ID: 1107962877

View in Genome Browser
Species Human (GRCh38)
Location 13:45574660-45574682
Sequence CTGTGCTTGTTGGAGTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 1, 2: 2, 3: 42, 4: 273}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107962870_1107962877 20 Left 1107962870 13:45574617-45574639 CCATCTACATAGAGGGAGTAGGC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1107962877 13:45574660-45574682 CTGTGCTTGTTGGAGTTTCTGGG 0: 1
1: 1
2: 2
3: 42
4: 273
1107962867_1107962877 22 Left 1107962867 13:45574615-45574637 CCCCATCTACATAGAGGGAGTAG 0: 1
1: 0
2: 0
3: 7
4: 135
Right 1107962877 13:45574660-45574682 CTGTGCTTGTTGGAGTTTCTGGG 0: 1
1: 1
2: 2
3: 42
4: 273
1107962868_1107962877 21 Left 1107962868 13:45574616-45574638 CCCATCTACATAGAGGGAGTAGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1107962877 13:45574660-45574682 CTGTGCTTGTTGGAGTTTCTGGG 0: 1
1: 1
2: 2
3: 42
4: 273
1107962874_1107962877 -6 Left 1107962874 13:45574643-45574665 CCTTGGGGCTTTTCTGTCTGTGC 0: 1
1: 0
2: 5
3: 46
4: 530
Right 1107962877 13:45574660-45574682 CTGTGCTTGTTGGAGTTTCTGGG 0: 1
1: 1
2: 2
3: 42
4: 273
1107962864_1107962877 30 Left 1107962864 13:45574607-45574629 CCAGGTTGCCCCATCTACATAGA 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1107962877 13:45574660-45574682 CTGTGCTTGTTGGAGTTTCTGGG 0: 1
1: 1
2: 2
3: 42
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107962877 Original CRISPR CTGTGCTTGTTGGAGTTTCT GGG Intronic
903607981 1:24588932-24588954 CTGTGCTTTGTGGATTTGCTGGG + Intronic
903858658 1:26352311-26352333 CTGTGCGTGTTTGTATTTCTTGG - Intronic
904969830 1:34410814-34410836 TTGTGCTTGATGGAGTTACTGGG - Intergenic
905942176 1:41872938-41872960 CTGTGCATGTTTAACTTTCTAGG + Intronic
906890760 1:49710426-49710448 CTGGGCCTGTTGGAGGTTGTGGG + Intronic
907046906 1:51305097-51305119 CTGAGGCTGTTGGAGTTTGTGGG - Exonic
910336897 1:86143214-86143236 CTGTGTTAGATGGAGTTTCTTGG - Intronic
911390384 1:97233647-97233669 CTGTGCCTATTGTTGTTTCTGGG + Intronic
911726564 1:101247382-101247404 CTGTGCTAGGTGGAGCTGCTTGG + Intergenic
915392857 1:155560461-155560483 CTGTGGATGTTGGAACTTCTTGG - Intronic
915409014 1:155686390-155686412 CTGTGGATGTTGGAACTTCTTGG - Intronic
915488247 1:156236678-156236700 CTGTGCCTGGTGGAGGATCTGGG - Intronic
916026608 1:160838653-160838675 CTGTGCTCTTTGGGGTTCCTGGG - Intronic
916209807 1:162351247-162351269 CTGTTATTGTTGCAGTTTCAAGG + Intronic
918089538 1:181276913-181276935 CTCTGATTTTTAGAGTTTCTGGG - Intergenic
918376831 1:183917880-183917902 CTGTGTTTGCTGGAGTGTCGGGG + Intronic
919095137 1:193025120-193025142 CTGTGCCTGTTGGTATTTCTGGG - Intronic
920130896 1:203731065-203731087 CAGTGCTTATTGGAGTTACAAGG - Intronic
920448871 1:206041818-206041840 CTGGGCTTCTGGCAGTTTCTCGG - Intronic
921400365 1:214715382-214715404 CTGTGCCTATTGGCATTTCTCGG + Intergenic
921896379 1:220406181-220406203 CTGTGCCTATTGGCATTTCTGGG - Intergenic
923764130 1:236877008-236877030 CCATGCCTGTTGCAGTTTCTGGG + Intronic
