ID: 1107965326

View in Genome Browser
Species Human (GRCh38)
Location 13:45592694-45592716
Sequence GTACTAAAAAAACTAAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 940
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 890}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107965319_1107965326 12 Left 1107965319 13:45592659-45592681 CCACAGGGCAGAATTTATCATTA 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1107965326 13:45592694-45592716 GTACTAAAAAAACTAAAAGGGGG 0: 1
1: 0
2: 2
3: 47
4: 890

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107965326 Original CRISPR GTACTAAAAAAACTAAAAGG GGG Intronic
900286589 1:1903969-1903991 CTACTAAAAATACAAAAATGGGG + Intergenic
901336865 1:8456904-8456926 GTCCTGAAAAAATTAAAAGCAGG - Intronic
901378961 1:8860175-8860197 GTACTAAAAATACAAAAATGAGG - Intergenic
901483448 1:9541313-9541335 CTACTAAAAATACAAAAAGCTGG - Intronic
901611405 1:10501465-10501487 CTACTAAAAATACAAAAAGCCGG - Intronic
902188758 1:14745508-14745530 GTCATAATAAAACTGAAAGGAGG + Intronic
902751333 1:18513522-18513544 CTACTAAAAATACAAAAAGCTGG + Intergenic
902904667 1:19547162-19547184 GTCTTACAAAAACAAAAAGGGGG + Intergenic
903506692 1:23840985-23841007 CTACTAAAAATACAAAAAGTTGG + Intergenic
903625314 1:24726133-24726155 GTACTAAAAATACAAAAAATTGG + Intergenic
903941328 1:26933712-26933734 TTCCTAAAAAAACTAAAAACTGG - Intronic
903985812 1:27227523-27227545 GTCCTAAATGAAATAAAAGGAGG + Intergenic
904180045 1:28659830-28659852 CTACTAAAAATACAAAAAGGTGG + Intergenic
904221091 1:28969597-28969619 GTACTAAAAATACAAAAAATTGG + Intronic
904394824 1:30212931-30212953 CTACTAAAAATACTAAAATTAGG + Intergenic
904721623 1:32514258-32514280 CTACTAAAAATACAAAAAGCCGG + Intronic
905826983 1:41033281-41033303 CTATTAAAAAAAAAAAAAGGAGG + Intronic
905840010 1:41168425-41168447 GAACTAAAAAAATTCAATGGAGG - Intronic
907290773 1:53411325-53411347 GTAATCAATAATCTAAAAGGAGG + Intergenic
907463788 1:54621971-54621993 GTAGTAAAAAAAGTTAAAGGGGG + Intronic
908366449 1:63428213-63428235 ATAATAATAAAATTAAAAGGAGG - Intronic
908766911 1:67562515-67562537 CTACTAAAAATACAAAAAGGTGG + Intergenic
909247739 1:73309869-73309891 GTACTAAAATAGCTACAATGAGG + Intergenic
909314127 1:74194619-74194641 AGCCTGAAAAAACTAAAAGGTGG + Intronic
909626787 1:77726112-77726134 CTACTAAAAATACAAAAATGAGG - Intronic
910221675 1:84894440-84894462 CTACTAAAAATACAAAAAGCCGG + Intergenic
910341137 1:86189345-86189367 ATAGTCAAAAAACTAAAGGGTGG - Intergenic
910366811 1:86474549-86474571 GTATCAAAAAAAAAAAAAGGGGG + Intronic
910401464 1:86842105-86842127 CTACTAAAAATACAAAAAGTTGG + Intergenic
910729217 1:90373231-90373253 GGACTCATAAAACTAAAAGTTGG - Intergenic
911035954 1:93548077-93548099 TTACTAACAAACCTAAAGGGTGG - Intronic
911334527 1:96565165-96565187 ATAATAAAAAAAATAAAAGTGGG - Intergenic
911740586 1:101383030-101383052 GTATTCAAGAAACTAGAAGGTGG - Intergenic
911757322 1:101573999-101574021 TTCCTAAAAAAACAAAAAGAAGG + Intergenic
912006688 1:104911769-104911791 GTACTATGAAAATTGAAAGGGGG - Intergenic
912531987 1:110331327-110331349 CTACATAAAAAACTAAAAGGGGG + Intergenic
912990097 1:114477953-114477975 GTACAAAAAAAATTAACAGCTGG + Intronic
914404080 1:147353200-147353222 GTACTAAGATAATTCAAAGGAGG - Intergenic
914699669 1:150120171-150120193 GTAATAAAAAAACTAGTAAGTGG - Intronic
914817707 1:151075262-151075284 GTACTAAAAATACAAAAAATTGG + Intronic
915150827 1:153829933-153829955 GCACTAAAAATACTAAAATTAGG + Intronic
915958600 1:160244777-160244799 CTACTAAAAATACAGAAAGGTGG - Intronic
916273014 1:162964098-162964120 GAACTAAAACAATTAAAAAGAGG - Intergenic
916543157 1:165776955-165776977 GTACTAAAAATACAAAAATTAGG + Intronic
917045758 1:170858442-170858464 CTACTAAAGAATCTAACAGGTGG + Intergenic
917117758 1:171619682-171619704 CTACTAAAAATACAAAAATGTGG + Intergenic
917183345 1:172323214-172323236 ATATTAAAAAAAATAAAATGAGG - Intronic
917230172 1:172828004-172828026 GTTCTAAGAAAACTAAACTGTGG + Intergenic
917367149 1:174244703-174244725 GTAGTGAAAAAAATACAAGGAGG + Intronic
917852262 1:179075187-179075209 GTCTTAAAAAAAAAAAAAGGAGG + Exonic
918452309 1:184671385-184671407 GTGCTAAAGAAAGAAAAAGGGGG - Intergenic
918558067 1:185829287-185829309 TTTCTAAAAAAAATAAAAGGGGG + Intronic
919172504 1:193972881-193972903 GTATTAAGAAAATTATAAGGGGG - Intergenic
919541147 1:198846913-198846935 TTACAAAAAAAAAAAAAAGGTGG - Intergenic
919733272 1:200928212-200928234 CTGCTAAAAAGACAAAAAGGAGG - Intergenic
920341457 1:205277667-205277689 CTACTAAAAATACAAAAATGAGG - Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921031758 1:211340444-211340466 CTACTAAAAATACAAAAAGCTGG - Intronic
921197024 1:212768016-212768038 TTCCTTAAAAAACTAAAAGCAGG + Intronic
921696081 1:218212743-218212765 GTTCAAAAAAATCTCAAAGGAGG - Intergenic
922310172 1:224381280-224381302 CTACTAAAAATACAAAAATGGGG + Intergenic
922443749 1:225678821-225678843 GAATTAAAAAAAAAAAAAGGAGG - Intergenic
922533280 1:226360947-226360969 AAACAAAAAAAACTAAAAAGGGG + Exonic
922600299 1:226846253-226846275 GTACTAAAAATACAAAAAATTGG + Intergenic
922888626 1:229042228-229042250 AAACTAAAAAAACTAGAAAGAGG + Intergenic
922927878 1:229365580-229365602 ATAATAAAAAAATAAAAAGGTGG - Intergenic
923090422 1:230736355-230736377 CTACTAAAAATACAAAAAGCCGG + Intergenic
923239339 1:232066015-232066037 ATAGTAAAAAACCTAGAAGGTGG + Intergenic
923299253 1:232626091-232626113 GTACCAAAAAAGAGAAAAGGTGG - Intergenic
923306110 1:232690395-232690417 GTATTAGAAAAACAAAGAGGAGG + Intergenic
923502192 1:234575150-234575172 AAACTAAAAAAACAAAAAGGAGG - Intergenic
923566787 1:235082490-235082512 CTACTAAAAATACAACAAGGAGG + Intergenic
924259556 1:242215378-242215400 ATGCTCAAAAAACAAAAAGGGGG + Intronic
924521430 1:244809549-244809571 CTACTAAAAATACAAAAATGAGG - Intergenic
924842003 1:247721646-247721668 CTACTAAAAAAACAAAAGGGAGG + Intergenic
1063180317 10:3592393-3592415 GCTTTAAAACAACTAAAAGGAGG - Intergenic
1063218059 10:3941921-3941943 CTACTAAAAATACAAAAATGAGG + Intergenic
1063680708 10:8184912-8184934 GTGCTAAAAAAAATCAGAGGTGG - Intergenic
1064038936 10:11940853-11940875 GTATTTAAAAAACTAAAAGGCGG - Intronic
1064346551 10:14537671-14537693 CTACTAAAAATACAAAAAGTTGG + Intronic
1064831235 10:19468928-19468950 TTATTAAAAAAATTAAGAGGAGG - Intronic
1064912981 10:20423514-20423536 CTACTAAAAATACAAAAAGCCGG - Intergenic
1065026023 10:21539948-21539970 GAAAAAAAAAAACAAAAAGGAGG + Intronic
1065518183 10:26545458-26545480 GTACTAAAAATACAAAAATTAGG + Intronic
1065819668 10:29513982-29514004 GTAAAAAAAAAAAAAAAAGGTGG + Intronic
1066129864 10:32382375-32382397 GTACAAACAAAATGAAAAGGAGG + Intergenic
1066689085 10:38009103-38009125 GTACTAAAAATACAAAAATTAGG - Intergenic
1068024964 10:51631355-51631377 AAACTAAATAAACTAATAGGTGG + Intronic
1068408775 10:56627229-56627251 GTAATCAAAGAACAAAAAGGGGG - Intergenic
1068979993 10:63052005-63052027 CTACTAAAAATACAAAAAGCCGG + Intergenic
1069455348 10:68549631-68549653 GTACTAAAAATACAAAAAATAGG + Intergenic
1069534304 10:69241647-69241669 GTACTAAAAATACAAAAAATTGG - Intronic
1069567127 10:69471063-69471085 CTACTAAGAAAAATAAAACGGGG - Intronic
1069810246 10:71154108-71154130 CTACTAAAAATACAAAAAGCCGG + Intergenic
1070100012 10:73376774-73376796 TTAAAAAAAAAACCAAAAGGTGG + Intronic
1070120575 10:73572981-73573003 TAACTAAAAAAACTAATATGTGG + Intronic
1070725757 10:78787905-78787927 ATTTTAAAAAAACTAAAATGTGG + Intergenic
1070907371 10:80084984-80085006 CTACTAAAAATACAAAAAGTAGG - Intronic
1071137820 10:82471734-82471756 CTACTAAAAATACAAAAATGTGG + Intronic
1071991764 10:91106595-91106617 CTACTAAAAAAAAAAAAAGTGGG - Intergenic
1072148141 10:92661601-92661623 TTACTAATAAAACAAATAGGCGG - Intergenic
1072727009 10:97820765-97820787 ATAATATGAAAACTAAAAGGAGG - Intergenic
1072820859 10:98555958-98555980 ATACTAAGAACTCTAAAAGGTGG + Intronic
1073353133 10:102833754-102833776 GTACTAAAAATACAAAAACTAGG - Intronic
1073980779 10:109151380-109151402 CTACTAAAAACACTAAAAAGTGG + Intergenic
1074342383 10:112645805-112645827 GCACCAAAAAAAGTAAAAAGGGG - Intronic
1077078854 11:713844-713866 GTACTAAAAATACAAAAATTAGG - Intronic
1078222195 11:9361107-9361129 GTACTAAAAATACAAAAATTAGG - Intergenic
1078286678 11:9963298-9963320 TTACTAAAAATACAAAAATGAGG + Intronic
1078786300 11:14497635-14497657 GTCCTCAAAAAACTAAAAACAGG + Intronic
