1134233999 16:12451421-12451443 TCCCCAACCATTTAATGATCCGG + Intronic
1135306541 16:21372063-21372085 TCCCCAAGGAATGAATTCTTGGG + Intergenic
1136736401 16:32471461-32471483 TCCCCCACCAGTGAATGCTTTGG + Intergenic
1139357951 16:66378614-66378636 TCCCCAGGCATTGGGTGCTCAGG - Intronic
1203016669 16_KI270728v1_random:358117-358139 TCCCCCACCAGTGAATGCTTTGG - Intergenic
1203035004 16_KI270728v1_random:631275-631297 TCCCCCACCAGTGAATGCTTTGG - Intergenic
1143782550 17:9236857-9236879 TCCCCCATCAGTGAATGCCCTGG - Intronic
1147969057 17:44210081-44210103 ACCCCATTCATTGAAAGCTCGGG - Intronic
1148765323 17:50035461-50035483 TCCCCAAGGATAGAATCATCTGG + Intergenic
1148805863 17:50263718-50263740 TCCCCAAGAAGGCAATGCTCTGG - Intergenic
1157380117 18:47206655-47206677 GCAACAAGCATTGACTGCTCTGG + Intergenic
1159251983 18:65891403-65891425 TCCACAAGCATTGAGTGATAGGG + Intergenic
1160399984 18:78603167-78603189 TCACCAAGCAGTCAATTCTCCGG - Intergenic
1163270965 19:16253731-16253753 TCCCCAAGCTCTGAATAGTCAGG + Intergenic
1165044021 19:33090130-33090152 TCCACAAACAGGGAATGCTCTGG - Intronic
1166402996 19:42497683-42497705 GCCCCAAGCAAGGAAAGCTCTGG + Intergenic
1166620883 19:44298995-44299017 TCCCTAAACATTGCATGCTGGGG - Intronic
925892077 2:8442458-8442480 TCCCCAAGCAGTGAGTTCTTTGG - Intergenic
925953699 2:8939655-8939677 TCCCCAGGGATTGTGTGCTCTGG - Intronic
934309068 2:91847361-91847383 TCCCCCACCAGTGAATGCTTTGG - Intergenic
936293260 2:111245096-111245118 TCCCCATGGATTGATTGCTTTGG - Intergenic
938710010 2:133968153-133968175 TCCTCAAGCATTTCTTGCTCTGG - Intergenic
939729715 2:145767056-145767078 CCACCAAGCAATGAATCCTCTGG + Intergenic
940719638 2:157268022-157268044 TCCCCAAGCACTGATGTCTCAGG - Intronic
945543126 2:211113727-211113749 TCCCCATGAAATGAATACTCTGG - Intergenic
1170585900 20:17733806-17733828 TACCCAAGCATTGAATTTTGGGG - Intronic
1175276181 20:57772443-57772465 TCCCCAAGCCTCCGATGCTCAGG - Intergenic
1179423173 21:41252158-41252180 TCCCCATGATTTAAATGCTCAGG + Intronic
1184549215 22:45195589-45195611 TCCCCCAGCAGTGTCTGCTCAGG - Intronic
956160355 3:66345248-66345270 TCCCCTAGCATTGACTGATTTGG + Intronic
959222592 3:103540797-103540819 TCCCGCAGCATTGAAGGCTCAGG + Intergenic
960022265 3:112968227-112968249 TACCCATGCATTGAATGTTTTGG - Intronic
969237541 4:5876580-5876602 TATCCAAGCATTGAATGCAGGGG + Intronic
969536975 4:7762349-7762371 TCCCCAAGCATAGAATACAGAGG - Exonic
977030936 4:91882317-91882339 TGCTCAAGCATTGAATCTTCAGG + Intergenic
982103158 4:151988603-151988625 TCCTCAAGAACAGAATGCTCAGG + Intergenic
991965579 5:72086993-72087015 TCCTCAAGTCTTGAATTCTCTGG - Intergenic
994734708 5:103538401-103538423 TCCCCAAGCATATGATGCACAGG + Intergenic
996607813 5:125344574-125344596 TCCCCAAGCTTTGAATTCCAAGG + Intergenic
999832161 5:155331186-155331208 TCCCCAAGCATTCAGGGATCAGG + Intergenic
1000261272 5:159590977-159590999 TCCCCAAGCACTGAATGTGCTGG - Intergenic
1004156089 6:13169491-13169513 TCCCCAAACATTAAATGTTGGGG - Intronic
1007211851 6:40198592-40198614 TCTCCAAGAAATGATTGCTCAGG - Intergenic
1007391077 6:41549656-41549678 TACCCAAGCAGTGAAGGCTGGGG + Intronic
1008644861 6:53503812-53503834 TCCTGAAGCATGGAAAGCTCTGG - Intronic
1012177410 6:96105357-96105379 TCCTCAAACAATGAATGTTCTGG - Intronic
1015698839 6:136012181-136012203 TTCCCACCCTTTGAATGCTCAGG + Intronic
1017620942 6:156296473-156296495 TTAACAAGAATTGAATGCTCTGG - Intergenic
1028860097 7:95639491-95639513 TCCCCAAGCATTGGCTTCTGTGG - Intergenic
1035478406 7:159159984-159160006 TCCCCAGGCCTTCAATGCCCAGG - Intergenic
1035846335 8:2868850-2868872 GCCCCAAACATAGAATGTTCAGG + Intergenic
1040636219 8:49276207-49276229 TCCCAAAGCTTTTAATGCTATGG + Intergenic
1041483669 8:58350338-58350360 TCCCCCAGCATTGAATATTTGGG + Intergenic
1043122778 8:76350136-76350158 TCCCAAAGAAATGAATGCTGCGG - Intergenic
1043522524 8:81061794-81061816 TCCCCAAGCATCCATGGCTCAGG - Intronic
1044377418 8:91492776-91492798 TCTCAAATCATTGAATTCTCAGG - Intergenic
1044404769 8:91815813-91815835 TTCCCAACCATTAAATACTCAGG + Intergenic
1047114332 8:121823777-121823799 TCACCAAGTATCGAATGCTTTGG + Intergenic
1049382402 8:142323869-142323891 TCCCCAAGCCATGCATGCTATGG - Intronic
1054760938 9:69003493-69003515 ACCCCAAGGGTTGACTGCTCAGG + Intronic
1054992857 9:71350344-71350366 TCCCCAATCTTTCAATACTCCGG + Intronic
1058701948 9:107608277-107608299 TCCTCAAGCTTTCATTGCTCTGG + Intergenic
1059277163 9:113106854-113106876 TCACCAGGCACTGAATCCTCAGG + Intergenic
1059279088 9:113117697-113117719 TCACCAGGCACTGAATCCTCAGG - Intergenic
1060214666 9:121731617-121731639 GCCCCAAGAATGGACTGCTCTGG + Intronic
1186843133 X:13505273-13505295 TCCCCAATCATTGAATGACAAGG - Intergenic
1189266318 X:39719541-39719563 GACCCTAGCATAGAATGCTCTGG + Intergenic
1198405765 X:136311012-136311034 TCACCAAGAATTGAATCATCTGG - Intronic
1199971732 X:152866622-152866644 TCTCCAAGCACAGAATGCTAAGG - Intronic