924148844 1:241106992-241107014 CTGTGTTTGTTGGGATTACTTGG + Intronic
924213547 1:241795284-241795306 CAGTGTGAGTTGGAGTTTCTAGG + Exonic
924649345 1:245910061-245910083 CAGTTTTTGTTGGAGTCTCTTGG - Intronic
924946851 1:248852301-248852323 ATGTGGGTGTTGTAGTTTCTTGG - Intronic
1063900343 10:10726397-10726419 CTGCTCTCATTGGAGTTTCTAGG + Intergenic
1065059908 10:21889699-21889721 CTGTGCCTGTTAGTGTTTCTGGG - Intronic
1065422738 10:25565098-25565120 CCCTGCTTCTTCGAGTTTCTGGG + Intronic
1067398232 10:45944255-45944277 CTGTGTTTGTTGGAGATTTGAGG - Intergenic
1067866551 10:49913340-49913362 CTGTGTTTGTTGGAGATTTGAGG - Intronic
1068189291 10:53629464-53629486 CTGATCTTGTTGTGGTTTCTAGG + Intergenic
1068418402 10:56757022-56757044 CTGTGTTGGCTGTAGTTTCTGGG - Intergenic
1070719755 10:78747844-78747866 GTGTGCTGGGGGGAGTTTCTGGG - Intergenic
1071241680 10:83713079-83713101 CATTGCCTGTTGGTGTTTCTGGG - Intergenic
1071465049 10:85932072-85932094 CTGGGCTTTCTGGAGTTTCTGGG + Intronic
1072262707 10:93696271-93696293 CCGTGCCTGTTGGTGTTTCCGGG - Intronic
1072514064 10:96160177-96160199 CTTTTCTTCTTGGAGGTTCTTGG - Exonic
1072546123 10:96440891-96440913 CTGTCATTATTGGATTTTCTTGG + Intronic
1072819237 10:98539765-98539787 CTCTGCCTCTTGCAGTTTCTTGG + Intronic
1073327742 10:102652052-102652074 CTGTGCCTCTTGGTGCTTCTGGG + Intronic
1074518908 10:114198855-114198877 CTCTGCCTTTTGGTGTTTCTGGG + Intronic
1075117976 10:119642989-119643011 CTGTGCTTCCTAGAGTTGCTGGG + Intergenic
1075333589 10:121593072-121593094 CTGTGATACTTGGAGGTTCTCGG + Intronic
1076647903 10:131966037-131966059 ATGTGCATGTAGAAGTTTCTAGG + Intergenic
1079130942 11:17746579-17746601 CTGTGCTTGTGGAAAGTTCTAGG + Intronic
1079250413 11:18782995-18783017 CTGTGGTGGTGGGAGTATCTTGG + Intronic
1079778941 11:24573771-24573793 GTGTGCTTTTTAAAGTTTCTAGG - Intronic
1083674935 11:64319822-64319844 GTGTGCTGTTTGGAGTTCCTGGG + Exonic
1084365578 11:68695668-68695690 CTGTGCCTGTTGGCATTTCTAGG - Intergenic
1084522689 11:69674259-69674281 CTGTGTATGTTGCAGTTTTTTGG - Intronic
1085115906 11:73931471-73931493 CTGTGCTAGATGGTGTTTCTTGG + Intergenic
1087871244 11:103295359-103295381 CTGTGCCTGTTGCTGCTTCTAGG - Intronic
1090101086 11:123797533-123797555 CTGTGCCTGTTGCTGCTTCTGGG + Intergenic
1090548248 11:127789817-127789839 CTGTGCATGTTGGTGTTACAGGG - Intergenic
1091534404 12:1391835-1391857 CTGTGCCTGTTGGCATTTCCTGG + Intronic
1091922355 12:4315605-4315627 CTGTGCATGTTGGAGTATTGAGG - Intergenic
1092293262 12:7178016-7178038 CTGGGCATGTTGGTGTTTCTGGG + Intergenic
1093631786 12:21419099-21419121 CTGTGCCTATTGGTATTTCTGGG - Intronic
1094247173 12:28311841-28311863 TTGTGCCTGTTGGTGTTTCCTGG + Intronic
1096466529 12:51849784-51849806 CTGTGCCTCTTGGACTCTCTTGG - Intergenic
1096569605 12:52514404-52514426 CTGTGCTTCTTGGAGTCTCTGGG + Intergenic
1097550498 12:61062037-61062059 CTCTGCTTTTTAGAGTTTCCAGG - Intergenic
1099317592 12:81104253-81104275 CTGTGCCTATTGGTGCTTCTCGG - Intronic
