ID: 1107965851

View in Genome Browser
Species Human (GRCh38)
Location 13:45597618-45597640
Sequence CCTGGTGAGCTGAGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 1, 2: 5, 3: 45, 4: 467}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107965851_1107965857 27 Left 1107965851 13:45597618-45597640 CCATCTGCCCTCAGCTCACCAGG 0: 1
1: 1
2: 5
3: 45
4: 467
Right 1107965857 13:45597668-45597690 GCATCTTGACTCCTCCAGGAAGG 0: 1
1: 0
2: 2
3: 13
4: 177
1107965851_1107965856 23 Left 1107965851 13:45597618-45597640 CCATCTGCCCTCAGCTCACCAGG 0: 1
1: 1
2: 5
3: 45
4: 467
Right 1107965856 13:45597664-45597686 CTGAGCATCTTGACTCCTCCAGG 0: 1
1: 0
2: 2
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107965851 Original CRISPR CCTGGTGAGCTGAGGGCAGA TGG (reversed) Intronic
900603172 1:3511855-3511877 CTTGGTGAGCAGAGGGTCGAGGG - Intronic
900907101 1:5566988-5567010 CCTGCAGGGCTGAGGGCCGAGGG + Intergenic
901128879 1:6949828-6949850 CCTGGCGTGCCGAGGGCAGAAGG - Intronic
901182725 1:7352647-7352669 CCTGCTGGGCTGAGGCCAGGAGG - Intronic
901645877 1:10716462-10716484 CATGGGGAGCAGTGGGCAGAGGG + Intronic
901754728 1:11434661-11434683 CCTGGGGAGCTGGGTGCAGCTGG - Intergenic
901927953 1:12578948-12578970 CTTGGTGGTCTGAGGGCAGATGG + Exonic
902036698 1:13463161-13463183 CCGGGTGTCCTGAAGGCAGAGGG + Intergenic
902278741 1:15359078-15359100 CCTGGGGACCTGATGGCATAGGG + Intronic
902301175 1:15503809-15503831 CGTGGAGAGCCTAGGGCAGAGGG + Intronic
902607413 1:17576330-17576352 GCTGGGCAGCTGAGGGCAGAGGG + Intronic
902614349 1:17615794-17615816 CCTGGTGAGGAGGGGGCCGAGGG - Intronic
903287999 1:22288969-22288991 CTTGGTGAGCAGAGCACAGAAGG + Intergenic
903860379 1:26361001-26361023 CCTGGGGAGCTGAGGCCTGATGG - Intergenic
903883632 1:26529335-26529357 CCTGGTGAGTTGAGGGCCTAAGG + Intergenic
903996310 1:27307314-27307336 CCTGCTGCTCTGAGGGGAGAGGG + Exonic
904058199 1:27686130-27686152 CCAGGGGAGCTGAGGGCAGGAGG + Intergenic
904450065 1:30605331-30605353 TGGGGTGAGCGGAGGGCAGAGGG + Intergenic
904498386 1:30900582-30900604 CCTGGAGAGCTGGGGGGAGGTGG - Intronic
905125844 1:35715874-35715896 CCTGGGCCACTGAGGGCAGAAGG + Exonic
905478831 1:38247488-38247510 GCTGGTGACCGGAGGCCAGAGGG - Intergenic
905479186 1:38249571-38249593 CCTGGAGAGCTGAGGACTGAAGG - Intergenic
905643662 1:39609732-39609754 CCTGGAGGGCTCAGAGCAGAAGG + Intergenic
906104295 1:43282810-43282832 ACTGGCGAGCTGGGGACAGAGGG - Exonic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
906254465 1:44337432-44337454 TCTGGTGTGGTGAGGGCAGCTGG - Intronic
906606538 1:47176382-47176404 CTTGATGAGCTGAGGGCAGGTGG + Intergenic