1078967310 11:16360835-16360857 CTACTAAAAATACAAAAAGTTGG + Intronic
1079226059 11:18605840-18605862 CTACTAAAAATACAAAAATGTGG - Intergenic
1079285708 11:19129924-19129946 CTACTAAAAATACAAAAAGCCGG + Intronic
1079741023 11:24060501-24060523 CTACTAAAAATACAAAAAGTAGG - Intergenic
1080221293 11:29908168-29908190 ATTCTTAAAAAACGAAAAGGAGG + Intergenic
1080466383 11:32501307-32501329 CTACTAAAAATACAAAAAGCCGG + Intergenic
1080567404 11:33524471-33524493 GAACTAATAAAAATAAAAGCTGG - Intergenic
1080833815 11:35921248-35921270 GTACTAAAAATACAAAAAATTGG - Intergenic
1082018287 11:47509385-47509407 GGAGTAAAAAAGCTAAGAGGGGG + Intronic
1082052930 11:47787586-47787608 CTACTAAAAATACAAAAATGAGG - Intronic
1082119973 11:48369735-48369757 TTACCAAAAAAAAAAAAAGGGGG - Intergenic
1083180743 11:60983076-60983098 GAAGTAAAAAAACAAAGAGGAGG - Intronic
1083249996 11:61460198-61460220 CTACTAAAAATACAAAAAGCCGG + Intronic
1083465688 11:62844373-62844395 GTATTAAATAAAATAAAAGTAGG - Intergenic
1083486665 11:62987307-62987329 GTACTAAAAATACAAAAATTAGG + Intergenic
1083555224 11:63620784-63620806 GTACTAAAAATACAAAAATTAGG - Intergenic
1083839132 11:65293443-65293465 GTACTAAAAATACAAAAATTAGG + Intronic
1085584704 11:77691013-77691035 GCAGTACAAAAACAAAAAGGAGG + Intronic
1085653510 11:78290798-78290820 GTTCTAAAAAAAATAAAATTTGG - Intronic
1086123304 11:83323720-83323742 ATTCCAAAAAATCTAAAAGGAGG - Intergenic
1086320538 11:85642526-85642548 GAACCAATAAAACCAAAAGGTGG + Intergenic
1086533586 11:87815434-87815456 GTACTAAAATTATTAAGAGGAGG + Intergenic
1086935873 11:92745430-92745452 GTACTAAAGAAACTTTGAGGAGG + Intronic
1087109424 11:94447527-94447549 ATACTATAAAAACATAAAGGAGG + Intronic
1087245330 11:95828874-95828896 GTACTAAAAATACAAAAAATTGG + Intronic
1087664188 11:101024237-101024259 CTACTAAAAATACAAAAAGTTGG + Intergenic
1087847275 11:102987614-102987636 GTCTTAAAAAAAAAAAAAGGGGG + Intergenic
1088165227 11:106927205-106927227 CTACTAAAAATACAAAAAGTTGG + Intronic
1088251502 11:107865067-107865089 CTACTAAAAATACAAAAAGCCGG + Intronic
1088502307 11:110494611-110494633 GTCCAAATAAAACAAAAAGGAGG - Intergenic
1089269579 11:117292472-117292494 GTACTAAGAAAAGTTAAAAGCGG - Intronic
1090488771 11:127139455-127139477 GGACTATAAAAAATAAAAAGAGG - Intergenic
1091115822 11:133012339-133012361 GTACTAGAAAAGCCAACAGGAGG - Intronic
1091423800 12:367936-367958 ATACTCAAAGAACTGAAAGGAGG + Intronic
1091478358 12:799847-799869 CTACTAAAAATACAAAAAGTAGG - Intronic
1092574796 12:9769880-9769902 TTACTAAAAGAAGTAACAGGAGG - Intergenic
1092755276 12:11757658-11757680 CTCCTAAAAAAGCTGAAAGGTGG - Intronic
1092829700 12:12431856-12431878 CTACTAAAAATACAAAAAGTAGG - Intronic
1093135233 12:15441552-15441574 GTATCAACAAAACTAAAAGTTGG + Intronic
1093455975 12:19365203-19365225 CTACTAAAAATACAAAAAGCCGG + Intronic
1093774796 12:23060863-23060885 GTCCTTAAAAAACTGAAAGAGGG - Intergenic
1093908415 12:24718832-24718854 GGAATAAGAAAACCAAAAGGAGG + Intergenic
1094291993 12:28861386-28861408 TTACTAAAGAAAGTAAAAAGAGG - Intergenic
1094548507 12:31428187-31428209 CTACTAAAAATACAAAAATGTGG + Intronic
1095454514 12:42368651-42368673 CTACTACAAAACATAAAAGGGGG - Intronic
1095612175 12:44142694-44142716 GTAAAATAAAAACTAAAAGAGGG + Intronic
1095705252 12:45229686-45229708 GAATTAAAAAAACTAAAATAAGG - Intronic
1096099290 12:48959395-48959417 CTACTAAAAAAACAAAAAATTGG - Intergenic
1096274075 12:50190800-50190822 GTCCTAAAAAAAAAAAAAAGTGG + Intronic
1096357640 12:50955125-50955147 CTACTAAAAATACAAAAAGTTGG + Intronic
1096645104 12:53028959-53028981 GTACTAAAAATACAAAAATTAGG + Intronic
1096679971 12:53249181-53249203 CTACTAAAAATACAAAAAGCTGG - Intergenic
1097989479 12:65820105-65820127 CTACTAAAAATACAAAAACGTGG - Intergenic
1098012144 12:66064707-66064729 TTACTTAAAAAAATAAAAAGAGG - Intergenic
1098050505 12:66447640-66447662 GTATTAAAAACACTAAAAGGGGG - Intronic
1098523610 12:71461477-71461499 ATAATAAATAGACTAAAAGGCGG - Intronic
1099584561 12:84501495-84501517 TTAATAAAAAAAAAAAAAGGGGG + Intergenic
1100221168 12:92505975-92505997 GTAAAAAAAAAAGTGAAAGGGGG - Intergenic
1100895963 12:99182707-99182729 TTCCTGAAAAAACTAAAAGTAGG - Intronic
1101141047 12:101796298-101796320 GTACCCAATAAACTACAAGGTGG + Intronic
1101369750 12:104115561-104115583 GTCTTAAAAAAAAAAAAAGGGGG + Intergenic
1102100974 12:110278878-110278900 CTACTAAAAATACAAAAATGAGG + Intergenic
1102105717 12:110321060-110321082 CTACTAAAAATACAAAAATGAGG + Intronic
1102497190 12:113327814-113327836 CTACTAAAAATACAAAAAGCCGG + Intronic
1103286251 12:119803985-119804007 GAACTAAAAAAAAAAAAAAGTGG - Intronic
1103580977 12:121915158-121915180 CTACTAAAAATACTAAAATTAGG + Intronic
1103581766 12:121920694-121920716 CTACTAAAAATACAAAAAGTTGG - Intronic
1103767151 12:123288438-123288460 CTACTAAAAATACAAAAAGCTGG - Intergenic
1103819794 12:123688379-123688401 GTACTAAAAATACAAAAAATTGG - Intronic
1103855693 12:123969398-123969420 GAAATAAACAAACTAAAATGCGG + Intronic
1104124667 12:125834894-125834916 GTACTGACAAAAATAGAAGGTGG - Intergenic
1104346409 12:128003561-128003583 CTACTAAAAATACAAAAAGTAGG + Intergenic
1104678887 12:130735196-130735218 TTCCTTAAAGAACTAAAAGGCGG - Intergenic
1105423142 13:20270857-20270879 GTAATAAAATGTCTAAAAGGGGG + Intergenic
1105785335 13:23742761-23742783 CTACTAAAAGAAATAAAAGATGG + Intronic
1105929200 13:25036386-25036408 CTATTAAGAAAATTAAAAGGTGG + Intergenic
1106637573 13:31545298-31545320 GGACTAAACTAAATAAAAGGTGG - Intergenic
1106859968 13:33894882-33894904 GTATTAAAAAAACATAAATGGGG + Intronic
1106888665 13:34218406-34218428 GTAATAAAAAAAATCAAAGCTGG - Intergenic
1106911869 13:34471629-34471651 GCACTGAAAAAACTAAGAAGGGG + Intergenic
1106938931 13:34754786-34754808 GTAGTAGGAAAGCTAAAAGGTGG - Intergenic
1107186794 13:37532072-37532094 GAACTAAAAAAAATAAATGAAGG + Intergenic
1107849816 13:44559854-44559876 CTACTAAAAATACAAAAATGAGG - Intronic
1107965326 13:45592694-45592716 GTACTAAAAAAACTAAAAGGGGG + Intronic
1108139514 13:47404966-47404988 GTATTAAGAAAGCCAAAAGGAGG + Intergenic
1108415389 13:50193312-50193334 GTACTTAAATAATTAAAAAGTGG - Intronic
1108992264 13:56674777-56674799 GAAGAAAAAAAAATAAAAGGGGG + Intergenic
1109242596 13:59908202-59908224 CTACTAAAAATACAAAAAGTTGG + Intronic
1110031821 13:70625049-70625071 CTACTAAAAATACGAAAATGAGG - Intergenic
1110045750 13:70828486-70828508 CTCCTCAAAAAACTAAAAGTAGG - Intergenic
1110622590 13:77614593-77614615 GTACCAACAAAACTTAAAAGGGG - Intronic
1110880617 13:80567758-80567780 GTAGTAAAAATACTAAAATTAGG - Intergenic
1111253009 13:85629328-85629350 GTAAAAAAAAAACTCCAAGGAGG + Intergenic
1111489799 13:88957524-88957546 GAAATAAAAAAACAAAAAGTAGG + Intergenic
1111884882 13:94007617-94007639 CTGCTAAAAAGACTTAAAGGGGG - Intronic
1112035043 13:95489248-95489270 GTCCTTAAAGAACTAAAAGTAGG - Intronic
1112352021 13:98643435-98643457 GAACTAATAAATCTAAAAGTTGG - Intergenic
1112385070 13:98931760-98931782 GTACTAAAAATACAAAAATTAGG - Intronic
1112451974 13:99520732-99520754 CTACTAAAAATACAAAAAGTTGG - Intronic
1112950146 13:104984590-104984612 GTATTGAGAAAACTGAAAGGAGG + Intergenic
1113007042 13:105718021-105718043 GTACAAAATAAATTAAAAAGCGG - Intergenic
1113543457 13:111126970-111126992 GAACAAACAAAACTGAAAGGTGG + Intronic
1113563367 13:111301918-111301940 ATAAGCAAAAAACTAAAAGGAGG + Intronic
1113703063 13:112401999-112402021 AAGCTAAAAAAACTAAAAGAGGG - Intronic
1113900971 13:113797781-113797803 ATACTAATAAAACTAAACGTGGG + Intronic
1113977170 13:114236618-114236640 ATACCAAAAAAAAAAAAAGGTGG - Intronic
1114146317 14:19981751-19981773 ATACTATGAAAACTGAAAGGGGG + Intergenic
1114489662 14:23091431-23091453 CTACCAAAAATACAAAAAGGTGG + Intronic
1116314223 14:43366689-43366711 GTACTAAAAATACAAAAAATTGG + Intergenic
1116370393 14:44122747-44122769 ATACTCAAAAAACTTAAATGTGG + Intergenic
1116466258 14:45236125-45236147 GTACCAAAAAAACTATACTGTGG + Intronic
1116682833 14:47996476-47996498 GCAATAAAAAAAATAAAATGAGG - Intergenic
1116853390 14:49930526-49930548 CTACTAAAAAAACAAAAATTAGG - Intergenic
1116858523 14:49974882-49974904 CTACTAAAAATACAAAAAGTAGG - Intergenic
1117137660 14:52753349-52753371 GTACTAAAAATACAAAAATTAGG - Intronic
1117291218 14:54335307-54335329 GTAATTAAAAAAGAAAAAGGAGG - Intergenic
1117311046 14:54523538-54523560 CTACTCAAAAAAAAAAAAGGAGG - Intronic