1103882089 12:124173955-124173977 AAGTGCTTATGGGAGTTTCTAGG + Intronic
1104050078 12:125188955-125188977 CAGGGCTGGTTGGATTTTCTGGG + Intronic
1104658198 12:130589995-130590017 CTGTTCTTGAGTGAGTTTCTGGG + Intronic
1104680374 12:130746985-130747007 CTCTGCTTGTTGTAGTTCCTAGG - Intergenic
1104736800 12:131140010-131140032 CTGTGCTTGGGGGAGCTTCTCGG + Exonic
1105747666 13:23392958-23392980 CTGTGCTTATTGTGTTTTCTGGG - Intronic
1107189330 13:37560558-37560580 CTGTGCTTCTAGGTGTTCCTGGG - Intergenic
1107228166 13:38076062-38076084 CTTTGCCTGTTGGTGTTTCTGGG - Intergenic
1107962877 13:45574660-45574682 CTGTGCTTGTTGGAGTTTCTGGG + Intronic
1109454226 13:62562871-62562893 ATGTGCTTATTGATGTTTCTTGG + Intergenic
1110423270 13:75336998-75337020 CACTGCTTGTTGCATTTTCTGGG + Exonic
1112138597 13:96612379-96612401 CTCTGCTTGTTGGTGTTCCAAGG + Intronic
1113167383 13:107457459-107457481 CTGTGCTTGCTACACTTTCTTGG - Intronic
1113549855 13:111184433-111184455 CTGTACCTGTTGGTGTTTCTGGG + Intronic
1114730322 14:24986312-24986334 CTGTGCTTCTTGGACTATCCTGG - Intronic
1117201399 14:53393622-53393644 CTGTCCTTGTTGGGATTTCCAGG + Intergenic
1120238387 14:81919217-81919239 CTGTAATTCTTGGAGTTCCTTGG + Intergenic
1122664386 14:103318509-103318531 CTGTGCTTGTTGTATTGGCTTGG - Intergenic
1124152334 15:27192790-27192812 CTCTGCTTTTTAGAGTTTCCAGG + Intronic
1124183072 15:27496451-27496473 CTGTACTTGTTGGTGCTTCCAGG + Intronic
1124194006 15:27604639-27604661 CTATGCTCATTGGGGTTTCTGGG + Intergenic
1124385667 15:29206468-29206490 CTGTGATTACTGGAGTTTTTGGG - Intronic
1126359871 15:47835262-47835284 CTCTTCTTGTTGGAGAATCTGGG + Intergenic
1126375965 15:47996838-47996860 TTGTCCTTGTTGCAGTTCCTGGG - Intergenic
1126731797 15:51691172-51691194 CTGTGCTTGTTTCAGTTGCTTGG - Intronic
1127243510 15:57145548-57145570 ATTTGCTTTTTGAAGTTTCTTGG + Intronic
1128596580 15:68957136-68957158 CTGTGCCTGTTCATGTTTCTGGG + Intronic
1129981780 15:79878806-79878828 CTGTGCTTGTTGCTGCCTCTGGG + Intronic
1130864879 15:87924362-87924384 CTGTCTTTCTAGGAGTTTCTGGG + Intronic
1133418869 16:5628466-5628488 CTGTGTTTGTTTAGGTTTCTAGG + Intergenic
1135740098 16:24967818-24967840 TTGTCCTTGATGGAGTTTTTTGG - Intronic
1135961992 16:27002775-27002797 CTGTGACTGTTGGTTTTTCTGGG - Intergenic
1137030422 16:35518791-35518813 CTGTGCTTCTGGGTGTTCCTGGG - Intergenic
1139480637 16:67228680-67228702 CTGTGCTTCTTGGGCTATCTGGG - Intronic
1142162010 16:88562532-88562554 TTGGGTTTCTTGGAGTTTCTTGG - Intergenic
1143396566 17:6603724-6603746 CTGTGCCTATTGGTGTTTCTGGG - Intronic
1144181042 17:12752883-12752905 CTGCTCTTGCTGGAGTTTCCAGG - Exonic
1144855326 17:18264304-18264326 CTGTGCTTGTGGCAGTCCCTGGG + Exonic
1147267566 17:39244169-39244191 CTGTGGTTGTTGAAGCTTCCAGG + Intergenic
1147792965 17:43025001-43025023 CTGGGCTTATTTGACTTTCTCGG - Intronic
1151480592 17:74368291-74368313 CTGTGCTACTTGCACTTTCTGGG + Intronic
1151522331 17:74639289-74639311 ACGTGCTCGATGGAGTTTCTGGG - Intergenic
