ID: 1107963741

View in Genome Browser
Species Human (GRCh38)
Location 13:45580835-45580857
Sequence CACCCCACCCTCTTTGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107963741 Original CRISPR CACCCCACCCTCTTTGGCTT TGG Intronic
900674821 1:3878613-3878635 CACCCCACCCTTTTGTGGTTTGG + Intronic
900889094 1:5436394-5436416 CAGTCCTCCCACTTTGGCTTTGG - Intergenic
901401924 1:9020559-9020581 CACCCCCCCGCCTTTGGCTTGGG + Intronic
902219186 1:14954068-14954090 CACCACACCCCCTTTCCCTTGGG + Intronic
903941953 1:26938098-26938120 CTCCCCACCCTGGTTGGCTGTGG + Intronic
904036987 1:27564262-27564284 CAGCTCAGCCTCTTTGGCTTCGG + Intronic
904062905 1:27725510-27725532 CTCCCCACCTTCTTTGGGCTTGG + Intergenic
905381890 1:37567998-37568020 CACACCCCCCTCTTTGTCTGTGG + Intronic
905737558 1:40340347-40340369 CATACCATCCTCTTTTGCTTGGG + Intergenic
905811726 1:40917991-40918013 CAGCCCACCCTCTTTCCCTGGGG + Intergenic
906562928 1:46772618-46772640 TAACCTAACCTCTTTGGCTTTGG + Intronic
906667267 1:47630748-47630770 CACCCCACGCTGCATGGCTTTGG + Intergenic
907393154 1:54171816-54171838 CACCCCACACTCTTCTTCTTGGG + Intronic
907397401 1:54200641-54200663 ACCCCGACCCTCTGTGGCTTTGG + Intronic
908011041 1:59777632-59777654 CTCCCCTCCCTCTCTGTCTTGGG - Intergenic
908775514 1:67635770-67635792 CACGCCACGCTGTTTGGCCTAGG + Intergenic
909763501 1:79324435-79324457 CTGACCACCCTCTTTGCCTTAGG + Intergenic
913681198 1:121187773-121187795 CCCCCCACCCTGTCCGGCTTGGG - Intronic
915059677 1:153170994-153171016 CATTCCACCCTCTTTGGCCTTGG + Intergenic
915579664 1:156805844-156805866 CTTCCCAGCCTCTTGGGCTTAGG - Intergenic
917494770 1:175530339-175530361 CACCCGCCTCTCTTTGGCTCTGG + Intronic
918292473 1:183122203-183122225 CACACCACCTCCTTTGTCTTGGG - Exonic
919796135 1:201322608-201322630 CAGACCACCCTCTTTGGCCCAGG + Intronic
919937423 1:202263915-202263937 AACCCCAAACTCTTTGGCTTGGG - Intronic
920468513 1:206206298-206206320 CCCCCCACCCTGTCCGGCTTGGG - Intronic
920739700 1:208568988-208569010 CACCCGACCCTCTTTACCTAAGG - Intergenic
922043037 1:221915772-221915794 CTCCCCACCCACTTTACCTTGGG + Intergenic
922707476 1:227796900-227796922 CACCTCACCCTCCTGGGGTTGGG + Intergenic
1064316887 10:14265886-14265908 CATCACACCCTCTTTGTGTTGGG + Intronic
1069799468 10:71073111-71073133 CTCCCCTCCCTCTCTGCCTTGGG + Intergenic
1073612412 10:104957666-104957688 CTTCCCACCCTCTCTGGCTGAGG + Intronic
1075616939 10:123897067-123897089 CCCCCCACCCACTTTGGCCCAGG + Intronic
1076437986 10:130459573-130459595 CACCCCTCCCTCTTCACCTTGGG - Intergenic
1076438047 10:130459832-130459854 CACCCCTCCCTCTTCACCTTGGG - Intergenic
1077267150 11:1656659-1656681 CTCCCATCTCTCTTTGGCTTTGG - Intergenic
1077299189 11:1839347-1839369 TAACCCTCTCTCTTTGGCTTTGG - Intronic
1077843134 11:5996441-5996463 TAGCCCAGCCTCTTTGTCTTAGG + Intergenic
1077869530 11:6250355-6250377 CACCCCACCCTTTCTTTCTTGGG + Intergenic
1077899724 11:6478707-6478729 TCCCCCACCCTCTTTGGTCTGGG + Intronic
1078164587 11:8871156-8871178 CAGCCCACCCTCTCTGTCTTGGG - Intronic