1117481468 14:56149587-56149609 GAAAAAAAAAAAGTAAAAGGTGG - Intronic
1117604932 14:57418824-57418846 TTACTAAAAACACTAAAATTGGG - Intergenic
1117682484 14:58218982-58219004 CTACTAAAAATACAAAAAGCTGG - Intronic
1117889326 14:60401108-60401130 ATACAAAAAAAACTAAAAGAGGG - Intronic
1118769564 14:68933119-68933141 ATAATAAAAAAAATACAAGGAGG - Intronic
1119364313 14:74078827-74078849 CTACTAAAAATACAAAAATGTGG - Intronic
1119368854 14:74120452-74120474 CTACTAAAAATACAAAAAGTAGG + Intronic
1120279986 14:82427145-82427167 TGATTTAAAAAACTAAAAGGAGG + Intergenic
1120352073 14:83374819-83374841 CTACAACAAAGACTAAAAGGAGG - Intergenic
1120553549 14:85901919-85901941 GTAATAAAAAAATTAAAAAGGGG - Intergenic
1120827121 14:88966135-88966157 TTATTAAAAAAAAAAAAAGGAGG + Intergenic
1120861831 14:89261627-89261649 GTACTAAAAATACAAAAATTAGG + Intronic
1121487056 14:94324738-94324760 CCAGTAACAAAACTAAAAGGTGG - Intergenic
1121618647 14:95331238-95331260 GTACAAAAAAAAAAAAAATGTGG - Intergenic
1122457948 14:101869814-101869836 CTACTAAAAATACAAAAATGAGG - Intronic
1122964202 14:105113765-105113787 CTACTAAAAATACAAAAAAGTGG + Intergenic
1123807709 15:23891927-23891949 GTACTAAAAAAAAACAAAGTTGG - Intergenic
1123963019 15:25426488-25426510 ATACTAAAAGAACTAAAGGTAGG + Intronic
1124516700 15:30372447-30372469 GTGCTAAAAAAAAAAAAGGGGGG + Intronic
1124698540 15:31889355-31889377 GTACTAAAAATACAAAAAATTGG - Intergenic
1124726218 15:32158284-32158306 GTGCTAAAAAAAAAAAAGGGGGG - Intronic
1125623999 15:41091222-41091244 CTACTAAAAATACAAAAAGTTGG - Intronic
1125665759 15:41428899-41428921 CTACTAAAAATACAAAAAGTAGG - Intronic
1125797721 15:42415894-42415916 CTACTAAAAATACAAAAAGCCGG - Exonic
1125873107 15:43120411-43120433 CTACTAAAAATACAAAAAGTAGG - Intronic
1125908045 15:43411738-43411760 GTACTCATAAAAATAAAATGAGG - Intronic
1126151910 15:45530910-45530932 GTACTAAAAATACAAAAATTAGG + Intergenic
1127361823 15:58251171-58251193 GTACTAAAAAAAAAAAAAATAGG - Intronic
1127595760 15:60480433-60480455 GTATTAAAAAAAATTATAGGAGG - Intergenic
1127748642 15:62007938-62007960 GTACTAAAAATACAAAAATTAGG + Intronic
1128358110 15:66942637-66942659 CTACTAAAAATACAAAAAGCTGG + Intergenic
1128824442 15:70698948-70698970 GTAACAAAAAAACAAAAGGGTGG + Intronic
1129448620 15:75636624-75636646 GTACTAAAAATACAAAAATTAGG - Intergenic
1129470037 15:75748047-75748069 CTACTAAAAATACAAAAAAGTGG - Intergenic
1129521249 15:76187610-76187632 GCACTTAAAACACTCAAAGGTGG - Intronic
1129745793 15:78019884-78019906 GTATCAAAAAAAAAAAAAGGGGG + Intronic
1130441480 15:83958903-83958925 GTAATAAGCAAAATAAAAGGAGG + Intronic
1130628052 15:85536153-85536175 GTACAAAAAAAAATTAAAGCTGG - Intronic
1131313315 15:91310377-91310399 CTACTAAAAATACAAAAAGTAGG - Intergenic
1132752861 16:1466786-1466808 CTACTAAAAATACAAAAAGTAGG + Intronic
1132857068 16:2050751-2050773 CTACTAAAAATACAAAAAGCCGG - Intronic
1132957849 16:2605391-2605413 CTACTAAAAATACAAAAAGGTGG + Intergenic
1132970309 16:2684467-2684489 CTACTAAAAATACAAAAAGGTGG + Intronic
1133162458 16:3921014-3921036 CTACTAAAAATACAAAAATGAGG - Intergenic
1133603976 16:7368100-7368122 TTACTAAAAATACTAAAATTAGG + Intronic
1133648085 16:7783275-7783297 GTACTAAAAATACAAAAATTAGG - Intergenic
1134274633 16:12764758-12764780 GTACAAATAAAACAAAATGGTGG - Intronic
1134539063 16:15049588-15049610 CTACTAAAAATACGAAAAGCTGG - Intronic
1134634608 16:15782911-15782933 GCACTAAAATAATTAGAAGGAGG - Intronic
1134655582 16:15946170-15946192 CTACAAAAAATACAAAAAGGTGG - Intergenic
1135896769 16:26412745-26412767 GTGCTAAAAAAAAAAAAAGGGGG + Intergenic
1136101256 16:27998019-27998041 CTACTAAAAATACAAAAAGCTGG - Intronic
1136594867 16:31241172-31241194 CTACTAAAAATACAAAAAGCCGG - Intergenic
1137386843 16:48049762-48049784 CTAATAAAAAGAGTAAAAGGTGG - Intergenic
1138695433 16:58808560-58808582 GTCTTAAAAAAAAAAAAAGGGGG - Intergenic
1139595652 16:67956519-67956541 CTACTAAAAATACAAAAATGTGG + Intronic
1139617414 16:68106588-68106610 CTACTAAAAATACAAAAAAGAGG - Intronic
1139714896 16:68805182-68805204 GTACTAAAAACACAAAAGGAAGG - Intronic
1139876953 16:70153877-70153899 CTACTAAAAATACAAAAAGTAGG + Intronic
1139891576 16:70256462-70256484 GTACTAAAAATACAAAAATTAGG - Intronic
1140422649 16:74833336-74833358 CTACTAAAAATACAAAAATGAGG - Intergenic
1140568201 16:76069208-76069230 GTAATAATAAAACCAAAAAGTGG - Intergenic
1140659589 16:77175055-77175077 TTACTTAAATAACTAAAAGTAGG + Intergenic
1141082005 16:81061002-81061024 GTACTACAAAAAAAAAATGGAGG + Exonic
1141911372 16:87060672-87060694 GTTCTCAAAAAACGAAAAGTGGG + Intergenic
1142396223 16:89833287-89833309 CTACTAAAAATACAAAAAGATGG - Intronic
1142542342 17:669918-669940 ATAATAAAAAAATTAAAAGGTGG + Intronic
1142659810 17:1420106-1420128 CTACTAAAAATACTAAAATCTGG - Intergenic
1142842661 17:2645768-2645790 CTACTAAAAATACAAAAAAGTGG - Intronic
1143071347 17:4296557-4296579 GTACTAAAACCTTTAAAAGGAGG - Intronic
1143088989 17:4437397-4437419 GTATTTAAAATAATAAAAGGGGG + Intronic
1143458740 17:7085983-7086005 CTACTAAAAATACAAAATGGTGG - Intergenic
1143522175 17:7450987-7451009 GTACTCAAGAAACAGAAAGGAGG + Intronic
1143555549 17:7657534-7657556 GCATTAAAAAAAGAAAAAGGAGG - Exonic
1143561862 17:7701267-7701289 CTACTAAAAATACAAAAATGAGG - Intronic
1143894419 17:10125063-10125085 GCAGTAAAAAAAAAAAAAGGGGG + Intronic
1143949118 17:10618958-10618980 CTACTAAAAATACAAAAAGCTGG - Intergenic
1144323871 17:14158233-14158255 GTAAAAAAAAAATTAAAAGTAGG + Intronic
1144707403 17:17378640-17378662 CTACTAAAAATACAAAAAGCTGG + Intergenic
1144744152 17:17602181-17602203 GTACTAAAAATACAAAAATTAGG + Intergenic
1145802925 17:27702127-27702149 GCCCTGAAAAAACAAAAAGGGGG + Intergenic
1146173345 17:30649467-30649489 GTATTAAAAAAAAAAAATGGTGG - Intergenic
1146196224 17:30815384-30815406 CTACTAAAAATACAAAAAGTTGG - Intronic
1146201693 17:30863963-30863985 CTACTAAAAATACAAAAAGTAGG - Intronic
1146338317 17:31995111-31995133 GTAATAAAAAAATTACAAAGAGG + Intronic
1146385266 17:32365607-32365629 TTATTAAATATACTAAAAGGTGG + Intronic
1146798649 17:35801035-35801057 GTACTAAAAATACAAAAATTTGG + Intronic
1147600962 17:41745132-41745154 GTACTAAAAATACAAAAATTAGG - Intergenic
1147782185 17:42951385-42951407 GTACTAAAAATACAAAAAATTGG + Intronic
1147964014 17:44183749-44183771 CTACTAAAAATACAAAAAGTAGG + Intergenic
1147972402 17:44226207-44226229 CTACTAAAAATACAAAAAGGTGG - Intergenic
1148373340 17:47118347-47118369 GTACTCAAAAGAATGAAAGGTGG - Intronic
1149123527 17:53199361-53199383 ACAATAAAAAAACTAAAAAGAGG - Intergenic
1149312916 17:55413023-55413045 GTTCTAAAAAAATTAATATGGGG + Intronic
1149320883 17:55479418-55479440 CTACTAAAAATACAAAAAGTAGG + Intergenic
1150061048 17:62068469-62068491 CTACTAAAAACACAAAAAGGCGG + Intergenic
1150243877 17:63659034-63659056 CTACTAAAAAAATTAAAAAATGG - Intronic
1150775612 17:68079491-68079513 TTACTAAAAATACAAAAGGGTGG - Intergenic
1150940623 17:69689407-69689429 GTAGTAAACAAACACAAAGGGGG + Intergenic
1150963972 17:69946740-69946762 GTTCAAAAAAATCTAAATGGTGG - Intergenic
1150992462 17:70275548-70275570 GGATTAAAAAAAATAAAAGTTGG + Intergenic
1151900012 17:77006022-77006044 GTTGAAAAAAAAATAAAAGGAGG - Intergenic
1152043518 17:77920550-77920572 CTACTAAAAATACAAAAAGTAGG + Intergenic
1152555582 17:81051559-81051581 CTACTAAAAATACAAAAAGCCGG - Intronic
1152850754 17:82633708-82633730 GTCCTCAAAAAATTAAAAAGAGG + Intronic
1153011529 18:544002-544024 GTTCCAAAAAGAATAAAAGGAGG - Intergenic
1153284277 18:3443859-3443881 GTAGTAAATAAAATAAAAGAAGG + Intronic
1153708535 18:7772985-7773007 ATACTATAAAAAGTAACAGGAGG + Intronic
1153842441 18:9018957-9018979 GTTTTAAAAAAAGAAAAAGGTGG - Intergenic
1153845305 18:9044022-9044044 GTACTAAAAATACAAAAATTAGG - Intergenic
1153933770 18:9902356-9902378 CTACTAAAAATACCAAAAGCTGG + Intergenic
1154160593 18:11978516-11978538 GTACTAAAAATACAAAAAAATGG - Intergenic
1154254591 18:12771488-12771510 CTACTAAAAATACAAAAAGCCGG - Intergenic
1155212737 18:23617052-23617074 CTACTAAAAATACAAAAAGCTGG + Intronic
1155641243 18:28018160-28018182 CTACAAAAAAAAAAAAAAGGAGG + Intronic
1155955825 18:31956040-31956062 GTAATAAAAATACAAAAAGCTGG - Intergenic
1155978146 18:32153994-32154016 CTACTAAAAATACTAAAATTAGG + Intronic
1156157192 18:34316986-34317008 GTATTTAAAACACAAAAAGGTGG - Intergenic
1156956410 18:42970367-42970389 GTATTAAAAAAATTAAATGCTGG + Intronic