1152857059 17:82671136-82671158 CTGTGTGTGTTGGAGTTACAGGG - Intronic
1153315052 18:3713112-3713134 CTGTACTTGTTGGTGGTTCAGGG - Intronic
1153671633 18:7417831-7417853 CTGTTCATGCAGGAGTTTCTCGG + Intergenic
1153890225 18:9507135-9507157 CTATGCTTGTTGGTGTTTCTGGG + Intronic
1155676073 18:28430324-28430346 CTATGCCTGTTGGTATTTCTAGG + Intergenic
1156362106 18:36392222-36392244 CTGTGCTGGGTGGGGGTTCTGGG - Intronic
1157402421 18:47399669-47399691 CAGTGCAAGTTGGAGTGTCTGGG + Intergenic
1157448821 18:47769944-47769966 CTATGCTTGTTAAAGTTTCTAGG + Intergenic
1158690596 18:59656902-59656924 TTCTGCCTGTTGGGGTTTCTGGG - Intronic
1158940020 18:62399163-62399185 CTGGGCATCTTGGATTTTCTTGG - Intergenic
1159214041 18:65366562-65366584 CTGTGCATGTTGTAGTTGCCTGG + Intergenic
1159271902 18:66163918-66163940 CTGTACCTGTTGGCATTTCTGGG - Intergenic
1165849677 19:38842505-38842527 CTGTGCTTGTAGCTGTTCCTTGG + Intronic
1166954281 19:46452584-46452606 CTGTGCATTTCAGAGTTTCTGGG + Intergenic
1167956090 19:53065222-53065244 CAGTGCTGGTTAGGGTTTCTTGG - Intergenic
925059724 2:881557-881579 CTGTACTGGTGGGTGTTTCTGGG - Intergenic
926916257 2:17894792-17894814 CTGGGCTTGTTGGAGGGTGTGGG + Intronic
927356578 2:22180274-22180296 CTGTGGTTGTTGTGATTTCTGGG - Intergenic
929090326 2:38210382-38210404 CTGTGTTTGTTGGCATTTCTAGG - Intergenic
930549421 2:52813771-52813793 ATCTTTTTGTTGGAGTTTCTAGG + Intergenic
931590961 2:63882858-63882880 CTGTGGTTGTTGAAATCTCTGGG + Intronic
933443176 2:82340880-82340902 CTTTGCTTGTTTGGGTTTGTGGG + Intergenic
933936916 2:87213500-87213522 CTGTGCCTGTTGGTATTTCTAGG + Intergenic
934124291 2:88871415-88871437 CTGGGCCTGTTGGTGTTTCTGGG - Intergenic
934546420 2:95220367-95220389 CTGTGCCTGTTGGCGTTTCCGGG + Intronic
934907821 2:98221256-98221278 CAGTGCTTGTTGGAGATCCCAGG - Intronic
935678575 2:105617194-105617216 CTGTGCTTGTCAGGCTTTCTGGG - Intergenic
936356227 2:111752324-111752346 CTGTGCCTGTTGGTATTTCTAGG - Intergenic
936975058 2:118210669-118210691 CTGTGCCTCTTGGAGTTTCCAGG - Intergenic
937085052 2:119166034-119166056 GTGAGCTTGTTGCAGTGTCTGGG + Intergenic
937240234 2:120456016-120456038 CTGTGCCAGTTAGGGTTTCTGGG - Intergenic
937240666 2:120460339-120460361 CTGTGTTCATTGGTGTTTCTGGG + Intergenic
939544218 2:143532927-143532949 CTGTTTTTGTTTGAGTTTTTTGG - Intronic
940001180 2:148967481-148967503 CTGTGCTTGCTGGTGTGCCTTGG + Intronic
940142879 2:150513681-150513703 CTGTGCTTTTTGGATATTATGGG + Intronic
940853888 2:158714837-158714859 CTGTGCTTGTTGCTGTTTCCAGG + Intergenic
941559570 2:167027580-167027602 CTCTGCTTTTTAGAGTTTCCAGG + Intronic
942119180 2:172760017-172760039 CTGTGCCCATTGGTGTTTCTGGG - Intronic
942701166 2:178712396-178712418 CTGTGCTACTTGGAATTTCCAGG + Exonic
942757229 2:179356284-179356306 CTTTGGTGGTTGAAGTTTCTTGG + Intergenic
944544992 2:200790373-200790395 CTGTCCCTGTGGGAGCTTCTTGG - Intergenic
944825794 2:203482038-203482060 CTCTTATTGTTGGTGTTTCTTGG - Intronic
945681582 2:212920389-212920411 CTTAGATTGTTTGAGTTTCTGGG - Intergenic
