ID: 1107964579

View in Genome Browser
Species Human (GRCh38)
Location 13:45587573-45587595
Sequence CTCTGCCCAAAACAACTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107964579_1107964581 29 Left 1107964579 13:45587573-45587595 CCTCACAGTTGTTTTGGGCAGAG 0: 1
1: 0
2: 3
3: 18
4: 148
Right 1107964581 13:45587625-45587647 CAGTTTAAAATCAAGCAGTGAGG 0: 1
1: 0
2: 5
3: 33
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107964579 Original CRISPR CTCTGCCCAAAACAACTGTG AGG (reversed) Intronic
900509617 1:3052397-3052419 CCCCGCCCAACACAACTCTGAGG - Intergenic
901230141 1:7637221-7637243 CTGTGCCCAGCACGACTGTGGGG + Intronic
901872050 1:12143881-12143903 CTTTCCCCAAAACATCTGAGCGG - Exonic
905724647 1:40240532-40240554 TTCTACCCTAAACAACGGTGTGG - Exonic
906151253 1:43588927-43588949 CTCTGCCAACTACACCTGTGTGG + Exonic
910534999 1:88287633-88287655 CTGTGACCAAATCAGCTGTGTGG + Intergenic
913241607 1:116834965-116834987 CTCTGCCCAAACAAATTGAGTGG + Intergenic
913519839 1:119634320-119634342 CTTTGCCCAAAATAACTGTTTGG + Intronic
913692617 1:121293712-121293734 CTCTGCCCAGAACATCTCAGTGG + Intronic
914144939 1:144986378-144986400 CTCTGCCCAGAACATCTCAGTGG - Intronic
920262493 1:204698724-204698746 TTCTGCCCTAAATCACTGTGGGG - Intergenic
920333730 1:205229991-205230013 CTCTGGAGAAAATAACTGTGAGG - Intronic
920479937 1:206312073-206312095 CTCTGCCCAGAACATCTCAGCGG + Intronic
922185449 1:223270364-223270386 CTCTGCCCAAGCAAGCTGTGAGG + Intronic
924593179 1:245422640-245422662 CTCTGCCCCAAACCCCTATGAGG - Intronic
1063957026 10:11276697-11276719 CTCTGCATAATCCAACTGTGGGG - Intronic
1065833565 10:29637107-29637129 ATCTGCCAAAAATCACTGTGAGG - Intronic
1065937658 10:30535077-30535099 CTCTTCCCAAAACAAGTTTTTGG - Intergenic
1068112868 10:52701769-52701791 CCATACCCAGAACAACTGTGTGG + Intergenic
1069891336 10:71654336-71654358 CTCTGCCCAAATAAACTCAGTGG + Intronic
1069993689 10:72329824-72329846 CTCTGCCCAAGGCCACTGGGTGG + Intergenic
1070092832 10:73305270-73305292 CTTTGCCCCAAACAGCTTTGGGG - Intronic
1070830887 10:79417492-79417514 CTCTGCCCACAACAACGGATGGG - Intronic
1076393674 10:130122351-130122373 CCCTCACCAAAACAAATGTGTGG - Intergenic
1076789435 10:132768875-132768897 CTCTGCCCAAAACCAGGGCGGGG - Intronic
1077113745 11:873430-873452 CTGCGCCCAAAAGACCTGTGTGG - Intronic
1082263401 11:50095447-50095469 CTCTGCTCAGAACCACTCTGCGG + Intergenic
1083130372 11:60619374-60619396 TGCTTCCCAAAACAACTCTGTGG + Intergenic
1083464291 11:62834886-62834908 CTCTGCTCAAAACACATATGAGG - Intronic
1085051575 11:73382808-73382830 CTCTGCCCGAGATAACTGTCTGG + Intronic
1086594400 11:88553862-88553884 CCCTACCCAAAACTCCTGTGAGG - Intronic
1088875469 11:113932634-113932656 CTGTTTCCAAAACAACTATGGGG - Intronic
1089750708 11:120649197-120649219 CTCTGCCCCACACACCTGGGAGG + Intronic
1092985173 12:13838257-13838279 CTCGGCCCAAAGCACCTGCGTGG + Intronic
1094783769 12:33822028-33822050 CAATGCCCGAAAGAACTGTGGGG - Intergenic
1095924665 12:47566689-47566711 CTGTGCCCACAGAAACTGTGAGG - Intergenic
1096035624 12:48467335-48467357 TTCTGGCCAACAGAACTGTGAGG + Intergenic