1157213453 18:45763113-45763135 CTACTAAAAATACAAAAATGTGG - Intergenic
1157512241 18:48284627-48284649 CTACTAAAAATACAAAAAGCTGG + Intronic
1158702582 18:59761967-59761989 GTACTTAAAAAAAAAAAAAGAGG + Intergenic
1160655146 19:262703-262725 TTACTAAAAATACAAAAAGCTGG - Intergenic
1160886536 19:1352173-1352195 CTACTAAAAATACAAAAAGTAGG + Intergenic
1160896515 19:1404997-1405019 GTACTAAAAATACAAAAATTAGG - Intergenic
1161111015 19:2470089-2470111 CTACTAAAAATACAAAAAGTTGG - Intergenic
1161186466 19:2924759-2924781 CTACTAAAAATACAAAAAGTTGG - Intergenic
1161394927 19:4039989-4040011 CTACTAAAAATACAAAAAGCTGG + Intergenic
1161505700 19:4642314-4642336 CTACTAAAAATACAAAAATGAGG + Intronic
1161669469 19:5597382-5597404 CTATTAAAAAAAATAAAGGGTGG - Intronic
1162206487 19:9060015-9060037 CTACTAAAAATACAAAAATGAGG + Intergenic
1162297501 19:9823522-9823544 CTACTAAAAATACAAAAATGTGG - Intronic
1162317577 19:9949366-9949388 CTACTAAAAAAACAAAAATTAGG - Intergenic
1162960375 19:14122229-14122251 GTACTAAAAATACAAAAAAAAGG - Intronic
1163298442 19:16428034-16428056 CTACTAAAAATACAAAAATGAGG + Intronic
1163409463 19:17144802-17144824 GTACTAAAAATACAAAAAATTGG + Intronic
1163538805 19:17894311-17894333 CTACTAAAAATACAAAAAGTTGG - Exonic
1163743105 19:19028849-19028871 CTACTAAAAATACAAAAATGTGG - Intronic
1163801703 19:19369693-19369715 GTCTTAAAAAAAAAAAAAGGGGG + Intergenic
1163926052 19:20344653-20344675 CTACTAAAAAAACAAAAATTAGG + Intergenic
1164117435 19:22236070-22236092 GGACTAAAAAGACGCAAAGGTGG - Intergenic
1164185256 19:22861463-22861485 GTATGAAAAACACTAAAAGTTGG - Intergenic
1164226866 19:23253404-23253426 CTACTAAAAATACCAAAAGTTGG + Intergenic
1164403878 19:27924516-27924538 CTACTAAAAACACAAAAAGTAGG - Intergenic
1165582038 19:36874488-36874510 CCACTAAAAAAAAAAAAAGGGGG + Intronic
1165804873 19:38574097-38574119 CTACTAAAAATACAAAAAGTAGG + Intronic
1165863806 19:38923678-38923700 GTACTAAAAATACAAAAATCAGG + Intronic
1165936671 19:39393394-39393416 GTTCAAAAAAAAAGAAAAGGAGG - Intronic
1165955008 19:39497091-39497113 CTACAAAAAAAAAGAAAAGGAGG - Intergenic
1166216271 19:41337439-41337461 GTACTAAAAATACAAAAATCAGG - Intronic
1166221338 19:41366621-41366643 CTACTAAAAATACAAAAATGAGG - Intronic
1166726230 19:45029546-45029568 CTACTAAAAATACAAAAATGAGG + Intronic
1166746475 19:45144311-45144333 GTACTAAAAATACAAAAATTAGG - Intronic
1167018760 19:46859407-46859429 CTACTAAAAATACAAAAATGAGG - Intergenic
1167064585 19:47174871-47174893 CTACTAAAAATACAAAAATGTGG - Intronic
1167396112 19:49230278-49230300 GTACTAAAAATACAAAAATTAGG - Intergenic
1167451839 19:49575161-49575183 CTACTAAAAATACAAAAATGAGG - Intronic
1167838249 19:52092952-52092974 CTACTAAAAACACAAAAAGCTGG + Intronic
1167895003 19:52573536-52573558 GTACTAAAAACACAAAAATTGGG - Intronic
1168202133 19:54823335-54823357 TTCTTTAAAAAACTAAAAGGAGG - Intronic
1168206940 19:54857389-54857411 ATCTTTAAAAAACTAAAAGGAGG - Intronic
1168299257 19:55394094-55394116 ATACTAAAAATACTAAAAACTGG + Intronic
1168649032 19:58081227-58081249 GTGCTAAAAAAAAAAAATGGAGG + Intronic
1168681789 19:58321122-58321144 CTACTAAAAATACAAAAAGCTGG - Intergenic
925843574 2:8015579-8015601 TTACTTAAAGAACTAAAAGTAGG - Intergenic
925993858 2:9275828-9275850 GCATTAAAAAAACTAAAAAGAGG + Intronic
926758989 2:16260778-16260800 TTACTTTAAAAACTAAAGGGAGG + Intergenic
926986827 2:18633518-18633540 TTACAAAAAAAATTAAAAAGTGG - Intergenic
927116548 2:19909135-19909157 CTACTAAAAATACTAAAATTAGG - Intergenic
927258725 2:21064275-21064297 GTAGTAAAAAAAAAAAAAAGGGG - Intergenic
927804876 2:26138273-26138295 CTACTAAAAATACTAAAAGCCGG + Intergenic
927821732 2:26272054-26272076 CAATTAAAAAAACTAAAAAGAGG - Intronic
928547482 2:32341896-32341918 CTACTAAAAATACAAAAAGTAGG + Intergenic
928704783 2:33936927-33936949 GTATTAAAAAAAAAAAAAGTGGG - Intergenic
928859519 2:35840056-35840078 GTACTTACAGAATTAAAAGGAGG - Intergenic
928908283 2:36391426-36391448 GTTCTAAAAAAATCAAAAGTGGG - Intronic
929442027 2:41972142-41972164 GTCTTAAAAAAAAAAAAAGGGGG + Intergenic
929984657 2:46716108-46716130 GAACTAAAAAAAAAAAAAAGGGG - Intronic
930417313 2:51104775-51104797 GTACTAAAAATACAAAAATTAGG - Intergenic
930425354 2:51206046-51206068 GTATTAAAAAAAAAAAAAGAGGG + Intergenic
930787418 2:55284201-55284223 ATGCTAGAAAAACTAAAAGTTGG + Intergenic
931236431 2:60416845-60416867 TTACTAAAAAAAAAAAAAAGTGG - Intergenic
931277173 2:60754201-60754223 GTACTAAAAATACAAAAATTAGG + Intergenic
931325630 2:61219234-61219256 GTACTCAAAAATCAAAATGGTGG - Intronic
932947514 2:76253515-76253537 GGACTAAAGAAAATAAAATGTGG + Intergenic
933154253 2:78954110-78954132 CTACTAAAAATACAAAAATGAGG + Intergenic
933157519 2:78992337-78992359 CTACTAAAAATACAAAAAGCTGG - Intergenic
933395129 2:81721771-81721793 TTACTTAAAAATTTAAAAGGTGG + Intergenic
933640199 2:84750636-84750658 GTACTAAAAAATGTTGAAGGTGG + Intronic
933680581 2:85096369-85096391 GTAGTATAAAAAAGAAAAGGGGG + Intergenic
933683653 2:85125580-85125602 CTACTAAAAAAATTAAAATTAGG - Intergenic
933826401 2:86164977-86164999 GTACTAGAAAAAACAAAAGCTGG + Intronic
934895196 2:98112615-98112637 GTACAAAGAAAACCAAAAGAAGG - Intronic
935355943 2:102199992-102200014 GTACTAAAAAAACAAAAAATTGG + Intronic
935714912 2:105931320-105931342 CTACTAATAAAAGTAAAAAGAGG + Intergenic
936408155 2:112227013-112227035 GTACTCAAAAAACTAGAAATAGG + Intronic
936464720 2:112737089-112737111 CTACTAAAAATACAAAAAGTAGG - Exonic
936709846 2:115119844-115119866 GTACCAAAAAGACTAACAAGTGG + Intronic
936867784 2:117095690-117095712 CTACTAAAAATACCAAAAGCTGG - Intergenic
936962121 2:118087471-118087493 CTACTAAAAATACAAAAAGTAGG + Intergenic
937052988 2:118907481-118907503 GTAATAAAAAAGGGAAAAGGAGG + Intergenic
937424597 2:121788281-121788303 CTACTAAAAATACTAAAATTAGG - Intergenic
937683013 2:124664849-124664871 CTACTAAAAATACAAAAATGAGG - Intronic
938202349 2:129384327-129384349 GAACAAAATAAACTCAAAGGAGG - Intergenic
938371666 2:130772387-130772409 CTACTAAAAATACAAAAAGCCGG + Intergenic
938694018 2:133819102-133819124 GCATTAAAAAAATTAAAAAGTGG + Intergenic
938700373 2:133872701-133872723 GTGCTATAAAACCCAAAAGGAGG - Intergenic
938732882 2:134160156-134160178 ATAATAAAAAAATTAAAAAGTGG - Intronic
938821202 2:134962048-134962070 GTACTCAAAATAATAAAGGGAGG + Intergenic
938853973 2:135291024-135291046 CTAGTAAAAATACAAAAAGGAGG - Intronic
939138843 2:138329082-138329104 GAACTAAAAAAAACAAAATGAGG + Intergenic
939164735 2:138628162-138628184 ATATTTAAAAAACTAAAAAGTGG - Intergenic
939937091 2:148305940-148305962 GTAATAAAAAATTAAAAAGGGGG - Intronic
940226717 2:151408812-151408834 GTCTTAAAAAAAAAAAAAGGCGG + Intergenic
940264417 2:151821354-151821376 ATACTTCAAAAACAAAAAGGAGG + Intronic
940719312 2:157264377-157264399 GTACTTTAAAAACTAAATGCTGG - Intronic
940946330 2:159622409-159622431 GTACTAAAAAAAATTATGGGAGG + Intergenic
941110049 2:161411282-161411304 GTCCTAAAAGAACAAAAATGAGG - Exonic
941270141 2:163415456-163415478 GGAATAAAAAAATTAAAATGTGG + Intergenic
941984828 2:171500030-171500052 AAAATAAAAAAATTAAAAGGCGG - Intergenic
942184126 2:173408165-173408187 ATAATAAAAAAACTAATAGCTGG - Intergenic
942773133 2:179546774-179546796 TTCCTCAAAAAACTAAAAGTTGG - Intronic
943522903 2:188975977-188975999 GAACTAAAAAAAAGAAATGGAGG - Intronic
943645510 2:190405370-190405392 GTACAAAAAAAATTAAAAATTGG + Intergenic
943662857 2:190577709-190577731 CTACTAAAAATACAAAAAGCCGG + Intergenic
943892864 2:193312841-193312863 GCATTAATAAAACTAAAAGCTGG + Intergenic
944118033 2:196209927-196209949 CTACTAAAAATACAAAAAGTTGG - Intronic
944582713 2:201146445-201146467 GTACTAAAAATACAAAAATTAGG - Intronic
944795833 2:203184264-203184286 GTACTAAAAATACAAAAATTAGG + Intronic
944815040 2:203367319-203367341 GTTTTAAAAAAAAAAAAAGGCGG - Intronic
945015680 2:205512985-205513007 ATACTAAAAAAAAAAAAAGAAGG - Intronic
946971439 2:225096450-225096472 ATACTAAAAAAAAAAAAAGTTGG - Intergenic
947057173 2:226118331-226118353 GTAAAAATAAAAGTAAAAGGGGG + Intergenic
947168722 2:227289379-227289401 CTACTAAATTAACTAAAAGAAGG + Intronic
947349712 2:229230637-229230659 GTACTACAAAGACCCAAAGGCGG - Intronic
947688587 2:232113598-232113620 GTATTATAAAACCCAAAAGGAGG + Intronic
947758266 2:232585036-232585058 GTACTAAAAATACAAAAATTAGG + Intergenic
947996489 2:234532031-234532053 GTCCTTAAAGAACTAAAAGTAGG + Intergenic