946670782 2:222101877-222101899 ATCTGCTTGTGGGAGTTCCTTGG + Intergenic
949052900 2:241906794-241906816 CTGTGCTTGTTGCTGCCTCTAGG + Intergenic
949059955 2:241951079-241951101 CCGTGCTGGTTGGAGCTGCTGGG + Intergenic
1168961513 20:1873200-1873222 ATGTGCTTCCTGGACTTTCTAGG + Intergenic
1170841666 20:19928999-19929021 CACTGCTTGTGGGATTTTCTGGG + Intronic
1171166794 20:22979121-22979143 CTGTGCCTGTTGGTATTTCTGGG + Intergenic
1174127428 20:48317344-48317366 CTGTGCTTGTTGGCATTTCCAGG - Intergenic
1174148929 20:48472480-48472502 CTGTTCTTGTTTGAGAGTCTCGG - Intergenic
1174904514 20:54536592-54536614 GTGTGCCTATTGGGGTTTCTGGG - Intronic
1174956533 20:55104471-55104493 CTGTGCCTATTGGCATTTCTAGG + Intergenic
1176335980 21:5600640-5600662 CTGTGCCTGTTGAAGCCTCTGGG - Intergenic
1176391777 21:6220308-6220330 CTGTGCCTGTTGAAGCCTCTGGG + Intergenic
1176469642 21:7095866-7095888 CTGTGCCTGTTGAAGCCTCTGGG - Intergenic
1176493203 21:7477644-7477666 CTGTGCCTGTTGAAGCCTCTGGG - Intergenic
1176507439 21:7660739-7660761 CTGTGCCTGTTGAAGCCTCTGGG + Intergenic
1177175854 21:17700130-17700152 CTCTGCTGGTTGGCGTTTCCAGG - Intergenic
1180565645 22:16661418-16661440 CTCTGCTTTTTAGAGTTTCCAGG - Intergenic
1180944114 22:19680299-19680321 CTGTGTCTGTTGGCGTTTCCAGG - Intergenic
1181907057 22:26206619-26206641 CTGTGCTTTTTGGGATTTTTAGG - Intronic
1182915384 22:34024560-34024582 CTGTGGCTTTTGGAGTCTCTGGG + Intergenic
1183133758 22:35866683-35866705 CAGTGCCTGTTGGTGTTTCTGGG - Intronic
1184571201 22:45326053-45326075 CTGTGCCTGTTCGTGTTGCTTGG - Intronic
1184636518 22:45836501-45836523 CTGGGCTTCCTGGAGTTTCATGG - Intronic
1185035033 22:48470233-48470255 CTGTGCTTGTGTGAGTTTATGGG + Intergenic
949706246 3:6820730-6820752 CTGTGCTTGTGTGTGTGTCTTGG - Intronic
949866197 3:8549494-8549516 CTCTGCTTGTTTGATTTCCTGGG - Intronic
952580055 3:34822973-34822995 CTGGGCTTGTTGGCATGTCTCGG + Intergenic
952912405 3:38202262-38202284 CTGTGATTGTTAAAGTTTCTTGG + Intronic
956167175 3:66405683-66405705 ATGTGCTTTCTGCAGTTTCTCGG - Intronic
957136574 3:76296201-76296223 CAGTGGTTGTTGGCGTTGCTTGG - Intronic
958076003 3:88679160-88679182 CTTTGCCTATTGGAGGTTCTGGG + Intergenic
959825574 3:110792045-110792067 CTGAGCTTTTAGGAGTTTATTGG - Intergenic
960294192 3:115923147-115923169 CTGGCCTTGTTTGAGTGTCTTGG - Intronic
960638263 3:119804907-119804929 GTGTGCTTGTTGAAATGTCTAGG - Intronic
961449948 3:126998167-126998189 CTGTGCCTTTTGGGGTTTCAGGG + Intronic
961529155 3:127529407-127529429 CTGAGCCTGTTGGTATTTCTAGG - Intergenic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
965879512 3:173371720-173371742 CTGTGTTTATTGGAGCTTCCAGG - Intergenic
965960350 3:174422197-174422219 TTCTTCTTGTTGAAGTTTCTTGG + Intergenic
966652670 3:182318553-182318575 CTGGGCTTCTGGGATTTTCTTGG + Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
968188465 3:196650010-196650032 CTCTCCTTGTTGGAGCTGCTCGG - Intronic
968322609 3:197784206-197784228 CTGTACTTTTTGGTGTTTTTTGG + Exonic