908128048 1:61050226-61050248 CCTGGAGAGGGGAGGGCAGGGGG - Intronic
909538083 1:76760625-76760647 CCTGGGGAGCAGAGGGAAGTGGG + Intergenic
909677046 1:78250352-78250374 CCTGGCAAGCTACGGGCAGATGG - Intergenic
909927783 1:81458872-81458894 CTTGCTGAGCTGTGGGCAGTGGG - Intronic
910337911 1:86155334-86155356 CCGTGTCAGCTGAGGGCAGGCGG - Intronic
910436300 1:87209331-87209353 CCTGGTCAGTTCAGGGCTGAAGG - Intergenic
911655028 1:100434351-100434373 ACTGGGGAGCTCAGGGAAGATGG + Intronic
912520596 1:110242161-110242183 CCTGGAGAGTTGAGGGGAAATGG - Intronic
915156008 1:153876925-153876947 CCTGGTGAGGGGAGGGCGGCGGG + Intronic
915213724 1:154327169-154327191 CCTGGTAGGCTAAAGGCAGAGGG + Intronic
915283407 1:154837923-154837945 CCAGGTGTGCTGAGGTCAGCGGG + Intronic
915569887 1:156738754-156738776 CCTTGTCAGCTCTGGGCAGATGG + Exonic
915572155 1:156750683-156750705 TCTGTGGAGCTGAGGGCTGATGG + Intronic
915651204 1:157312140-157312162 TCTGGAGAGCTGTGGGCATAGGG - Intergenic
916140293 1:161691498-161691520 CATGGTGAGCTGAGAGTTGAAGG + Intergenic
918215974 1:182392032-182392054 CCGGGAGGGCTGAGGGCAGAGGG + Exonic
919464526 1:197913083-197913105 TCTGCAGAGCTGAGGGCAGGCGG + Intronic
919589317 1:199480631-199480653 CCTGACTAGCTGAGGGCAAAGGG - Intergenic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
919694895 1:200564318-200564340 CCTGCTGTGCTGAGCTCAGATGG + Intronic
920299587 1:204980384-204980406 CCTGGTGACGTGAAGGGAGAGGG + Exonic
920584941 1:207149433-207149455 CCTAGTGTTCTGAGGTCAGATGG - Intergenic
922758092 1:228107785-228107807 CCTGGCGAGCTGACAGCAGCAGG - Exonic
922813061 1:228428912-228428934 CCCGATGAGCAGAGGGCAGCAGG - Intergenic
923065766 1:230515924-230515946 CCTGGTCTGCTGAAGGCAGCAGG - Intergenic
923991659 1:239444509-239444531 CCTGGTGAGCTGGGACCTGAGGG + Intronic
924043668 1:240007996-240008018 GCTGATGAGCTGTGAGCAGAAGG + Intergenic
1063614929 10:7593155-7593177 GCTGCTGAGCTGAGGGAAGGAGG - Intronic
1064104755 10:12491571-12491593 CCTGTTGAGCTGCAGGCAGTGGG + Intronic
1064213540 10:13380966-13380988 CCAGGTGTGGTGGGGGCAGAAGG + Intergenic
1064728829 10:18308456-18308478 CCTGGAGAGCGGAGGGCGGGAGG - Intronic
1069755926 10:70774468-70774490 CGAGGGGACCTGAGGGCAGAAGG - Intronic
1069987498 10:72294373-72294395 CCTGGTGTCCTGGGGACAGAGGG - Intergenic
1070149451 10:73797011-73797033 CCTGGTGAGGTGGGGGCACTGGG + Exonic
1070159697 10:73858709-73858731 CATTCTGAGCCGAGGGCAGATGG + Intronic
1071488993 10:86123251-86123273 CCTAGGGAACAGAGGGCAGAGGG + Intronic
1071524226 10:86348945-86348967 CCTGGTGAGCAGGGGCTAGAAGG - Intronic
1072545167 10:96431790-96431812 GCTGGTGGGGGGAGGGCAGAAGG + Intronic