948431979 2:237924727-237924749 GTATTAAAAAAAAAAAAGGGGGG + Intergenic
948969885 2:241417133-241417155 CTACTAAAAATACAAAAAGCTGG + Intronic
1168822510 20:784847-784869 GTACTATGAAAATTGAAAGGGGG - Intergenic
1169025445 20:2366906-2366928 GTACTAAAAATACAAAAAATTGG + Intergenic
1169129178 20:3155227-3155249 CTACTAAAAATACAAAAAGTAGG + Intronic
1169301740 20:4447646-4447668 GCATTAATAAAACTAAAAGTTGG + Intergenic
1170173016 20:13436345-13436367 GTTTTAAAAAAAAAAAAAGGAGG + Intronic
1170754160 20:19183760-19183782 GTGCTAAAAAAATTTAATGGGGG - Intergenic
1171005460 20:21461102-21461124 CTACTAAAAATACAAAAATGTGG + Intergenic
1171022690 20:21600957-21600979 CTACTAAAAATACAAAAATGTGG + Intergenic
1171478252 20:25430953-25430975 TTTCTAAAAAATATAAAAGGAGG - Intronic
1171847808 20:30288382-30288404 TTATTAAAAAATTTAAAAGGAGG - Intergenic
1171975486 20:31592102-31592124 GTATTAAAAAAAAAAAAAAGAGG - Intergenic
1171998804 20:31755246-31755268 CTACTAAAAATACAAAAAAGCGG - Intronic
1172111754 20:32550579-32550601 CTACTAAAAATACAAAAAAGTGG + Intronic
1172220935 20:33274553-33274575 GTATTAAAAAAAAAAAAAGAAGG + Intronic
1172296236 20:33813009-33813031 GTACTAAACACACAAAAAGATGG + Intronic
1172296258 20:33813142-33813164 GTAAAAAAAAAAAAAAAAGGGGG + Intronic
1174024353 20:47560239-47560261 CTACTAAAAATACAAAAAGCCGG - Intronic
1174585667 20:51606102-51606124 CTACTAAAAATACTAAAATTAGG + Intronic
1175555322 20:59849818-59849840 TTTCTAAAAAAATTTAAAGGGGG + Intergenic
1176585820 21:8584347-8584369 ATTCTAAAAAAATTAAAAGAGGG - Intergenic
1177137586 21:17322567-17322589 CTATTAAAAAAAAAAAAAGGAGG + Intergenic
1177262010 21:18741860-18741882 GTAAAAAAAAAAAAAAAAGGAGG - Intergenic
1177727779 21:24991293-24991315 AACCTAAAAAAATTAAAAGGAGG + Intergenic
1178192065 21:30294909-30294931 CTACTAAAAATACAAAAATGAGG - Intergenic
1178284708 21:31315813-31315835 CTACTAAAAATACAAAAAGGCGG + Intronic
1178545102 21:33486538-33486560 CTACTAAAAAAAATAAAAATTGG + Intronic
1178598414 21:33975158-33975180 GTATCAAAAGAAGTAAAAGGAGG - Intergenic
1178964430 21:37102830-37102852 GTACTAAAAATACAAAAATTAGG + Intronic
1179198968 21:39196532-39196554 ATAATACAAAAACCAAAAGGAGG - Exonic
1180094303 21:45548577-45548599 CTACTAAAAATACAAAAATGAGG + Intergenic
1180249207 21:46568515-46568537 GTCTTAAAAAAACAAAAAAGAGG + Exonic
1180392429 22:12297226-12297248 TTATTAAAAAAAAAAAAAGGGGG - Intergenic
1180421232 22:12816285-12816307 GTACTAAAAATACAAAAATTAGG - Intergenic
1182294614 22:29305753-29305775 CTACTAAAAATACAAAAAGCCGG + Intergenic
1182340205 22:29614275-29614297 CTACTAAAAATACAAAAAGTAGG + Intronic
1182403377 22:30101584-30101606 GTATTAAAAAAAAAAAAAGCTGG + Intronic
1182591268 22:31382177-31382199 GTCTTAAAAAAAAAAAAAGGGGG - Intergenic
1183286903 22:36972168-36972190 GTTCTGAAAATAATAAAAGGTGG + Intergenic
1183452408 22:37904350-37904372 GTACTAAAAATACAAAAAATTGG - Intergenic
1183819675 22:40335501-40335523 AAACAAAAAAAACTAAAGGGTGG + Exonic
1183838981 22:40481892-40481914 CTACTAAAAATACAAAAAGTTGG + Intronic
1184063954 22:42104958-42104980 GAACTATAAAAATTAAAAGGGGG - Intergenic
1185090393 22:48765419-48765441 TCACTAAAAAAATCAAAAGGTGG + Intronic
1185225781 22:49651327-49651349 GTTCTTAAAAAACTAAAATAAGG + Intronic
1185363199 22:50421744-50421766 CTACTAAAAATACAAAAAGGAGG + Intronic
949356635 3:3187801-3187823 ATTATAAAAAAATTAAAAGGAGG + Intergenic
949467410 3:4357988-4358010 GTTCAAAAAAAAGTAAAAGGTGG + Intronic
950337278 3:12206389-12206411 CTACTAAAAATACAAAAAGTAGG - Intergenic
951661186 3:25068445-25068467 AAACTAAGAAAACAAAAAGGGGG + Intergenic
951752490 3:26053239-26053261 GAATTAAAAAAAAAAAAAGGGGG - Intergenic
951841286 3:27036610-27036632 GCACTAAAAAAGATTAAAGGAGG - Intergenic
952378330 3:32785133-32785155 CTACTAAAAATACAAAAAGCCGG + Intergenic
952637543 3:35550060-35550082 GTTCTAAAAAAAAAAAAGGGGGG + Intergenic
952695576 3:36261824-36261846 CAACTAAAAAAACTAAATTGCGG + Intergenic
953339348 3:42120710-42120732 GTACTAAAAATACAAAAATTAGG - Intronic
953456933 3:43050177-43050199 CTACAAGAAATACTAAAAGGAGG - Intronic
953509528 3:43521868-43521890 GTACTAAAATAGCCAAAAGGTGG + Intronic
954013005 3:47659743-47659765 CTACTAAGAAAAAAAAAAGGGGG + Intronic
954032572 3:47830281-47830303 GTACTAAAAATACAAAAATTAGG + Intronic
954032698 3:47831115-47831137 GTATTAAAAAAAAAAAAAAGAGG + Intronic
954041960 3:47895018-47895040 GTCCAAAAAAAAAAAAAAGGGGG + Intronic
954171161 3:48803588-48803610 TTACTAAAAATACTAAAAATTGG - Intronic
954619997 3:51990152-51990174 CTACTAAAAATACAAAAAGCTGG - Intergenic
954742451 3:52764463-52764485 CTACTAAAAATACAAAAAAGTGG + Intronic
954918224 3:54166512-54166534 GTAAAATAAAAACAAAAAGGGGG - Intronic
955249065 3:57259721-57259743 TCACTAGAAAACCTAAAAGGAGG + Intronic
955366297 3:58313095-58313117 CTACTAAAAACACAAAAAGCCGG + Intronic
955378916 3:58421414-58421436 GTACTAAAAATACAAAAATTAGG + Intronic
955453557 3:59096497-59096519 GTAATATAAAAACAAAAAGAGGG - Intergenic
955601920 3:60654609-60654631 ATATTACAGAAACTAAAAGGTGG + Intronic
955806720 3:62744088-62744110 TTAGTAAAGAAGCTAAAAGGGGG - Intronic
956134316 3:66083902-66083924 ACACTAAAAAAACAAAAAAGGGG + Intergenic
956554595 3:70504735-70504757 GAACTAAAAAAAATAAATAGAGG - Intergenic
956616757 3:71180175-71180197 GAACAAGAAAAACAAAAAGGTGG - Intronic
956718191 3:72096668-72096690 TTAATTAAGAAACTAAAAGGAGG - Intergenic
956779868 3:72595401-72595423 GTACCAGAAAAAGGAAAAGGAGG + Intergenic
957704256 3:83759026-83759048 GAACTAAAACAAATAAAAGCTGG - Intergenic
957767752 3:84648178-84648200 TTATTTAAAAAAATAAAAGGAGG + Intergenic
957955147 3:87176907-87176929 GTTCTAATAAAAGAAAAAGGAGG - Intergenic
958008776 3:87848063-87848085 TTTCTCAAAAAACTAAAAAGAGG - Intergenic
958270003 3:91487773-91487795 TTAATAAAAAAATTAAAAGATGG + Intergenic
958813202 3:98886805-98886827 GTAAAAAAAAAAAAAAAAGGGGG - Intronic
959323969 3:104912368-104912390 CTACTAAAAATACAAAAAAGTGG - Intergenic
959871629 3:111335298-111335320 GGAATAAAAATACTAAAAGCAGG - Intronic
960264431 3:115604121-115604143 GTTTTCAAAAAACTAAAATGAGG + Intergenic
960311854 3:116126467-116126489 GTGCTCAAAAAACAAAAATGAGG - Intronic
960711854 3:120538221-120538243 CTACTAAAAATACAAAAATGAGG - Intergenic
960781670 3:121325995-121326017 CTACTAAAAAAAAAAAAAGTGGG + Intronic
961610072 3:128130089-128130111 AAAATAAAAAAACTAAAAGTTGG + Intronic
961853816 3:129849296-129849318 CTACTAAAAATACAAAAAGCTGG + Intronic
962102716 3:132359344-132359366 CTACTAAAAATACAAAAAGCCGG + Intronic
962450621 3:135513479-135513501 GTGTTATAAAACCTAAAAGGAGG + Intergenic
962584739 3:136830581-136830603 CTACTAAAAATACAAAAAGTAGG - Intronic
962798889 3:138872610-138872632 GTACTAAAAATACAAAAATTAGG - Intergenic
963408173 3:144895191-144895213 GTACTAAAGTAACTGAACGGTGG + Intergenic
963475387 3:145797498-145797520 GGATTACAAAAACAAAAAGGAGG - Intergenic
963876174 3:150477990-150478012 ATAATAAAATAACAAAAAGGGGG - Intergenic
963903121 3:150751668-150751690 TTAGTAAGAAAGCTAAAAGGTGG - Intronic
964019490 3:151991553-151991575 GTAGTAAAAAAAAAAAAAGATGG - Intergenic
964598299 3:158464426-158464448 GAAGTAAAAAAACTAACAGATGG - Intronic
964964872 3:162480049-162480071 CTACAAGAAAAACTAAAGGGAGG - Intergenic
965149093 3:164947123-164947145 CTACTAAAAATACAAAAAGCCGG + Intergenic
965731053 3:171773291-171773313 GTACTACTAAAACTAAAATGAGG + Intronic
966367955 3:179211503-179211525 CTACTAAAAATACAAAAAGCCGG + Intronic
966769007 3:183487221-183487243 GTAATCAAAAACCTAGAAGGGGG + Intergenic
967119042 3:186366282-186366304 TTTCTAAGAAAACTAAAATGAGG - Intergenic
967147268 3:186616804-186616826 CTACTAAAAATACAAAAATGTGG + Intronic
968326474 3:197821836-197821858 CTACTAAAAATACAAAAAGTAGG - Intronic
968339925 3:197946973-197946995 CTACTAAAAATACAAAATGGTGG - Intronic
968763336 4:2454299-2454321 CTACTAAAAATACAAAAAGTAGG - Intronic
969031826 4:4221778-4221800 CTACTAAAAATACAAAAAGCTGG - Intronic
969083591 4:4639008-4639030 CTACCAAAAAAAAAAAAAGGTGG + Intergenic
969308993 4:6341175-6341197 CTACTAAAAATACAAAAAGTCGG + Intronic
969616746 4:8257527-8257549 CTACTAAAAATACAAAAAGCAGG + Intergenic
970790248 4:19849832-19849854 AAAATAAAAAAATTAAAAGGTGG - Intergenic
972175770 4:36403883-36403905 GTAATAAAAAATTTAAAAAGTGG - Intergenic
972292489 4:37702824-37702846 CTACTAAAAATACAAAAAGTTGG + Intergenic