1098070487 12:66669067-66669089 CCAAGCCCAAAACAAATGTGTGG + Intronic
1099875022 12:88393266-88393288 CTCAGCCCCAAACAACTCTGTGG - Intergenic
1101085689 12:101233598-101233620 CTCTGCTCAAAGGCACTGTGGGG + Intergenic
1102676582 12:114663678-114663700 ATCTACCCAAAACATGTGTGTGG - Intergenic
1106841293 13:33687605-33687627 CTCTTCTCAACACAACAGTGTGG - Intergenic
1107964579 13:45587573-45587595 CTCTGCCCAAAACAACTGTGAGG - Intronic
1110160778 13:72375840-72375862 CTCTTCCCCAGACAACTGTGTGG - Intergenic
1110772254 13:79363089-79363111 CTCTGCAAAAAATAACTGTCAGG + Intronic
1111215786 13:85139691-85139713 CTCTGCCCATGAAAACTCTGAGG + Intergenic
1111678998 13:91421276-91421298 CACATCCCAAAATAACTGTGAGG - Intronic
1113047064 13:106167786-106167808 CTCTTCCCAGAACACCTGTGTGG + Intergenic
1114721212 14:24884075-24884097 CTCTGCCAAAAAAAAAGGTGGGG + Intronic
1116750963 14:48882972-48882994 CTCTGCACATAACAAGGGTGAGG - Intergenic
1119338400 14:73853663-73853685 CTCACCCCAAAAAAACTGTGAGG - Intronic
1121810347 14:96882108-96882130 CTCTGACCAAGAAAACTCTGAGG - Intronic
1122585777 14:102805550-102805572 CGCTGCCCAAGACTACTGTTGGG + Intronic
1125604609 15:40932836-40932858 CTCTCCCCTAAACAGCTGTCCGG + Intronic
1126052162 15:44695864-44695886 CTTCCCCTAAAACAACTGTGAGG - Intronic
1129108800 15:73325607-73325629 CTGTGCTCAAAACAACTGCCCGG + Intronic
1130817948 15:87460266-87460288 TTCTGGCCACAAGAACTGTGAGG + Intergenic
1132749657 16:1451702-1451724 ATCTGCACAAAAGAGCTGTGGGG + Exonic
1132883329 16:2171829-2171851 CTCGGCCCACACCCACTGTGGGG - Intronic
1135113629 16:19708832-19708854 CTCTCCCCAAAACCCATGTGGGG - Intronic
1136347236 16:29683976-29683998 CTCTGCACTTAGCAACTGTGAGG - Intronic
1137042794 16:35628793-35628815 CTGTGCCTAAAACAACTGTGGGG + Intergenic
1137274903 16:46926994-46927016 CTCTGCCCAAAGCCACTGCCGGG - Exonic
1139349743 16:66327610-66327632 CTCTGCCCAGAAAAGCTTTGAGG + Intergenic
1139721495 16:68859609-68859631 CTCTGCCCTAAAAACATGTGGGG + Intronic
1139876284 16:70148610-70148632 CCCTTCCCACAACCACTGTGGGG + Intronic
1146069702 17:29668824-29668846 CTCTGCCTCAAACACTTGTGAGG - Intronic
1147877511 17:43632178-43632200 CTCTGCCCAAAGCAGGGGTGGGG + Intergenic
1151927917 17:77212386-77212408 TTCTGTCCAAAACCACTGCGAGG - Intronic
1152805184 17:82352353-82352375 CTCTGCCCATGACAACTGGGAGG - Intergenic
1154054302 18:10996900-10996922 CTCTGACCAAAGGAGCTGTGGGG + Intronic
1154235993 18:12606289-12606311 CAGTGCCTAAAACAACTGTCTGG + Intronic
1156275149 18:35577111-35577133 CTCTGCCCATGAGAACTGTGAGG + Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1159366205 18:67468812-67468834 GATTGCCTAAAACAACTGTGAGG + Intergenic
1160586805 18:79917682-79917704 CACTGCCCAACCCAACAGTGAGG + Intronic
1161195213 19:2982835-2982857 CTCTGTCCAAAGCAACTGACCGG - Intronic
1162700365 19:12510552-12510574 CTCTGACTAAATCAACTCTGCGG + Intronic
1162704627 19:12546233-12546255 CTCTGACTAAACCAACTCTGTGG + Intronic
1162812693 19:13173872-13173894 CTCTGTCAAAAAAAAGTGTGAGG - Intergenic
1162938210 19:13992535-13992557 TCCTGCCCAAAACAACAGGGCGG + Intronic
925518311 2:4709757-4709779 CTCTCCCCAAAAAATATGTGAGG + Intergenic