1073098185 10:100993168-100993190 CCTGGGGAACAGGGGGCAGAAGG - Exonic
1073265768 10:102227604-102227626 CCTGGCAAGCAGAAGGCAGAGGG - Exonic
1073544677 10:104338207-104338229 CCTAGTGTGCTGAAGGAAGAAGG - Intronic
1074689331 10:115990301-115990323 CTTTCTGAGCAGAGGGCAGAGGG + Intergenic
1075707729 10:124511850-124511872 CCTGGTGAGTGGTGGGGAGATGG + Intronic
1075831636 10:125417079-125417101 CCTGATGAGCTGACGGGAGATGG - Intergenic
1076583613 10:131531339-131531361 CATGCTGAGCTGAGGGAGGAGGG + Intergenic
1076819913 10:132933133-132933155 CCTGGGTAGCTGTGGGCAGGAGG + Intronic
1076912648 10:133399417-133399439 CCAGGTCAGCTCAGGGAAGAAGG - Intronic
1077108795 11:853181-853203 CCAGGCAAGCTGGGGGCAGAGGG - Intronic
1077365823 11:2161199-2161221 CCTGGAGGGCTGAGGGCTGCTGG + Exonic
1077419046 11:2440994-2441016 CCTGGTGAGCTGAGGGATGTCGG + Intergenic
1078134057 11:8637779-8637801 ACTGGAGAGCTGAGGGCACCAGG + Intronic
1079483891 11:20913618-20913640 CATGGTGAGCTGACAGCAGGAGG + Intronic
1080428651 11:32178738-32178760 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1080691972 11:34565877-34565899 CCTGGTGGGCACAGGGAAGAGGG + Intergenic
1080774775 11:35375517-35375539 GCTGGTGAGCTGAGCACAGCAGG + Intronic
1081649696 11:44815529-44815551 TCTGGGGAGTTGAGGGCTGATGG + Intronic
1081666371 11:44919200-44919222 TCGGGTGAGCTGGGGGCAGAGGG - Exonic
1081835406 11:46149479-46149501 CCTGGGGAGCTGTGTGAAGAAGG + Intergenic
1083614107 11:64018058-64018080 GGGGGTGAGCTGGGGGCAGAGGG + Intronic
1083776887 11:64898354-64898376 GATGGTGAGCTGGGAGCAGAGGG + Exonic
1084421073 11:69060866-69060888 CCGGGTGAGCTGGGCGCACAGGG + Intronic
1084715309 11:70869894-70869916 CCTGGGGAGCTTCAGGCAGAGGG - Intronic
1085076204 11:73594961-73594983 CTTGGTGAGAAGAGAGCAGATGG - Intronic
1085179497 11:74521585-74521607 CATGGGGAGCTGAGGTCACAAGG + Intronic
1085311263 11:75518296-75518318 CCTGGAGAGATGAGGGGAGTGGG - Intronic
1089085125 11:115810540-115810562 CCTGCTTAGGTGAGAGCAGAGGG - Intergenic
1089762539 11:120738850-120738872 CCTGGTGAGATGGGGGAGGAGGG + Intronic
1090548489 11:127792301-127792323 CCCGCTGAGCAGAGGGCTGAAGG - Intergenic
1090759165 11:129820609-129820631 CCAGGTCATCTGAGGGCAGGTGG + Intronic
1091408152 12:221589-221611 GCGGGGGAGCTGAGGGCACAAGG - Intronic
1091651333 12:2312455-2312477 TGTGTTGATCTGAGGGCAGAAGG - Intronic
1091791350 12:3273883-3273905 GCTGGTGAGCTGGGGACAGCCGG - Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1095417275 12:41990579-41990601 CCTGGGAGGCTGAGGCCAGAGGG - Intergenic
1095952467 12:47789385-47789407 CCTGGGGAGGTGAGGGCATGTGG - Intronic