1082920079 11:58483390-58483412 AACCTCACTCACTTTGGCTTTGG - Intergenic
1083308463 11:61772647-61772669 CACTCCAGCCTCTCTGGCATGGG + Intronic
1085049614 11:73373440-73373462 CAGCCCACCTTCTTAGGGTTAGG + Intergenic
1085668544 11:78439325-78439347 CACCGCACCCACGGTGGCTTTGG + Intronic
1086949345 11:92875734-92875756 CACACCACCATCTATGACTTAGG + Intronic
1088892804 11:114058521-114058543 CACCCCAACCTCCTGGGCTTCGG + Intergenic
1089344032 11:117778712-117778734 CACCTCCCCCTCATTGGGTTAGG - Intronic
1090480946 11:127067542-127067564 CACCCCTCCCTCTGTGTCTTAGG + Intergenic
1091069191 11:132547335-132547357 TCGCCCACCCTCTTTGTCTTAGG - Intronic
1097144667 12:56931889-56931911 CACCCCTCCCTCTAGGGCTGGGG + Intronic
1098239563 12:68453041-68453063 CACCCCACCCTCTTATCTTTTGG + Intergenic
1099995256 12:89771305-89771327 AACCACACCCACTTTGCCTTTGG + Intergenic
1102478075 12:113201736-113201758 CACGCCACCATCTTGGGCTTGGG + Intronic
1103800063 12:123532414-123532436 CTCCCCACCCTGTTTGAATTGGG - Intronic
1107963741 13:45580835-45580857 CACCCCACCCTCTTTGGCTTTGG + Intronic
1108577815 13:51804283-51804305 CACTCCACCCTCTGAGGCTGGGG - Intergenic
1112061908 13:95749417-95749439 CACCCCTTCCTCTTTCCCTTTGG - Intronic
1113393526 13:109920746-109920768 CACCTTACCCTGTTTGGGTTGGG - Intergenic
1113964403 13:114144504-114144526 CAGCCCAGCCTCTGTGCCTTGGG - Intergenic
1114527418 14:23375564-23375586 CACCCCACCCTCTCTGTTTCCGG + Intronic
1114617114 14:24074218-24074240 CACCCCATCCCCTTTCCCTTAGG - Intronic
1115513940 14:34166547-34166569 TACCACACTCTCTGTGGCTTTGG - Intronic
1120864772 14:89286372-89286394 CACCCCATCCCCGTTGGTTTGGG - Intronic
1120897160 14:89543893-89543915 CCCCCCACCCCCATTGGTTTTGG - Intronic
1122460222 14:101888469-101888491 CCTCCCTCCCTCTTAGGCTTTGG + Intronic
1124889488 15:33719072-33719094 CATGCCATCCTCTTTGCCTTGGG + Intronic
1125105842 15:35969757-35969779 TTTCTCACCCTCTTTGGCTTTGG + Intergenic
1125691619 15:41600629-41600651 CACCCTCCCCTCTTGGGCTCTGG + Intergenic
1126543386 15:49845777-49845799 CATCCTACCCTCTTTAGTTTGGG - Intergenic
1126845127 15:52752589-52752611 CCCCCCCCCCTCTTTGATTTGGG - Intergenic
1128763572 15:70236411-70236433 CACCCCAACGTCTGTGGCTCAGG + Intergenic
1129069213 15:72937086-72937108 CACCCCTCCCTTCTGGGCTTGGG - Intergenic
1129460927 15:75699776-75699798 CACCCCACCCTCCTCGCCTGAGG - Intronic
1129656961 15:77530693-77530715 CATTCCACCCTCCTTGCCTTGGG - Intergenic
1129689565 15:77705576-77705598 CACCTCACCTTCTTGGTCTTGGG - Intronic
1129723892 15:77891941-77891963 CACCCCACCCTCCTCGCCTGAGG + Intergenic
1129799206 15:78400948-78400970 CTCCCTAACATCTTTGGCTTTGG - Intergenic
1132295328 15:100730269-100730291 CACCCCAGCCTCTGTGTCCTGGG + Intergenic
1132903914 16:2272459-2272481 GACCCCACCCACTGTGGCTGTGG - Intergenic
1136455759 16:30378826-30378848 CTCCCCACCCGCTTTGCCTCCGG - Intronic
1137785587 16:51134935-51134957 CCCGCCGCCCTCTCTGGCTTTGG + Intergenic
1138221066 16:55250777-55250799 CACCCCACCCCCTCTTGCTTTGG - Intergenic