927310978 2:21630798-21630820 ATCTGCCCAAAATGACTCTGGGG - Intergenic
928201970 2:29253257-29253279 CTGTGCCCAAAATATATGTGTGG + Intronic
931401017 2:61931492-61931514 CTCTGCCCATGAGAACTTTGAGG - Intronic
932001811 2:67892163-67892185 CAATGGCCAAAACAAGTGTGAGG + Intergenic
933297901 2:80511334-80511356 CTTTATCCAAAACAACTGTGAGG + Intronic
934591890 2:95561042-95561064 CTTTGCACAAAACAAGTCTGTGG + Intergenic
935048692 2:99505087-99505109 CTCTGTCAATAACAACTCTGGGG - Intergenic
935673785 2:105576928-105576950 CTCTGCCCCACACAGCTCTGTGG - Intergenic
938695241 2:133829125-133829147 CTCTACACAAAGTAACTGTGTGG - Intergenic
938991293 2:136632627-136632649 CTCTTCCCAAAACAAATGATAGG - Intergenic
939075203 2:137593010-137593032 CACAGCCCAAAAGAACTGTGTGG - Intronic
940854721 2:158720991-158721013 CTCTTCCCAAATGAAATGTGTGG - Intergenic
940882886 2:158964568-158964590 ATCTTCCCAACACATCTGTGAGG + Intergenic
942264385 2:174206492-174206514 CTCTGCCCAAAATAGCTGACTGG - Intronic
942456652 2:176142688-176142710 CTCTGCCCCCAACATGTGTGGGG + Intergenic
946075609 2:217071198-217071220 CTCGGCCCAGAACTTCTGTGTGG + Intergenic
1169786823 20:9368466-9368488 CCCTGCCCACAACTACTGTCTGG - Intronic
1169942042 20:10947712-10947734 CTCTGAGCAAAACAAATGAGGGG + Intergenic
1170537056 20:17350735-17350757 ATCTTCCCAACAAAACTGTGGGG - Intronic
1174025850 20:47573683-47573705 CTCTCCCCAAGACACCTGTGGGG - Intronic
1174403359 20:50288277-50288299 CTCTGTCCCAGACATCTGTGTGG - Intergenic
1175521659 20:59605642-59605664 CTCTGCCCAGCACACCTGTCCGG - Intronic
1175744030 20:61441356-61441378 CTCTGCCCCAACTAGCTGTGAGG - Intronic
1180841594 22:18961512-18961534 CCCTGCCCAAGACACCAGTGGGG + Intergenic
1181059894 22:20277281-20277303 CCCTGCCCAAGACACCAGTGGGG - Intronic
1181485768 22:23230872-23230894 ATGTGTCCAAAACAACTGCGTGG - Intronic
1181767151 22:25100145-25100167 CTCTGCCCCACACCACTGTGGGG - Intronic
1182045703 22:27272431-27272453 CACTGCCCCAACCAGCTGTGTGG + Intergenic
949733070 3:7136648-7136670 CTCTGGCCACACCAACTTTGTGG + Intronic
950893007 3:16421681-16421703 CTCTGCCCATAAGAGCTTTGTGG - Intronic
952389936 3:32871343-32871365 CTCTTCTCAAGACAGCTGTGTGG - Intronic
953801883 3:46030997-46031019 CCTTGCCCAGAACCACTGTGGGG + Intergenic
955458531 3:59152566-59152588 ATCTGCCCTCAAGAACTGTGAGG - Intergenic
956394222 3:68807712-68807734 CTCTGAACAAAACAACTCTCTGG - Intronic
961816151 3:129551460-129551482 CTCTACCCACACCAATTGTGAGG - Intronic
962129195 3:132654590-132654612 CTCTGCCCATGAGAACTCTGAGG + Intronic
962319330 3:134377624-134377646 CTCTTACCTAAACCACTGTGGGG - Intergenic
962678792 3:137777363-137777385 TTGAGCCCAAAACAACTGAGAGG - Intergenic
964801771 3:160565488-160565510 CTCCGGCAAAGACAACTGTGGGG + Exonic
965792014 3:172399694-172399716 CTCTCCCCAAAACACCTGCATGG - Exonic
966059163 3:175734162-175734184 CTCTGCAAAAAAGAAATGTGGGG - Intronic
968629279 4:1641839-1641861 CTCTGCCCACACCAGCTGGGCGG - Intronic
972068037 4:34977017-34977039 TGCTGCCCAAAACAACTTTTGGG + Intergenic
980745854 4:137014411-137014433 CTCTGCCAGAAACAACCCTGAGG + Intergenic