1096251060 12:50032956-50032978 CCTGGGGAGGTGAGGGCCGGTGG - Intronic
1096596564 12:52699632-52699654 CCTGGGGTGCTGAGGGCACTGGG - Intronic
1097329171 12:58314609-58314631 CAGGGGGAGCTGAGGCCAGAGGG - Intergenic
1098540900 12:71656106-71656128 CCAGGTGAACTAAGGGCTGAGGG + Intronic
1100032412 12:90209289-90209311 CCTAGTGAGCTGTGGGAAGAGGG + Intergenic
1101811479 12:108111741-108111763 GCTGGTGGGCTCAGGGGAGAAGG - Intergenic
1102116903 12:110409749-110409771 CCTGGGGAGGAGAGGTCAGATGG + Intergenic
1102465398 12:113127998-113128020 CCTGGGCACCTGAGGGGAGAGGG - Intronic
1103402140 12:120650311-120650333 CCTGGAGAGCTGATGGCAGAGGG - Intronic
1103848520 12:123916114-123916136 CCTGGCAGGCTGAGGGAAGAGGG - Intronic
1103904745 12:124321493-124321515 CCTGGGAAGGTCAGGGCAGAAGG + Intergenic
1103937122 12:124482662-124482684 CTGGGTCACCTGAGGGCAGATGG + Intronic
1104053104 12:125209458-125209480 CCTGGTCACCTCAGGGGAGAAGG + Intronic
1104679468 12:130739605-130739627 ACTGCTGGCCTGAGGGCAGAGGG - Intergenic
1104974999 12:132548349-132548371 CCTGGGCAGCAGAGGGCAGCTGG + Intronic
1105284940 13:18996008-18996030 CCAGATGAGCGGAAGGCAGAAGG + Intergenic
1106028208 13:25974926-25974948 GGTGGTGGGCTGAGGGCAGAAGG - Intronic
1106583062 13:31034125-31034147 CCTGGTGTTTAGAGGGCAGAAGG - Intergenic
1107475579 13:40732623-40732645 CCTGGAACGCTGGGGGCAGAAGG + Intronic
1107873289 13:44766215-44766237 CCTGGTGAGAGGAGGGGAAAGGG + Intergenic
1107965851 13:45597618-45597640 CCTGGTGAGCTGAGGGCAGATGG - Intronic
1110465166 13:75792074-75792096 CTTGGGAGGCTGAGGGCAGAAGG - Intronic
1113051272 13:106214558-106214580 ACTGATGAGCTGAGAGAAGAAGG + Intergenic
1113739663 13:112702486-112702508 CCTGGCCATCTGAGGGCAGAGGG - Intronic
1113790951 13:113027868-113027890 CCAGGTGTGCTGTGGCCAGAGGG + Intronic
1116398680 14:44478220-44478242 CCTGATGAGCTAACAGCAGAAGG + Intergenic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118990476 14:70792848-70792870 CCTGCTGAGCTGAGGCCAATGGG + Intronic
1119423983 14:74524216-74524238 CCTGCTGAGCAGAGGCCAGAAGG + Intronic
1119595440 14:75928694-75928716 CCTGGTGATCGCAGGGCACAAGG + Intronic
1119901001 14:78259721-78259743 CCTAGAGAGTTGAAGGCAGAAGG - Intronic
1120163488 14:81170090-81170112 ACTGGTAAGTTGAGGTCAGATGG - Intergenic
1120387353 14:83863154-83863176 CCTGGAGAGATTAGGGCAAAAGG + Intergenic
1120875921 14:89375854-89375876 TCTGGGGGGCTGGGGGCAGAGGG - Intronic
1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG + Intergenic
1121611781 14:95285906-95285928 CCTGGAGTGCTGAGTGCAGAAGG - Intronic
1121660672 14:95632773-95632795 GCTGTAGAGCAGAGGGCAGAAGG + Intergenic