972363686 4:38352841-38352863 ATTCTAAAAAATCTAGAAGGAGG + Intergenic
972486074 4:39541758-39541780 GCGCTGAAAAAACAAAAAGGAGG - Intergenic
972587804 4:40454458-40454480 ATAATAAAAAAATTAAAAGGGGG - Intronic
973208048 4:47582604-47582626 GTACTGAAGAAACTGAAAGAGGG - Intronic
973334027 4:48937776-48937798 GTTCCAAAAAAACTAAGAGGTGG - Intergenic
973763924 4:54146616-54146638 CTACTAAAAATACAAAAAGCCGG - Intronic
973890065 4:55359759-55359781 GTACTAAAAATACCAGAGGGAGG - Intronic
974714180 4:65645213-65645235 GTCCCAGAAAAACTAAAATGAGG - Intronic
974927675 4:68321331-68321353 ATACTAAGAAAATTAAAAGCTGG + Intronic
975448509 4:74496904-74496926 GTATCAATAAAACTAAGAGGTGG - Intergenic
975682348 4:76889230-76889252 CTACTAAAAATACTAAAATTAGG + Intergenic
976184966 4:82434417-82434439 CTACTAAAAATACAAAAAGTAGG + Intronic
976720606 4:88165510-88165532 GTAATAACAATACTTAAAGGTGG - Intronic
976761442 4:88553700-88553722 GTACTAAAAATACAAAAATTAGG - Intronic
976761612 4:88555117-88555139 GTACTAAAAATACAAAAATTAGG + Intronic
977096769 4:92755645-92755667 GTATTAATGAAACAAAAAGGAGG + Intronic
977941123 4:102860679-102860701 GCACTAGAGAAAATAAAAGGAGG - Intronic
978695489 4:111572046-111572068 GTATTTAGAAAAATAAAAGGTGG - Intergenic
978963837 4:114717405-114717427 GTACTAAAAAAAATGAAAACAGG - Intergenic
978977444 4:114895591-114895613 GTTCTAAACAATTTAAAAGGAGG + Intronic
979231734 4:118354296-118354318 TTACTAAAAATACAAAAAGCCGG + Intergenic
979336470 4:119468955-119468977 GTGCTAAAATAGGTAAAAGGAGG - Intergenic
980344224 4:131591538-131591560 GTAGTGAAAAAACTAAATTGAGG - Intergenic
980382976 4:132049458-132049480 GAAATAAAAAAACAAAAAGAAGG + Intergenic
980517520 4:133882706-133882728 GTACTAAAACAATTTAATGGGGG - Intergenic
981080570 4:140635659-140635681 GTAGTGAAAAAGCTAAAAAGAGG + Intronic
982768144 4:159371179-159371201 TTCCTTAAAAAACTAAAAGTAGG + Intergenic
982941886 4:161569465-161569487 GTAGAAAAACAACTCAAAGGAGG + Intronic
983346557 4:166533817-166533839 GTAATAGAATAACTAAAGGGAGG - Intergenic
984035208 4:174659134-174659156 GTGCTGAAAACACAAAAAGGAGG + Exonic
984251257 4:177337852-177337874 CTACTAAAAACACAAAAATGAGG + Intronic
984706320 4:182849697-182849719 CTACTAAAAATACAAAAAGTAGG - Intergenic
985038368 4:185863847-185863869 GTACAAACAACACTAAAATGGGG - Intronic
985252160 4:188035124-188035146 CTACTAAAAACACAAAAAGCCGG - Intergenic
986255022 5:6095159-6095181 ATAATAAAAAAAATAAAGGGTGG - Intergenic
986897526 5:12387987-12388009 TTACTAAAATAAATAAAAAGTGG + Intergenic
987355271 5:17058213-17058235 GTACTAAAAACACAAAAATTAGG + Intergenic
987507252 5:18789700-18789722 GAACTAAAGAAAATAATAGGAGG + Intergenic
987697414 5:21349949-21349971 GTACTAAAAACACAAAAAATTGG + Intergenic
988228343 5:28443448-28443470 GTACTAAAAATACAAAAATCAGG - Intergenic
988585556 5:32504748-32504770 ATAATAAAATAGCTAAAAGGTGG - Intergenic
988698223 5:33645565-33645587 GAAGGAAAAAAAATAAAAGGGGG - Intronic
988706616 5:33732232-33732254 GTGCTAAAAAAAATAAATGTAGG + Intronic
988754824 5:34236738-34236760 GTACTAAAAACACAAAAAATTGG - Intergenic
988824945 5:34927007-34927029 TAACTAAAAAAAAAAAAAGGTGG - Intergenic
988955025 5:36307278-36307300 GTACTAATAAAATTAGAAGAAGG - Intergenic
989009737 5:36856452-36856474 GTACTAAAAATACAAAAATTAGG - Intergenic
989593316 5:43131805-43131827 GTACAAAAAAAAAAAAATGGGGG + Intronic
989630044 5:43472841-43472863 GTACTAAAAAAACAGAAGGCCGG + Intronic
990018788 5:51100240-51100262 GTATTCCAAAAAATAAAAGGGGG - Intergenic
990215995 5:53532302-53532324 CTACTAAAAACACAAAAAGCGGG + Intergenic
990628971 5:57646721-57646743 GAACCAAAAAAACAAAAAGTTGG - Intergenic
990795314 5:59533440-59533462 GTAATTAAAACACTAAAGGGTGG + Intronic
991381665 5:66034449-66034471 CTACTAAAAATACAAAAAGCTGG - Intronic
992335076 5:75758888-75758910 CTACTAAAAACACAAAAAGTAGG + Intergenic
992682086 5:79163525-79163547 CTACTAAAAATACAAAAAGCTGG - Intronic
992817694 5:80461804-80461826 CTACTAAAAATACAAAAAGTTGG + Intronic
993272474 5:85812960-85812982 GTACTAAAAATACAAAAATAAGG + Intergenic
994318976 5:98367503-98367525 GTATTAAAAAAAAAAAGAGGTGG + Intergenic
994931140 5:106187307-106187329 CTACTAAAAATACAAAAAAGTGG - Intergenic
994931162 5:106187441-106187463 CTACTAAAAATACCAAAAAGTGG - Intergenic
995034449 5:107517154-107517176 TTACTAAAAAAAAAAAAAGATGG + Intronic
995068901 5:107895014-107895036 TTGCTAACAAAAATAAAAGGAGG - Intronic
995222281 5:109663173-109663195 GTACTAGAAAAAAAAAAAGATGG - Intergenic
995275468 5:110273309-110273331 ATAAAAAAAAAAATAAAAGGAGG + Intergenic
995901013 5:117066492-117066514 CTACTAAAAATACAAAAAAGTGG + Intergenic
995962687 5:117862220-117862242 ATAATAAAAAACATAAAAGGAGG - Intergenic
996223124 5:120957090-120957112 GTATTAACTAAACAAAAAGGTGG - Intergenic
997003614 5:129792464-129792486 TTACTTAAAGAACTAAAAGTAGG - Intergenic
997119267 5:131157401-131157423 CTACTAAAAATACAAAATGGTGG + Intergenic
997386995 5:133481375-133481397 GTACTAAAAATACAAAAATTAGG + Intronic
997403838 5:133627018-133627040 GTACTGAAAGAAATGAAAGGAGG - Intergenic
997431771 5:133845689-133845711 CTACTAAAAATACAAAAAGCCGG - Intergenic
997707460 5:135970879-135970901 GTACTGAAAATACTGAAAGGAGG - Intergenic
997822027 5:137075001-137075023 GTACTAAAAATACAAAAATTAGG - Intronic
998098333 5:139410931-139410953 GTACTAAAAATACAAAAATTAGG - Exonic
998580549 5:143370343-143370365 GTCCTAAATAAACAAAAAGTAGG - Intronic
998974947 5:147635438-147635460 TTAATAAAAAGACTAAAAGTGGG + Intronic
998991104 5:147818112-147818134 ATACTTAAAAAACTAAGAGAAGG + Intergenic
999071432 5:148747762-148747784 GTGCTAAAAGAATTAAGAGGAGG + Intergenic
1000676689 5:164130364-164130386 GTAGTTGAAAAATTAAAAGGGGG - Intergenic
1000786840 5:165555419-165555441 CTACTAAAAACACTAAAATTAGG + Intergenic
1001846129 5:174923022-174923044 GTATTAAAAATACAAAAAAGGGG + Intergenic
1002276888 5:178109683-178109705 GTACTAAAAATACAAAAATTAGG - Intergenic
1002381951 5:178837321-178837343 CTACTAAAAATACAAAAAGTTGG + Intergenic
1003160638 6:3631084-3631106 CTACTAAAAATACAAAAAGCCGG - Intergenic
1003196769 6:3921564-3921586 CTACTAAAAATACAAAAATGAGG - Intergenic
1003995168 6:11532864-11532886 ACACTAAAAAAAAAAAAAGGTGG + Intergenic
1003997502 6:11557614-11557636 GCAGTAAAGAAACTAAAAGTAGG - Intronic
1004278949 6:14264177-14264199 CTACTACAAAAACTATATGGTGG + Intergenic
1004357361 6:14941564-14941586 CTACTAAAAAAACAAAAATGAGG + Intergenic
1004437332 6:15609164-15609186 GTATTAAAAAAAAAAAAAGAAGG - Intronic
1005143555 6:22662333-22662355 CTACTAAAAATACAAAAATGAGG - Intergenic
1005221553 6:23594074-23594096 GTACTAAAAACACGAAAAATTGG - Intergenic
1005271720 6:24172350-24172372 GTACCAAAAAAACTTAAAAATGG - Exonic
1005553447 6:26948453-26948475 GTACTAAAAACACAAAAAATTGG - Intergenic
1005647037 6:27849369-27849391 GTCTTAAAAAAAAAAAAAGGGGG + Intronic
1005892933 6:30154567-30154589 GTAATAATAACACTAACAGGAGG - Intronic
1006030717 6:31174824-31174846 CTACTAAAAATACCAAAAGGTGG + Intronic
1006104670 6:31709556-31709578 CTACTAAAAACACAAAAAAGAGG - Intronic
1006191193 6:32210633-32210655 GGGTTAAAAAAAATAAAAGGAGG + Intronic
1006754621 6:36404649-36404671 TTACTAAAAAAAAAAAAAGATGG + Intronic
1006857817 6:37147827-37147849 CTACTAAAAATACAAAAAGTAGG + Intergenic
1007008017 6:38385953-38385975 GTACTAAAAATACAAAAATTAGG - Intronic
1007049310 6:38810425-38810447 CTACTAAAAATACAAAAAGTAGG + Intronic
1007290400 6:40781576-40781598 GTAAAAAAAAAAAAAAAAGGCGG + Intergenic
1007543874 6:42675793-42675815 CTACTAAAAATACAAAAAGTCGG + Intronic
1007547040 6:42702238-42702260 GTCTTAAAAAAAAAAAAAGGCGG + Intronic
1007565799 6:42849384-42849406 GTAATATAAAAATGAAAAGGAGG - Intronic
1007569272 6:42877642-42877664 GTACCAATAATATTAAAAGGAGG - Intergenic
1007920653 6:45606639-45606661 CTATTGAAAAAATTAAAAGGAGG + Intronic
1008985157 6:57533569-57533591 TTAATAAAAAAATTAAAAGATGG - Intronic
1009173189 6:60426524-60426546 TTAATAAAAAAATTAAAAGATGG - Intergenic
1009322066 6:62303748-62303770 GTACTAGAAAAACTAACCAGTGG - Intergenic
1009377777 6:62993286-62993308 GTACAGAAAAAAATAAAAGATGG - Intergenic
1009533343 6:64849328-64849350 CTACTAAAATAAATAAAAGTAGG + Intronic
1009808216 6:68629553-68629575 ATAATTAAAAAAATAAAAGGAGG + Intergenic
1010200161 6:73275186-73275208 CTACTAAAAATACAAAAAGCTGG + Intronic
1010329211 6:74602581-74602603 GTACTATCAAAAAAAAAAGGGGG - Intergenic