969603796 4:8191800-8191822 CTTTGCTTGTTTGTGTTTCTGGG + Intronic
973047551 4:45553414-45553436 CTTTTCTTGTTGGAGTTTTGTGG - Intergenic
976691820 4:87876601-87876623 CTGTGCTTGTTTGCATTTCTGGG - Intergenic
978927725 4:114269452-114269474 CTGTTCTTGGCTGAGTTTCTGGG - Intergenic
979123908 4:116942193-116942215 CTCTGCTTGGTTAAGTTTCTTGG + Intergenic
980149711 4:129030821-129030843 CTGGGCTTGTTTGAGTTGGTAGG - Intronic
981504402 4:145482861-145482883 CTGTCTTTGTTAGTGTTTCTCGG + Exonic
981578053 4:146225560-146225582 CTCTGCTTTTAGGAGTGTCTTGG - Intronic
981821005 4:148887617-148887639 ATGAGCTTGGTGGGGTTTCTAGG + Intergenic
984188539 4:176576621-176576643 CTGTTCTGCTTAGAGTTTCTGGG - Intergenic
984719337 4:182955343-182955365 CTGTGCTTCCTCTAGTTTCTGGG - Intergenic
984878256 4:184388720-184388742 CGGTGGTTGTTGGGGCTTCTTGG - Exonic
988665379 5:33321548-33321570 CTTAAATTGTTGGAGTTTCTTGG - Intergenic
990478238 5:56182963-56182985 CTGTGCCTGTTGACATTTCTGGG + Intronic
992388464 5:76308628-76308650 CTGTGCCTATTGGCATTTCTGGG + Intronic
992396772 5:76375717-76375739 TTTTGCTTATTGGAGTCTCTTGG - Intergenic
992841194 5:80696483-80696505 CTGTGCCTGTTGGTCTTTCCGGG + Intronic
992946577 5:81817276-81817298 CTGTGCCCATTGGTGTTTCTGGG - Intergenic
995228233 5:109727783-109727805 CTGGGTTGGTTGGACTTTCTGGG + Intronic
996087960 5:119323331-119323353 CTGCATTTCTTGGAGTTTCTCGG + Intronic
997519187 5:134511783-134511805 CTGTGATTGCTGGATATTCTAGG - Intergenic
997949797 5:138233206-138233228 CTGTGCTTGTTGGAACTGATAGG + Intergenic
998514693 5:142742345-142742367 CTGTGCATGAGGGATTTTCTGGG + Intergenic
998788344 5:145737576-145737598 CTGTGCTTGTTGCTGTTTTCAGG - Intronic
1000392400 5:160737983-160738005 CTGTGCCTGCTGGAGTTGTTAGG - Intronic
1001714843 5:173806969-173806991 CTGTGCTGGGTGGATTTACTGGG + Intergenic
1002465018 5:179403939-179403961 CTGGGCCTGTTGGAGATTGTGGG + Intergenic
1003432278 6:6050536-6050558 CTGTTCCTGTTTGAGGTTCTTGG + Intergenic
1003855822 6:10273634-10273656 CTGTGCTTGTTGGAATTTCTGGG - Intergenic
1005485289 6:26293769-26293791 CTGTGCTTCTGGGTGTTCCTGGG + Intergenic
1006888457 6:37402116-37402138 CTGTGCTTGTTGCCGCCTCTGGG + Intergenic
1007551912 6:42736380-42736402 CTGTGCCTGGTGCACTTTCTAGG - Intergenic
1008525104 6:52399807-52399829 CTGGGCTTGTTGGAGTTCTGGGG - Intronic
1010589800 6:77699653-77699675 CTCTGCTTTTTGGAGTTTCCAGG + Intronic
1010865350 6:80969753-80969775 CTGTGTTTGTTAGAATTACTTGG - Intergenic
1011697949 6:89930045-89930067 TTATGGTTGTTGGAATTTCTTGG - Exonic
1012155436 6:95813576-95813598 TTGTGTTTGTTGTTGTTTCTGGG + Intergenic
1012382609 6:98638207-98638229 CTGTGCAGGTGGGAGTGTCTTGG + Intergenic
1012839291 6:104309199-104309221 ATATGCTATTTGGAGTTTCTTGG + Intergenic
1013597509 6:111673234-111673256 CTGTGCTGGTTGGCGATTCCCGG + Intronic
1013798559 6:113912460-113912482 CTGTGCTTCTGGGAGTGCCTGGG - Intergenic
1014121624 6:117732189-117732211 CCTTGCTTGTTGGATTTTGTTGG + Intergenic