1122060456 14:99133634-99133656 ACTGGAGCGCTGAGTGCAGAGGG - Intergenic
1122406952 14:101506366-101506388 CCAGCTGAGCTCAGGTCAGAGGG + Intergenic
1122536283 14:102465809-102465831 CCTTGTGAGCTGAGTGCTGGAGG - Intronic
1122637215 14:103135792-103135814 CCTGGGCTGCAGAGGGCAGATGG - Exonic
1123024787 14:105419616-105419638 CCTGGTGCCCTGGGGGTAGAGGG - Intronic
1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1124130809 15:26983967-26983989 CATGGTGAGCTCAGCACAGACGG - Intronic
1124609485 15:31198489-31198511 CATGGTGAGCTGAAGGGACAAGG - Intergenic
1124955348 15:34356586-34356608 CCCAGTGATCTGTGGGCAGAAGG + Exonic
1125112646 15:36051179-36051201 CCTTGAGAGCTGAAGGGAGAAGG + Intergenic
1126996360 15:54449759-54449781 ACTGATGAGCTGAGAGAAGAAGG - Intronic
1127122897 15:55786619-55786641 CCTGGGGAGCTGGCGCCAGAAGG - Intergenic
1127638476 15:60893365-60893387 CCTGGTTTTCTGAGGGAAGAGGG + Intronic
1127664601 15:61133501-61133523 CCCGGAGAGTTGAGGGCTGATGG + Intronic
1128312576 15:66640537-66640559 GTTGGAGAGCTGAGAGCAGAAGG - Intronic
1128548849 15:68584809-68584831 CCTGGGGAGCTTGGGGCAGCTGG + Intronic
1129248595 15:74295591-74295613 CCCGGTGAGCAAGGGGCAGATGG + Intronic
1129884989 15:79031501-79031523 CCTGGGGATCTGCGGGCAGGTGG + Exonic
1129920646 15:79316535-79316557 CCTGATGAGGTGAGGGCTGCAGG + Intronic
1130727318 15:86452736-86452758 CGTGAGGAGATGAGGGCAGAAGG - Intronic
1131354283 15:91731034-91731056 GCTGTTGTGCTGAGGACAGAAGG + Intergenic
1131642531 15:94307763-94307785 GCTGATGGGCTGTGGGCAGAGGG + Intronic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1132567714 16:630939-630961 CCTGGTCAGCACAGGGCAGAGGG - Exonic
1132762800 16:1519103-1519125 TCTGCTGAGCTGAGGCCACAGGG - Intronic
1132923333 16:2411918-2411940 GTGGGGGAGCTGAGGGCAGAGGG - Intergenic
1133042546 16:3068158-3068180 CCTGGGGAGAGGAGGGCACAGGG - Exonic
1133111001 16:3548383-3548405 CCTGGTTAGCCGTGGCCAGAGGG + Intronic
1134131641 16:11654357-11654379 CCAGGGGAGCAGTGGGCAGATGG - Intergenic
1134537817 16:15040748-15040770 CCTGGGGTGCTGGGGGGAGAGGG + Intronic
1134889136 16:17823257-17823279 CCTGGTGAGCTAATGGAAGAGGG + Intergenic
1135032034 16:19046148-19046170 CCTTTTGTGCTGATGGCAGAAGG - Intronic
1136317899 16:29465057-29465079 CCTGGGGAGCTGAAGGCTGGGGG - Exonic
1136417570 16:30113157-30113179 GCTGGGGAGGTGAGGCCAGAGGG - Intronic
1136432474 16:30204406-30204428 CCTGGGGAGCTGAAGGCTGGGGG - Exonic
1137614184 16:49837180-49837202 CCTGGCGAGCTGAGGCCTGGGGG + Intronic
1138542878 16:57699065-57699087 GCTGGAGAGCAGAGGGCACAGGG + Intronic
1139601796 16:67991819-67991841 CCTGGTGAGCCTAGTGCAGATGG - Exonic