1139670481 16:68489885-68489907 CACCCCTCCCTCTTTGTCTGGGG - Intergenic
1139844659 16:69911577-69911599 CCTTCCACCCTCTTTGGCTCTGG - Intronic
1143634452 17:8156398-8156420 CCCCCCACGCTTATTGGCTTAGG + Intronic
1145202148 17:20955944-20955966 GATCCCACTCTCGTTGGCTTAGG + Intergenic
1146937890 17:36823945-36823967 ACCCCCACCCTCTCTGGCTGAGG - Intergenic
1146941468 17:36846815-36846837 CACCCCACCCTCCAGAGCTTGGG + Intergenic
1150282985 17:63940248-63940270 CAGCCCACCCCCTTTGACTCTGG - Exonic
1150492727 17:65585424-65585446 GAATCCACCCTATTTGGCTTTGG + Intronic
1151679544 17:75616201-75616223 CACCCCACCCTCCCTGGCCCGGG - Intergenic
1152257232 17:79247249-79247271 CTCCCCACCCTGGCTGGCTTCGG + Intronic
1155276049 18:24188377-24188399 CACACCACCCTCTTTGTCATTGG - Intronic
1156353543 18:36322072-36322094 CTCACCACCCTCTCTGGCTGAGG + Intronic
1156353818 18:36323626-36323648 CTCCCCACCTTCTGTGGCCTTGG - Intronic
1156604388 18:38648882-38648904 CACCCTGCCCAATTTGGCTTTGG - Intergenic
1158235933 18:55314025-55314047 ATCCCCACCCCATTTGGCTTAGG + Intronic
1160905885 19:1451584-1451606 GACCCGCCCCTCTCTGGCTTTGG - Exonic
1161041116 19:2111228-2111250 CAGCCCACACTCTTTGGCATGGG - Intronic
1162810785 19:13163367-13163389 CACACTACTCTCTTTGGGTTGGG + Intergenic
1162888870 19:13717590-13717612 CTCCCCACCCTCATCCGCTTGGG + Intergenic
926723050 2:15976875-15976897 AACCACACCCTCTCTGGCATGGG - Intergenic
927709095 2:25314196-25314218 CACCCCACCCTCCCTGGGTCAGG + Intronic
928891168 2:36204886-36204908 CACTCCTCCCTCTCTGGCATGGG - Intergenic
930103063 2:47617926-47617948 CAGGCCACACTCTTTGGCCTTGG + Intergenic
933327866 2:80861947-80861969 GACCCCAACCACTTTGGGTTTGG - Intergenic
937315717 2:120930903-120930925 CACCCCACCCTCACTGGCAAGGG - Intronic
940987371 2:160062651-160062673 CGCCCCACCCACTGCGGCTTGGG + Intergenic
946089415 2:217207686-217207708 CTCCCCACCCTCTCTGCCTTCGG + Intergenic
947896126 2:233674447-233674469 CACCCCACAACCTTTGGCTGAGG + Intronic
1170072289 20:12381805-12381827 CACCCCAACATCTATTGCTTTGG - Intergenic
1172171113 20:32933630-32933652 CACCCCACCCTCTAAGCCTCTGG + Intronic
1172619363 20:36308999-36309021 ACCCCCTCCCTCTTTGGCTCGGG + Intronic
1174073617 20:47916379-47916401 GACACACCCCTCTTTGGCTTTGG - Intergenic
1175946709 20:62562323-62562345 CACCCCACGCTCTCCGGCCTTGG - Intronic
1178034999 21:28570520-28570542 CACCCCACCATTTATGGCTTAGG + Intergenic
1178759295 21:35385367-35385389 CACCCCTTCCTTCTTGGCTTTGG - Intronic
1178911017 21:36673804-36673826 CCCCACACTCTCTTTGGCTTGGG - Intergenic
1179948268 21:44695191-44695213 CACCCCAACTCCTGTGGCTTTGG + Intronic
1180983542 22:19890950-19890972 CACCCCAGTCTCTCTGGCTGTGG + Intronic
951049707 3:18080413-18080435 CAGCCCTCCCTCTTGGGCATGGG - Intronic
957260107 3:77889806-77889828 AACCACATCCTCTTTGCCTTTGG - Intergenic
957947045 3:87078282-87078304 AGCCCCACCCTCTCTGGCTCAGG - Intergenic
958262380 3:91396725-91396747 CACCTGCCCATCTTTGGCTTTGG + Intergenic
958825615 3:99026731-99026753 CACCTCCCCTTCTTTGTCTTTGG - Intergenic