1016403937 6:143710147-143710169 CTGTGCCCATTGGTGTTTCTGGG + Intronic
1018738693 6:166710851-166710873 CTGTGCCTGCTGGAATTCCTGGG - Intronic
1018782381 6:167079972-167079994 CTGTGCTTTTTGGTCTGTCTTGG + Intergenic
1019061240 6:169259693-169259715 CTGTGCTGTTTGCAGTGTCTGGG - Intergenic
1019181985 6:170193291-170193313 TTGTGCCCGTTGGTGTTTCTGGG - Intergenic
1019380976 7:723355-723377 CTGTGCCTGTTGGCTGTTCTGGG + Intronic
1020232860 7:6333311-6333333 CTGTCCTTGCTGAAGCTTCTCGG - Intronic
1020713239 7:11635969-11635991 CTGAGCTTGTGTGAGTTTCTCGG - Intronic
1021751868 7:23808973-23808995 CTGTGTCTGTTGGCATTTCTGGG + Intronic
1021852438 7:24821781-24821803 CTGTGCCTGTGGGATTTTCAAGG + Intronic
1023456401 7:40343524-40343546 CTGTTCTTGGTGGAGTTTTGAGG - Intronic
1023977465 7:45041518-45041540 CTGTACCTGTTGGTGTTTCTGGG - Intronic
1024157974 7:46645757-46645779 TTGTGACTGTTGGTGTTTCTGGG + Intergenic
1026116275 7:67498300-67498322 CTGTCCTTGTAGCATTTTCTGGG - Intergenic
1026803904 7:73417838-73417860 CTGGGCTTGCTGGTGTGTCTGGG + Intergenic
1028243851 7:88452529-88452551 CTGTGCTTCTCAGAGATTCTGGG - Intergenic
1028665875 7:93342900-93342922 CTGTGCTTTTTAGAGTTTCCAGG - Intronic
1029154406 7:98504934-98504956 CTGTACCTGTTGGCATTTCTAGG - Intergenic
1029428465 7:100513085-100513107 CTGTGCTTGTTAGAGTAGTTTGG - Intergenic
1029582890 7:101449107-101449129 CTATCCTTGTTGGAGGTTCCAGG + Intronic
1030345408 7:108427805-108427827 CTGTATTTGGTGGAGTTTCTTGG - Intronic
1033417056 7:141171510-141171532 TTCTGCTAGTTGGTGTTTCTGGG + Intronic
1033925110 7:146449365-146449387 TTGTGCATGTTGGTATTTCTGGG + Intronic
1036126686 8:6069430-6069452 CTGTGCCTGAAGCAGTTTCTAGG - Intergenic
1037156089 8:15700869-15700891 CTTTGCCTGTTGGTGTTTCTGGG + Intronic
1037183430 8:16033555-16033577 CTCTGATTTTTAGAGTTTCTGGG - Intergenic
1038126213 8:24675625-24675647 CTGTGTTTGAAGTAGTTTCTGGG - Intergenic
1038140596 8:24840626-24840648 CTCTGCTTTTTAGAGTTTCCAGG - Intergenic
1038505754 8:28083531-28083553 CTGTGCTTGATTCAGATTCTTGG - Intronic
1039092134 8:33843607-33843629 CTGAGCTTGTCGCTGTTTCTGGG + Intergenic
1039203430 8:35122693-35122715 CTGCACTTGTTAGTGTTTCTTGG - Intergenic
1039772137 8:40698151-40698173 CTGTGCTGGCTGGATTTTCTGGG + Intronic
1041146127 8:54877781-54877803 GTATGCTTGTTTGAATTTCTAGG + Intergenic
1041572636 8:59354455-59354477 CTGTTTTTGGTGGAGTTTATTGG + Intergenic
1041681149 8:60593387-60593409 CTGTGCCTGTTGACCTTTCTAGG - Intronic
1044818766 8:96141206-96141228 CGGTGATTGTTTGAGTTTCCAGG - Intergenic
1045196755 8:99940351-99940373 CTGTGCTTGATGGTGTCCCTTGG + Intergenic
1046306508 8:112373823-112373845 CTGTATTCGCTGGAGTTTCTGGG + Intronic
1046542145 8:115599493-115599515 CTGGGCTTGTTGGAGAGTCGGGG - Intronic
1046850677 8:118969160-118969182 CAGAGGTTGTTGGCGTTTCTTGG - Intergenic
1046969458 8:120205233-120205255 CTGTATCTGTTGGTGTTTCTAGG + Intronic
1047821795 8:128529339-128529361 CTGCTCTTGTTAGAGTTTCAAGG - Intergenic
1048161923 8:132029224-132029246 CTGTGCTTGAGGGGGTTCCTAGG - Intronic