980768625 4:137341791-137341813 CTCTGCCCCCATCAAATGTGTGG - Intergenic
983947472 4:173602651-173602673 GTCTCCCCAAAACCACTGGGTGG + Intergenic
985237558 4:187892686-187892708 CTTTGCCCAAAATGACTGTGTGG + Intergenic
987998420 5:25316079-25316101 CTCTGCCCATAAGAACTCTGAGG + Intergenic
989250601 5:39310096-39310118 CTCTGCCCAAAACAAGACTGAGG + Intronic
992156242 5:73957777-73957799 CTTTCCCCCAATCAACTGTGTGG + Intergenic
1000929528 5:167234590-167234612 CTCTGCCCATCACAACTGTGGGG + Intergenic
1004450781 6:15743736-15743758 CTCCTCCCCAAACAACTCTGTGG + Intergenic
1005088202 6:22028424-22028446 CTTTCCCCCAAACCACTGTGGGG + Intergenic
1006669442 6:35720487-35720509 CTCTGCCCAAAGAGAATGTGAGG + Exonic
1010029270 6:71256239-71256261 CTCTGCCTACAAGAACTCTGAGG - Intergenic
1015245429 6:131068946-131068968 CTGAGCCCAGAAGAACTGTGGGG - Intergenic
1015742735 6:136474552-136474574 CTCAGCGCCAAACAAGTGTGAGG + Intronic
1016240942 6:141929739-141929761 TTCTGCTCAAAACAACTCAGAGG + Intergenic
1018812485 6:167307958-167307980 CCCTGGCCAAGGCAACTGTGGGG + Intronic
1021688530 7:23210853-23210875 CTCTGCCCAGCCCACCTGTGGGG + Intergenic
1021824020 7:24529898-24529920 CTCTCCCTACAACAACTGTGGGG - Intergenic
1024220493 7:47282854-47282876 ATCTGCCCAAACCACCTGGGAGG - Intronic
1028068755 7:86422457-86422479 ATCTTTGCAAAACAACTGTGTGG - Intergenic
1028834526 7:95359542-95359564 CTGTGCCCAGCACAACTGCGGGG + Intergenic
1029033447 7:97492912-97492934 CGATTCCCATAACAACTGTGTGG + Intergenic
1035981525 8:4377731-4377753 CTCTGCCCATAACAACTATTAGG + Intronic
1037970987 8:23171725-23171747 CTCTGCCCCCAAGAACTCTGAGG - Intergenic
1041016819 8:53599517-53599539 CTCTGACCAACAAAATTGTGAGG - Intergenic
1043513576 8:80975550-80975572 CGCTGCCCACACCAACAGTGTGG - Exonic
1044200239 8:89426816-89426838 CTGTGCCCTAAAGCACTGTGGGG - Intergenic
1044942508 8:97357521-97357543 CTGTGCCTTAAAGAACTGTGTGG + Intergenic
1045017740 8:98013406-98013428 ATCTGCACAAAACCCCTGTGAGG + Intronic
1048268695 8:133010784-133010806 CTCTGCCCAAGCCATCTCTGTGG + Intronic
1048850667 8:138642390-138642412 CTCTGCCCAACGCAACTGCCTGG + Intronic
1051968967 9:22863714-22863736 CTATGCCCAGTAAAACTGTGGGG - Intergenic
1053488924 9:38485404-38485426 TTCTGCCCCAAACAAGTTTGGGG + Intergenic
1055649879 9:78396750-78396772 CTCTACCCATAAGTACTGTGTGG + Intergenic
1056517976 9:87372895-87372917 CTCTGCCTTGAACAACTGCGAGG + Intergenic
1056812081 9:89772667-89772689 CTGTGCCCAAAACAAGTGTGGGG + Intergenic
1057669274 9:97074690-97074712 TTCTGCCCCAAACAAGTTTGGGG + Intergenic
1061620157 9:131806715-131806737 CTCTGGCCAGGACCACTGTGGGG + Intergenic
1061807762 9:133145937-133145959 CTCTGGCCTTTACAACTGTGAGG + Intronic
1061994132 9:134175451-134175473 CTCTGCCCAAACCACCTCTCAGG - Intergenic
1191986652 X:66988233-66988255 CCCTGCACAAAACACCTGTCTGG + Intergenic
1195654012 X:107317091-107317113 CACTGCCATAAAAAACTGTGTGG + Intergenic
1196117767 X:112015706-112015728 CTCTACCCAACACAGCTGTGTGG - Intronic
1199306944 X:146278691-146278713 CGCTGCCCACAATAACTCTGGGG + Intergenic
1200911450 Y:8534806-8534828 CTCTACCTAAAACCACAGTGGGG - Intergenic