1139704850 16:68734226-68734248 CCTGGTGGGTTAAGAGCAGAGGG + Intergenic
1139949095 16:70660582-70660604 ACTGGGGAGCTGGGGGCAGAGGG + Exonic
1139950117 16:70664490-70664512 CCTGGTGGGCTGGGGGCAAGGGG - Intronic
1140562905 16:76004688-76004710 CTTGGTGAGCTGAGGGCACAAGG + Intergenic
1141362158 16:83405958-83405980 CCAGGTGGGCTGAGGGCATGTGG - Intronic
1141799710 16:86298490-86298512 CCTGGTGAGGAAAGGGCAGATGG - Intergenic
1141807276 16:86350052-86350074 CCTGGTTGGCTGAGGAGAGAGGG - Intergenic
1141889979 16:86919931-86919953 ACAGGTGAGCTGTGGGCTGATGG + Intergenic
1142176501 16:88647810-88647832 CCTGGTGAGTGGTGGGCAGGGGG - Intronic
1142499557 17:324530-324552 ACTGGTGAGCTGAGAGACGAGGG - Intronic
1142644829 17:1304917-1304939 CCTGGTGTGCTGAGGGTAGTTGG + Intergenic
1143823399 17:9584101-9584123 CCTGGTAAGAACAGGGCAGATGG - Intronic
1144399907 17:14886309-14886331 CCTGCTGACCTGAGTGCATAGGG - Intergenic
1144623254 17:16831667-16831689 CATGGTGGGCTGGGGGCAGAGGG - Intergenic
1144883177 17:18441049-18441071 CATGGTGGGCTGGGGGCAGAGGG + Intergenic
1145149053 17:20503337-20503359 CATGGTGGGCTGGGGGCAGAGGG - Intergenic
1145745987 17:27320035-27320057 CCTCCTGATCTGAGGCCAGATGG - Intergenic
1146912159 17:36655706-36655728 CCTGGTGGGGTGGGGGCAGCTGG + Intergenic
1147202537 17:38812709-38812731 CCTGGTAAGCTGAGAGTAAATGG + Intronic
1147577577 17:41611604-41611626 CATGGTGGGCTGGGGGCAGAGGG - Intronic
1147658811 17:42106048-42106070 CTTGGGAGGCTGAGGGCAGAAGG + Intronic
1147959144 17:44155491-44155513 CCTGGGGAGCAGAGGTCTGAAGG + Intronic
1148043967 17:44731012-44731034 CCAGGTGAGCTGGGGCAAGATGG + Exonic
1148088669 17:45009622-45009644 CATGGTGAGGGGTGGGCAGAGGG - Intergenic
1148107041 17:45124337-45124359 CCTGGGGAGCTGAGGGTAAGGGG - Intronic
1148128649 17:45249349-45249371 CCTGGAAGGCTGAGGGTAGAGGG + Intergenic
1148464014 17:47853746-47853768 GCTGATGAGCTGCAGGCAGATGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151177679 17:72302099-72302121 CTTGGTGGGCTGAGGGCCAAGGG - Intergenic
1151367499 17:73626868-73626890 CCTGCTGTGCTGAGGACAGAGGG + Intronic
1151460728 17:74252641-74252663 CCTGGTGAGAAGAGAGGAGAAGG - Intronic
1151764096 17:76123141-76123163 CCTGGGCCCCTGAGGGCAGAGGG + Intergenic
1152322021 17:79613018-79613040 CATGGGGAGCTGAAGGGAGACGG - Intergenic
1152398489 17:80049654-80049676 GATGGTGAGCTGGGGCCAGAGGG - Intronic
1152465035 17:80461559-80461581 ACTGGGGAGCTGGGAGCAGAGGG + Intergenic
1152578055 17:81151554-81151576 CCTGGGAGGCTGGGGGCAGATGG - Intronic
1152708661 17:81859312-81859334 GCTGGGAAGCTGAAGGCAGAAGG - Exonic
1152744045 17:82031212-82031234 CCTGCAGGGCTGGGGGCAGAGGG - Intergenic