1050769834 9:9184187-9184209 CAGAGCTTGTTGGAGCATCTAGG - Intronic
1051137268 9:13936409-13936431 CTGTGCTTTCTGGAGAGTCTTGG - Intergenic
1051449772 9:17182294-17182316 CTGTACTTAGTGGTGTTTCTAGG + Intronic
1051950690 9:22628468-22628490 CTGTGATTCATTGAGTTTCTTGG + Intergenic
1051997494 9:23235295-23235317 CTCTGAGTGTTGGAGTTTCTGGG + Intergenic
1053667586 9:40327028-40327050 GTGTGTGTGTTGGAGTTACTGGG + Intronic
1053917169 9:42952137-42952159 GTGTGTGTGTTGGAGTTACTGGG + Intergenic
1054347422 9:63980706-63980728 CTCTGCTTTTTAGAGTTTCCAGG - Intergenic
1054378729 9:64467067-64467089 GTGTGTGTGTTGGAGTTACTGGG + Intergenic
1054445148 9:65307049-65307071 CTCTGCTTTTTAGAGTTTCCAGG - Intergenic
1054485125 9:65714457-65714479 CTCTGCTTTTTAGAGTTTCCAGG + Intronic
1054517025 9:66049255-66049277 GTGTGTGTGTTGGAGTTACTGGG - Intergenic
1057015473 9:91647282-91647304 CTGTGCCTATTGGTGATTCTGGG - Intronic
1060148233 9:121269523-121269545 GGGTGCTGGTTGGTGTTTCTTGG + Intronic
1061398597 9:130356357-130356379 CTTTGCTGGATGGCGTTTCTGGG + Intronic
1061808159 9:133147963-133147985 CTGTCCTTGTTGGAGCCTCAGGG - Intronic
1062287343 9:135779028-135779050 CTGTGGTTGTGGGGGTTTCAGGG - Intronic
1062719894 9:138034590-138034612 CTGTGCCTATTGGCATTTCTGGG + Intronic
1203425658 Un_GL000195v1:34262-34284 CTGTGCCTGTTGAAGCCTCTGGG + Intergenic
1203374109 Un_KI270442v1:348901-348923 CTCTGCTTTTTAGAGTTTCCAGG + Intergenic
1186451940 X:9681294-9681316 CTGTGCTTGTGGGTGGGTCTTGG + Intronic
1186727821 X:12375799-12375821 CTGTTCCTGTTGGAATTTCAAGG + Intronic
1187249857 X:17587274-17587296 CTGTGCTTGGTGGTGTTACGTGG - Intronic
1187434101 X:19251248-19251270 CTTTCCTTGTTGGATATTCTGGG + Intergenic
1187469101 X:19552591-19552613 CTGAGCTTGTTTTAGTTTCCTGG - Intronic
1188249665 X:27876935-27876957 CTGTGCCTATTGGTGGTTCTGGG + Intergenic
1188314827 X:28660131-28660153 GTGTGTGTGTTGGAGTTACTGGG + Intronic
1188953721 X:36408553-36408575 CTGTGCTTGTCGGCATTTCTGGG - Intergenic
1189672942 X:43431126-43431148 CTATGCCAGTTGGTGTTTCTGGG + Intergenic
1192140094 X:68639521-68639543 CTTGCCTTGTAGGAGTTTCTTGG - Intergenic
1192308724 X:69990761-69990783 CTGTTCTTGTTGGCATTTCTAGG + Intronic
1192782672 X:74309824-74309846 CTGTGCCTATTGAAGTTTCTGGG - Intergenic
1193783611 X:85733596-85733618 CTCTGCTTTTTAGAGTTTCCAGG + Intergenic
1195373908 X:104206829-104206851 CAGTGCCTTTTGGAGCTTCTTGG - Intergenic
1196792676 X:119478445-119478467 TGGTTCTTTTTGGAGTTTCTAGG + Intergenic
1196972462 X:121124474-121124496 CTGTGTTTGTTGATGTTTCCAGG + Intergenic
1198232581 X:134706055-134706077 CTGTGCTTGTTGGTATTACTGGG - Intronic
1198529188 X:137533144-137533166 ATTTGCTTCTTGGAGTGTCTGGG - Intergenic
1200280663 X:154774438-154774460 CTGTGTGTGTTGGAGTTAGTGGG + Intronic
1201919465 Y:19219022-19219044 CTCTGCTTTTTAGAGTTTCCAGG + Intergenic
1202334669 Y:23795000-23795022 TTTTTCTTGCTGGAGTTTCTGGG - Intergenic
1202536098 Y:25875059-25875081 TTTTTCTTGCTGGAGTTTCTGGG + Intergenic