960002514 3:112748134-112748156 CTCCCCAGCATCCTTGGCTTAGG - Intronic
960237674 3:115302873-115302895 CACTCCACCCTCTTTTCATTAGG - Intergenic
961779784 3:129314869-129314891 CTCCCCACCCTCCTTGCCTTTGG - Exonic
962446684 3:135472169-135472191 CAGCCCACCCTCTATAGTTTAGG - Intergenic
964129045 3:153267290-153267312 CACCTCATCCTCTTTGTCATGGG - Intergenic
966250590 3:177860641-177860663 CTCACCACCCACCTTGGCTTGGG + Intergenic
968999957 4:3972633-3972655 CAGCCCACCCTCTTGTGCTTTGG + Intergenic
969041130 4:4296966-4296988 CACCCCTCCCTCATTCCCTTAGG - Intronic
970877068 4:20884002-20884024 CACACTACCCTTTTTGCCTTTGG + Intronic
972150219 4:36079964-36079986 CCCCACAGCCTCCTTGGCTTAGG - Intronic
975211833 4:71710135-71710157 CACCCCACCCTCTTAGGTTTTGG + Intergenic
976661530 4:87545259-87545281 CACCCCACCTCCTTTCCCTTAGG - Intergenic
976873660 4:89828159-89828181 CACCACTCCCTCCTTGGTTTTGG + Exonic
980107501 4:128601569-128601591 CACCTCACCCCCCGTGGCTTGGG - Intergenic
981092681 4:140747791-140747813 CACCCTTTCCTCTTTGGGTTGGG + Intronic
983018142 4:162640315-162640337 TACCACACCCTCTGGGGCTTTGG + Intergenic
985842742 5:2320875-2320897 CACCCCACCCTCCTGGCCATGGG - Intergenic
987827840 5:23056561-23056583 CAGCCCAGCCTCTCTGCCTTGGG + Intergenic
995666218 5:114545016-114545038 CACCCCTCCCTCTAGGGCTCAGG - Intergenic
996542117 5:124641290-124641312 CACCACACCCACGTTGGCATGGG - Exonic
997236317 5:132274283-132274305 CACCCCACCCTATTTGGGTGTGG - Intronic
997855163 5:137366591-137366613 CACCCCACCCACTATGGTGTAGG + Intronic
1000569190 5:162890728-162890750 AACCCAACCCTCTTTGTCCTAGG - Intergenic
1000645650 5:163757338-163757360 CACACCTCCCTCTTTGGGTGGGG - Intergenic
1000850274 5:166331233-166331255 CACCCTGCCATCTTTGGCTGTGG + Intergenic
1001857013 5:175021828-175021850 CACCCCAACCCCTTGGCCTTTGG + Intergenic
1002160254 5:177310701-177310723 CACCTCATCCTCTCTGGCATTGG - Intronic
1002432276 5:179210571-179210593 CTCCTCACCCACTTTGCCTTTGG - Intronic
1002956825 6:1873803-1873825 CACCCTACCCTGTTTGGATGGGG + Intronic
1004698130 6:18053068-18053090 AACCACACCCTCCTTGGCATAGG + Intergenic
1005570386 6:27139591-27139613 GGCCGCACCCTCTATGGCTTCGG + Exonic
1008040379 6:46791299-46791321 CACCTCACCATCAGTGGCTTAGG + Intergenic
1008098578 6:47366830-47366852 CACACCATCCTCTTTGGTGTTGG - Intergenic
1008993037 6:57626152-57626174 CACCTGCCCATCTTTGGCTTTGG - Intronic
1009181651 6:60525258-60525280 CACCTGCCCATCTTTGGCTTTGG - Intergenic
1010273090 6:73937203-73937225 CACCAACCCCTCTTTGGCTGGGG + Intergenic
1012508546 6:99976541-99976563 CAAACCACCATCTATGGCTTTGG + Intronic
1013389110 6:109665496-109665518 CACACCACCCTCATTTGGTTTGG + Intronic
1018360601 6:163063419-163063441 AACCCCACCCTCACTGGCTCAGG + Intronic
1018740182 6:166722514-166722536 CACCCCAGCCTCTGTGGCTGTGG - Intronic
1019210110 6:170397966-170397988 CTGCTTACCCTCTTTGGCTTGGG + Intronic
1021717125 7:23470443-23470465 CTTCCCAACCCCTTTGGCTTCGG + Exonic
1022186446 7:27974177-27974199 CACCCCACTATCTGTGGGTTTGG - Intronic