1010551823 6:77232728-77232750 TTATTAGAAAAAATAAAAGGGGG - Intergenic
1011685687 6:89821615-89821637 CTACTAAAAATACAAAAAGCTGG + Intergenic
1011897026 6:92240964-92240986 GTTCTAAAAAGACTAATAGGAGG + Intergenic
1011987163 6:93462988-93463010 TTAATAAAAAATGTAAAAGGGGG - Intergenic
1012051490 6:94350752-94350774 GAACTAGAAAGACAAAAAGGAGG - Intergenic
1012149503 6:95729533-95729555 GTACTAAAAAGAATAAGAGTGGG - Intergenic
1012320692 6:97841246-97841268 GTACTAAAAAAAAAAAAAAAAGG - Intergenic
1012594143 6:101021570-101021592 CTACTTAAAATACTAAAAAGTGG + Intergenic
1013012512 6:106133344-106133366 ACATTAAAAAAACTAAAAAGAGG + Intergenic
1013128717 6:107210837-107210859 CTACTAAAAAAACAAAAATTGGG + Intronic
1014275292 6:119381198-119381220 TTCCTCAAAAAACTAAAAAGAGG - Intergenic
1015856077 6:137625857-137625879 GTAATAAAAAAAAAAAAAGGAGG + Intergenic
1016293434 6:142548784-142548806 GTATTAGAAAAAATAAAAGCAGG - Intergenic
1016558903 6:145372193-145372215 GTGGTAAGAAAATTAAAAGGTGG - Intergenic
1017107178 6:150898683-150898705 GTACTAAAGGAACCAAAATGAGG + Intronic
1017319995 6:153079825-153079847 GTATTTCAAAAAATAAAAGGAGG - Intronic
1017511108 6:155115166-155115188 GTACTAAAAAAAAAAAAAAAAGG + Intronic
1017864268 6:158429301-158429323 CTACTAAAAATACAAAAATGAGG - Intronic
1018418882 6:163624838-163624860 GTCTCAAAAAAACAAAAAGGCGG - Intergenic
1018444617 6:163843962-163843984 CTACTAAAAAAACAAAAATTAGG + Intergenic
1018537140 6:164833037-164833059 GTAAGAAAAAAACTAAGAAGTGG - Intergenic
1019182327 6:170197876-170197898 GTACAAAAACAATTAAATGGAGG + Intergenic
1019585242 7:1798143-1798165 ATACTAAAAACAATAAAATGTGG + Intergenic
1019781555 7:2943205-2943227 TTACTAAAAATAGAAAAAGGGGG + Intronic
1020229043 7:6303393-6303415 CTACTAAAAATACTAAAATTAGG + Intergenic
1020478902 7:8633264-8633286 CTACTAAAAATACAAAAAGCCGG + Intronic
1020789519 7:12609208-12609230 GTACTAAAGATACAGAAAGGAGG - Intronic
1020878611 7:13730014-13730036 CTACTAAAAATACAAAAAGTAGG + Intergenic
1020936885 7:14476914-14476936 CTACTAAAAATACAAAAATGAGG - Intronic
1021220725 7:17972612-17972634 CTACTAAAAATACAAAAAGTAGG + Intergenic
1021728806 7:23576562-23576584 TTACAAAAAAAACTAAAATTGGG - Intergenic
1022095135 7:27135646-27135668 GTACTAAAAAGACAAAAAACCGG + Intronic
1022362765 7:29678440-29678462 CTACTAAAAATACAAAAAAGTGG - Intergenic
1023473240 7:40548492-40548514 CTACTAAAAAAAGAAAAAGTTGG - Intronic
1023474662 7:40563738-40563760 GTATTAATAATAATAAAAGGGGG + Intronic
1023488392 7:40711343-40711365 GTACTAAAAATACAAAAATTAGG + Intronic
1023490752 7:40738033-40738055 CTACTAAAAATACAAAAAGCTGG + Intronic
1023509788 7:40939441-40939463 GTTCTCAAAGAACTAAAAGTAGG - Intergenic
1023974235 7:45015974-45015996 GTGCTAAAAATGATAAAAGGAGG - Intronic
1024225546 7:47323798-47323820 GGACTAAAAAAACTACAGGGAGG + Intronic
1024374835 7:48625099-48625121 TTCCTAAAAAAAATGAAAGGAGG + Intronic
1024425789 7:49225353-49225375 GTAAAAAATAAACTAGAAGGAGG - Intergenic
1025065524 7:55851840-55851862 CTACTAAAAATACAAAAAAGAGG + Intronic
1025230032 7:57197347-57197369 GTACTAGAATTATTAAAAGGAGG - Intergenic
1026278504 7:68901434-68901456 ATACTAAAAAAAAAAAAAAGAGG - Intergenic
1026472921 7:70709544-70709566 CTACTAAAAATACAAAAATGAGG + Intronic
1026722648 7:72845382-72845404 CTACTAAAAATACTAAAATTAGG - Intergenic
1026920274 7:74150417-74150439 GTACTAAAAATACAAAAAATTGG - Intergenic
1027258717 7:76448334-76448356 CTACTAAAAATACAAAAATGAGG + Intergenic
1027310103 7:76946576-76946598 CTACTAAAAATACAAAAATGAGG + Intergenic
1027841045 7:83312239-83312261 GTAATATAAAATCTAAAAGGAGG + Intergenic
1027960301 7:84938078-84938100 GTACATAAAAAAGTGAAAGGAGG + Intergenic
1027962545 7:84964918-84964940 GTCTTAAAAAAAAAAAAAGGGGG + Intergenic
1028017894 7:85738086-85738108 GAACTATAAAAATTAGAAGGGGG - Intergenic
1028120332 7:87050146-87050168 GCACAAAATAAACTAAAAGAGGG + Intronic
1028289959 7:89053247-89053269 GTACTATAAATACAACAAGGAGG - Intronic
1028339744 7:89704124-89704146 GTACTTCTAAAACTAAAAGTTGG - Intergenic
1028570784 7:92284545-92284567 GTTCTTAAAAGAATAAAAGGGGG + Intronic
1028920866 7:96308602-96308624 GTACTAGAAAAACGCACAGGTGG + Intronic
1029087872 7:98025381-98025403 CTACTAAAAATACAAAAAGCTGG + Intergenic
1029256070 7:99270481-99270503 CTACTAAAAATACAAAAAGCCGG - Intergenic
1029427766 7:100507435-100507457 CTACTAAAAATACAAAAAGTAGG - Intergenic
1029442959 7:100597692-100597714 GTAATAATAAAAATAAAAAGAGG - Intronic
1029446607 7:100616529-100616551 CTACAAAAAAAATAAAAAGGAGG + Intergenic
1029564742 7:101328841-101328863 GTACTAAAAATACAAAAATTAGG - Intergenic
1029731642 7:102442249-102442271 CTACTAAAAATATGAAAAGGAGG + Intronic
1029846147 7:103414186-103414208 GTCTTAAAAAAAAAAAAAGGGGG - Intronic
1029877177 7:103766556-103766578 GTGCTAAAAAATATAAAAGGAGG + Intronic
1030048196 7:105516107-105516129 CTACTAAAAATACTAAAATTAGG - Intronic
1030664503 7:112260283-112260305 GCACCAAAAAGATTAAAAGGAGG + Intronic
1030999371 7:116396971-116396993 TAAATGAAAAAACTAAAAGGTGG - Intronic
1031601622 7:123717086-123717108 GTAAAAAACAAACCAAAAGGGGG - Intronic
1031629576 7:124031694-124031716 CAAATAGAAAAACTAAAAGGTGG + Exonic
1032533461 7:132640770-132640792 CTACTGAAAAAAAAAAAAGGGGG + Intronic
1032724869 7:134581265-134581287 ATACTAAAAATACAAAAATGTGG - Intergenic
1032831452 7:135631438-135631460 GTAGTAAAGAAATTATAAGGGGG - Intronic
1033245362 7:139713084-139713106 GTACTATCACAACTAAACGGAGG + Intronic
1033559057 7:142513898-142513920 CTACTAAACATACTAAAATGAGG - Intergenic
1034014827 7:147570865-147570887 GTACTACAGAATCTAAAATGAGG - Intronic
1034236065 7:149570626-149570648 TTACTAAAAGAATTATAAGGAGG + Intergenic
1034612986 7:152389046-152389068 CTACTAAAAATACAAAAAGTTGG - Intronic
1035215302 7:157361928-157361950 CTACTAAAAATACAAAAAGCCGG - Intronic
1035296728 7:157871605-157871627 TTACAAAAAAAAATAAAAGGAGG - Intronic
1035445691 7:158941579-158941601 TTACGAAAAAAACAAAAAAGAGG + Intronic
1035974953 8:4299793-4299815 GTACTAAAAATACAAAAATTAGG - Intronic
1036107196 8:5853893-5853915 ATACTCAAAAAACGAAAAAGGGG - Intergenic
1036124574 8:6051329-6051351 CTACTAAAAATACAAAAAGCTGG - Intergenic
1036953131 8:13160280-13160302 AAAATAAAAAAATTAAAAGGCGG + Intronic
1037028170 8:14065732-14065754 GTAATTAAAATACTAAAAGTTGG + Intergenic
1037778709 8:21852758-21852780 GTACTAAAAATACAAAAATTAGG + Intergenic
1037798116 8:22013942-22013964 GTACTAAAAATACAAAAATTAGG + Intergenic
1038004805 8:23420733-23420755 ATATTGAAAAAACAAAAAGGGGG + Intronic
1038309579 8:26436003-26436025 TTACTAAAAATACAAAAAAGAGG - Intronic
1038811582 8:30851770-30851792 GTACTAAAAATACAAAAATTAGG + Intronic
1039128572 8:34233191-34233213 CTACTAAAAATACAAAAAGCCGG + Intergenic
1039462820 8:37760398-37760420 GTACTAAAAATACAAAAATTAGG + Intergenic
1039646029 8:39283936-39283958 GTACTAAAAATACAAAAATTAGG - Intronic
1039851743 8:41373467-41373489 GTATTAATAATACTAAAAGATGG + Intergenic
1040491612 8:47928479-47928501 GTCCTAAAAAAACTAATTAGAGG - Intronic
1040932898 8:52753676-52753698 AAACTAAAAAAATAAAAAGGGGG - Intergenic
1041242867 8:55863337-55863359 ATATTAAAAAAACAAAAAAGAGG + Intergenic
1041342562 8:56861350-56861372 GTGGAAAAATAACTAAAAGGGGG - Intergenic
1041481875 8:58331564-58331586 GTGCTAAAAGAAAAAAAAGGTGG + Intergenic
1041512064 8:58663320-58663342 GTACTAAAAATACAAAAAAGTGG + Intergenic
1041582033 8:59472023-59472045 GTACTAAAAATACAAAAATTAGG - Intergenic
1042790740 8:72602948-72602970 GCACTAAAAAAAAAAAAAGGCGG + Intronic
1042869874 8:73388737-73388759 GTACTAAAAATACAAAAATTAGG + Intergenic
1042981026 8:74528347-74528369 GTATCAACAAAACTAAGAGGTGG + Intergenic
1043053287 8:75407612-75407634 TTACTAAACAAACTGAAACGTGG - Intergenic
1043122069 8:76338782-76338804 GTATTAAAAAATCTAGATGGGGG - Intergenic
1043146514 8:76662195-76662217 TTATTAAAAAAATTTAAAGGGGG + Intergenic
1043803016 8:84635195-84635217 GTTCTACAAAAACAAAATGGAGG + Intronic
1043984770 8:86680886-86680908 CTCCTAAAACAACTAAAAGTTGG + Intronic
1044061826 8:87647840-87647862 GTACAAAAACAACTAAAAGTGGG - Intergenic
1044129052 8:88497461-88497483 GTCCTACAAAAACAAAAAGTAGG - Intergenic
1044155200 8:88837874-88837896 ATATTAAAAAAATAAAAAGGGGG + Intergenic
1044643269 8:94409083-94409105 GTGCTAAGAAAACTGAAAGCTGG - Intronic
1044654930 8:94537813-94537835 GTACTAAATAATCAAAAAAGGGG + Intronic
1045128772 8:99124718-99124740 CTACTAAAAATACAAAAAGCTGG + Intronic
1046518790 8:115298200-115298222 GTACTCAAAAAACTAAAAAAGGG - Intergenic
1046576286 8:116033839-116033861 GAACTAAAAAAAATTAAAGCAGG - Intergenic
1046593677 8:116235715-116235737 CTACTCATAAAACTTAAAGGAGG + Intergenic
1046906118 8:119574715-119574737 GTTTTAAAAAAACAAAAAAGAGG - Intronic
1047124967 8:121949644-121949666 CTACTAAAAATATTAAAAAGTGG - Intergenic
1047317861 8:123750924-123750946 AAACTAAAAAAAAGAAAAGGAGG - Intergenic
1047400489 8:124542214-124542236 CTACTAAAAATACAAAAATGAGG - Intronic
1047746762 8:127850852-127850874 CTACTAAAAATACAAAAAGTAGG + Intergenic
1048577996 8:135707901-135707923 GTACTAAAAATACAAAAATTAGG + Intergenic
1048730142 8:137430601-137430623 TTACTAGAAAAAATAAATGGAGG - Intergenic
1049081028 8:140443734-140443756 CTACTAAAAATACTAAAATTAGG + Intronic
1050071107 9:1815225-1815247 GAACTAAAAAAATGAAGAGGAGG + Intergenic
1050471199 9:5992712-5992734 GTGTTAAAAAAAAAAAAAGGGGG - Intronic
1050614933 9:7392044-7392066 GTAATAATATAACTAAAAGAAGG + Intergenic
1050892342 9:10839327-10839349 CTACTAAAAATACAAAAAGCGGG - Intergenic
1051429231 9:16964943-16964965 GAACTCACAAAACAAAAAGGAGG + Intergenic
1051545924 9:18274709-18274731 AAAATAAAAAAACTAAAATGAGG + Intergenic
1052297205 9:26910088-26910110 GTAATAAAAAAAATTAAAGGTGG - Intronic
1053785939 9:41653028-41653050 TTATTAAAAAATTTAAAAGGAGG - Intergenic
1053823603 9:41995567-41995589 CTACTAAAAATACAAAAAGCCGG + Intronic
1054159112 9:61661169-61661191 TTATTAAAAAATTTAAAAGGAGG + Exonic
1054174654 9:61866961-61866983 TTATTAAAAAATTTAAAAGGAGG - Intergenic
1054449511 9:65396021-65396043 TTATTAAAAAATTTAAAAGGAGG - Intergenic
1054478886 9:65592174-65592196 TTATTAAAAAATTTAAAAGGAGG + Intergenic
1054606970 9:67191799-67191821 CTACTAAAAATACAAAAAGCCGG - Intergenic
1054662884 9:67713832-67713854 TTATTAAAAAATTTAAAAGGAGG + Intergenic
1054858444 9:69925815-69925837 GGACTATAAAAATTAAGAGGGGG - Intergenic
1054908206 9:70429389-70429411 CTACTAAAAATACAAAAATGAGG + Intergenic
1054935435 9:70682781-70682803 GTACTATAATAACTCAAATGTGG - Intronic
1055059124 9:72050572-72050594 CTACTAAAAATACAAAAAGCCGG + Intergenic
1055806852 9:80105423-80105445 CTACTAAAAATACAAAAATGAGG + Intergenic
1055829723 9:80363832-80363854 GAAAAAAAAAAACTAAAAAGTGG - Intergenic
1056751356 9:89353709-89353731 GTCTTTAAAAAACAAAAAGGTGG + Intronic
1057656660 9:96959467-96959489 ATAGTAAAAAAATAAAAAGGGGG + Intronic
1057888043 9:98845966-98845988 GTACTCGAAAAACTAAAAATGGG - Exonic
1057993298 9:99795932-99795954 GTAGTAAAGAAACTGAAGGGAGG - Intergenic
1058061782 9:100505111-100505133 GGATTAAAAAAATTAAAAGCAGG + Intronic
1058231680 9:102434253-102434275 GTAATAAAACCACTAAAAGAAGG - Intergenic
1058344220 9:103941016-103941038 GTACAAAAACAATTAAAAAGTGG - Intergenic
1058434772 9:104952296-104952318 CTACTAAAAATACAAAAAGGAGG - Intergenic
1058898715 9:109422689-109422711 GTACAAAAAAAAAAAAAAGGAGG + Intronic
1060773286 9:126348166-126348188 TTTCTAACAAAACAAAAAGGAGG - Intronic
1061006803 9:127932864-127932886 CTACTAAAAATACAAAAATGGGG - Intergenic
1061045954 9:128165086-128165108 ATACTAAAAATACAAAAAGTTGG + Intergenic
1061600177 9:131664002-131664024 ATACCAAAAAAAGTAAAGGGTGG - Intronic
1061735892 9:132658532-132658554 GCAATAAATAAATTAAAAGGAGG + Intronic
1062304489 9:135896190-135896212 GTAGGTTAAAAACTAAAAGGAGG + Intronic
1062654670 9:137597154-137597176 CTACTAAAAAAACAAAAATTAGG + Intergenic
1185646612 X:1620330-1620352 CTACTAAAAATACAAAAAGTAGG - Intronic
1185686001 X:1928885-1928907 CGACTAAAAAAAAAAAAAGGAGG - Intergenic
1185770631 X:2763176-2763198 CTACTAAAAATACAAAAATGTGG - Intronic
1185816480 X:3160814-3160836 GGACTAAAATAATTCAAAGGAGG - Intergenic
1186276551 X:7945242-7945264 TTTCTAAAAAAACTAAAATTTGG - Intergenic
1187107705 X:16261136-16261158 GTACTACAAAAGCAAAAAGTGGG + Intergenic
1187201771 X:17140934-17140956 CTACTAAAAATACAAAAAGTTGG - Intronic
1187280355 X:17853968-17853990 GTTTTAAAAAAACTAAAACAAGG + Intronic
1187361990 X:18637091-18637113 GTACTAAAAATACAAAAATTAGG + Intronic
1187367574 X:18677201-18677223 CTACTAAAAATACAAAAAGTAGG - Intronic
1187650295 X:21395105-21395127 GTAATAAGAAAATTAAAAGCTGG - Intronic
1187658779 X:21513765-21513787 CTATTTAAAACACTAAAAGGTGG - Intronic
1188085640 X:25898451-25898473 GTACTCAGAAAACAAAAAAGGGG + Intergenic
1188739144 X:33755807-33755829 ATAATAAAAAAAATAAAAAGTGG - Intergenic
1189392101 X:40584907-40584929 CTACTAAAAATACAAAAATGAGG - Intronic
1189461055 X:41243455-41243477 GTTCAAAAAAAAAAAAAAGGAGG + Intergenic
1189505203 X:41606416-41606438 CTACTAAAAATACAAAAATGTGG - Intronic
1189823701 X:44895417-44895439 GTTCTTAAAAAAATAAAAGTTGG - Intronic
1190018653 X:46851763-46851785 GTACTAAAAATACAAAAACAGGG + Intronic
1190309294 X:49105345-49105367 GTACTAAAATAACAAAAATCGGG + Intergenic
1190998906 X:55638189-55638211 TTAGTAAAAAAAAAAAAAGGGGG + Intergenic
1191078023 X:56476589-56476611 ATACTAAGCAAACTAAAATGTGG - Intergenic
1192069996 X:67928681-67928703 TTCCTTAAAAAACTAAAAGCAGG + Intergenic
1192447111 X:71219423-71219445 TTAAAAAAAAAATTAAAAGGAGG - Intronic
1192473553 X:71420064-71420086 TTACTAAAAAAAGTATGAGGAGG - Intronic
1193216875 X:78874810-78874832 CTACTAAAAATACAAAAAGCTGG + Intergenic
1193581038 X:83262794-83262816 GTCCTTAAAGACCTAAAAGGAGG + Intergenic
1193632416 X:83906355-83906377 GTCCTAAATAAAAGAAAAGGTGG - Intergenic
1193645144 X:84058993-84059015 GTACAAAAAAAAGGAGAAGGTGG - Intronic
1193854978 X:86589226-86589248 GTATTCAAAAAACCAAAAGTTGG - Intronic
1193979402 X:88162753-88162775 GTAAAAAAAAAAAAAAAAGGCGG - Intergenic
1193992432 X:88324364-88324386 TTACTCAAAGAACTAAAAGTAGG - Intergenic
1194029875 X:88799594-88799616 GTACAAAAATAACTAATAGATGG + Intergenic
1194047688 X:89029420-89029442 CTATTAATAAAATTAAAAGGTGG - Intergenic
1194297070 X:92139426-92139448 CTACTAAAAATACAAAAATGTGG - Intronic
1194599313 X:95900808-95900830 GTACGAAAAAAACTAACAAGTGG - Intergenic
1194700063 X:97103194-97103216 GTAATAAAATAACTAACAGAAGG - Intronic
1195038422 X:100991538-100991560 CTACTAAAAATACAAAAAGCTGG - Intergenic
1195128412 X:101831338-101831360 GTACATAAAAAACTGAAAAGTGG + Intergenic
1196297112 X:114010948-114010970 GTCTCAAAAAAACAAAAAGGAGG - Intergenic
1196306264 X:114106871-114106893 TCACTAAAGAAATTAAAAGGTGG - Intergenic
1196782418 X:119395519-119395541 GTACTAAAAATACAAAAATTAGG + Intergenic
1196892105 X:120301020-120301042 GTTTTAAAAAAACTAAAACCAGG - Intronic
1197150576 X:123216319-123216341 GCACAAAAAATGCTAAAAGGAGG - Intronic
1197223911 X:123937831-123937853 CTACTAAAAATACAAAAATGTGG + Intergenic
1197831720 X:130650099-130650121 GTACAAGAAGAAATAAAAGGAGG - Intronic
1197930568 X:131690661-131690683 CTACTAAAAATACTAAAATTAGG + Intergenic
1198324819 X:135558945-135558967 CTACTAAAAATACAAAAAGCTGG - Intronic
1198331500 X:135627036-135627058 GTATTAAAAAACCTGAAAGGTGG + Intergenic
1198364186 X:135924359-135924381 GTATTTAAAAACCCAAAAGGAGG + Intergenic
1198368362 X:135966625-135966647 GTACATAATGAACTAAAAGGGGG + Intronic
1198621775 X:138520413-138520435 GTACTACCAAGACGAAAAGGAGG - Intergenic
1198859455 X:141054198-141054220 TTTCTCAAAAAACTAAAATGAGG - Intergenic
1198903240 X:141533193-141533215 TTTCTCAAAAAACTAAAATGAGG + Intergenic
1198920518 X:141720696-141720718 CTACTAAAAATACAAAAAAGTGG + Intergenic
1198967328 X:142241286-142241308 GTACTAAAAAAAATCAAAACAGG - Intergenic
1200394826 X:155978218-155978240 GTCTTAAAAAAATTAAAAGAGGG - Intergenic
1200514174 Y:4122145-4122167 TTACTATAAGAACTAAAAGAGGG + Intergenic
1200614584 Y:5364005-5364027 CTACTAAAAATACAAAAATGTGG - Intronic
1201372872 Y:13284256-13284278 TTAGTAAAAAGATTAAAAGGAGG + Intronic
1202086637 Y:21144432-21144454 GTATTAACTAAACTAAAAGGAGG + Intergenic
1202142878 Y:21746580-21746602 GTGCTCAAAAAACAAAAAAGAGG + Intergenic
1202143980 Y:21759038-21759060 GTGCTCAAAAAACAAAAAAGAGG - Intergenic
1202167351 Y:22004088-22004110 GTACTAGAAGAACCCAAAGGTGG + Intergenic
1202224009 Y:22582281-22582303 GTACTAGAAGAACCCAAAGGTGG - Intergenic
1202242163 Y:22781797-22781819 GTAAGAAAGAAACTAACAGGGGG - Intergenic
1202319106 Y:23613380-23613402 GTACTAGAAGAACCCAAAGGTGG + Intergenic
1202395148 Y:24415541-24415563 GTAAGAAAGAAACTAACAGGGGG - Intergenic
1202475637 Y:25254551-25254573 GTAAGAAAGAAACTAACAGGGGG + Intergenic
1202551663 Y:26056677-26056699 GTACTAGAAGAACCCAAAGGTGG - Intergenic