1022802319 7:33788255-33788277 AGACCCACCCTCTTTGCCTTCGG + Intergenic
1024076875 7:45825544-45825566 CACCCCACACTCTCTGTTTTTGG + Intergenic
1025127544 7:56355879-56355901 CACCCCACACTCTCTGTTTTTGG - Intergenic
1026091272 7:67302721-67302743 CGCGCCACCCTCTCTTGCTTTGG + Intergenic
1026745137 7:73005715-73005737 CGCGCCACCCTCTCTTGCTTTGG - Intergenic
1027031251 7:74890410-74890432 CGCGCCACCCTCTCTTGCTTTGG - Intergenic
1027098601 7:75359365-75359387 CGCGCCACCCTCTCTTGCTTTGG + Intergenic
1030869314 7:114735435-114735457 AACCCCACCCTCTGTGTTTTGGG - Intergenic
1031225255 7:119028915-119028937 CATCCCACTTTATTTGGCTTGGG + Intergenic
1038084183 8:24175227-24175249 CACCCCACCCCCATTGTCTCTGG + Intergenic
1041315515 8:56558031-56558053 CACCCCACCCTCACTGCCCTAGG - Intergenic
1041660048 8:60392531-60392553 CTCCCCTCCCTCTCTTGCTTTGG + Intergenic
1045382576 8:101642059-101642081 CAGCCCACCCTCTGTAGCTGTGG - Intronic
1048196331 8:132334850-132334872 GACCCCATCCTTTCTGGCTTGGG + Intronic
1050642261 9:7680827-7680849 CACCCCAGGTTCTTTGGCTTTGG - Intergenic
1052826672 9:33181340-33181362 CACCTCAACCTCCTGGGCTTAGG - Intergenic
1053451018 9:38194016-38194038 CCACCCACACTCCTTGGCTTGGG - Intergenic
1053459076 9:38254538-38254560 CAGCCCAGCATCTTTGGCTTCGG - Intergenic
1054777929 9:69139493-69139515 CAGGCCACTCTCTCTGGCTTGGG - Intronic
1055704164 9:78979461-78979483 AACTCCAGGCTCTTTGGCTTTGG + Intergenic
1056116434 9:83445870-83445892 CACCACAGACTCTTAGGCTTTGG - Intronic
1056634264 9:88318761-88318783 CACCCAACACTCTTTGAATTAGG + Intergenic
1056738793 9:89234812-89234834 AACCGCACGCTCTTTGGGTTCGG - Intergenic
1057149291 9:92782058-92782080 AACCCCACCCACCTTGCCTTTGG - Intergenic
1057476345 9:95406048-95406070 CTCCCCAACCTGTTTGACTTTGG - Intergenic
1058674182 9:107386645-107386667 CACCCCACCCTCTTGGGACCAGG + Intergenic
1059176352 9:112173265-112173287 ACCCCCATTCTCTTTGGCTTGGG - Intronic
1059971128 9:119669304-119669326 CACCCTATCCTCTTTGTGTTTGG - Intergenic
1060121420 9:120993946-120993968 CACACCATCCTCATTGGTTTAGG - Intronic
1060438216 9:123614614-123614636 CTCCCCTCCCACTTTGTCTTGGG - Intronic
1060908049 9:127325777-127325799 CACCCCATCCTCTCTTGCCTGGG + Intronic
1061545262 9:131300798-131300820 CACCCAGCCCTCCTTGCCTTTGG + Intronic
1062315269 9:135964130-135964152 GTCCCCTCCCTCTTTGACTTTGG - Intergenic
1186467847 X:9797796-9797818 CACCCCACCCACTGTGCCTCCGG - Intronic
1186606920 X:11101911-11101933 CACCCCTCTCCCCTTGGCTTTGG + Intergenic
1186689973 X:11964917-11964939 CAACCCACATTCCTTGGCTTGGG + Intergenic
1189232124 X:39460706-39460728 CTGCCCACCCTCTGTGGCTTCGG + Intergenic
1189619292 X:42818558-42818580 CAACCCCCCCTCTGGGGCTTTGG - Intergenic
1191831207 X:65418539-65418561 AACCACACCCACTTTGCCTTTGG - Intronic
1191865268 X:65698645-65698667 CGCCCCACCCTCTTTTGCACAGG - Intronic
1193639510 X:83994854-83994876 CCCCCCACCTTTTTTGTCTTTGG + Intergenic
1198224780 X:134635224-134635246 CACCACACTCCCTTTTGCTTGGG - Intronic
1200762972 Y:7056744-7056766 CACCCCACGCTCCTGGGCTCTGG + Intronic