1154194990 18:12258946-12258968 CCTGGTGACCCGGGGGGAGAGGG - Intronic
1157423439 18:47564921-47564943 CCTGATGGGCAGAGGACAGAGGG + Intergenic
1157558941 18:48632646-48632668 CGTGGCCAGCTTAGGGCAGATGG - Intronic
1160048545 18:75409794-75409816 CCTGAGGACCTGAGTGCAGATGG - Exonic
1160904980 19:1447737-1447759 CCTGGAGGGCTGAGGGTACATGG - Intronic
1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG + Exonic
1161155471 19:2730294-2730316 CCTGGGGAGCTGATGGCTGGTGG + Intronic
1161185045 19:2912080-2912102 AGTGGTGAGATGTGGGCAGAGGG + Intronic
1161286488 19:3471122-3471144 CATGGAGGGCTGGGGGCAGAAGG + Intergenic
1161347525 19:3775694-3775716 CCTGGTTTGCTCAGGGCTGAGGG - Intergenic
1161541048 19:4851742-4851764 CATGGAGGGCTGTGGGCAGAGGG + Intronic
1161563911 19:4988932-4988954 CCTCGGGAGCTGAGGGAATAGGG - Intronic
1161935424 19:7368893-7368915 CCTGGTGATCAAAAGGCAGAGGG + Intronic
1161947943 19:7450062-7450084 CCTGGTGAGCTGAGAAAGGAAGG + Intronic
1162014861 19:7839940-7839962 CCTGGAGAGCAGAGGCCAGTTGG + Intronic
1162833283 19:13300001-13300023 CCTGCTGATCTGACGGCAGGTGG + Intronic
1162837446 19:13330167-13330189 CATGGTGGGGTGGGGGCAGAGGG - Intronic
1164089717 19:21937995-21938017 CCAGGTAAGGTGAGGGCAGGAGG + Intronic
1165435031 19:35790762-35790784 CCTGGTGAGCCGACGGCTGCTGG + Intergenic
1165460081 19:35939307-35939329 CACAGTGGGCTGAGGGCAGAAGG - Intronic
1165854061 19:38869572-38869594 CCAGATGAGCTGCGGGGAGAGGG - Exonic
1165869087 19:38957995-38958017 ACTTGGGAGCTGAGGGGAGAAGG + Intronic
1166116981 19:40662335-40662357 ACTGGTGAGGTGCAGGCAGAGGG + Intergenic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1166794847 19:45420029-45420051 CCTGGGGATCTGAGGGAGGAGGG - Intronic
1166991511 19:46695607-46695629 GCTTGTGTGCGGAGGGCAGATGG + Intronic
1167141085 19:47651214-47651236 CCAGGTGAGCCCAGGGCTGAGGG - Intronic
1167145026 19:47676258-47676280 CCTGGAGAGCAGAGGGCTGGGGG + Intronic
1167257039 19:48436850-48436872 GCTTGGGAGATGAGGGCAGATGG + Intronic
1167321400 19:48799220-48799242 CCTGCTGAGCTGAGGCCACTGGG + Intronic
1167340646 19:48913843-48913865 CCTGGGCTGCTGTGGGCAGAGGG - Intronic
1167456700 19:49599935-49599957 CCCGGTGAGCTCTGGGCAGGTGG + Exonic
1168283991 19:55321411-55321433 CTGGGTGAGCTTAGGGAAGAAGG + Intronic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
924976209 2:178021-178043 GCTGGAGAGCAGAGTGCAGAAGG + Intergenic
925123447 2:1437419-1437441 CTGGGTGTGCTGAGGTCAGAAGG + Intronic
925817609 2:7768843-7768865 CCAGGGGACCTGAGGGCACAGGG - Intergenic
925892748 2:8448991-8449013 CCTGGTGGGCTGTTGGCAGGTGG - Intergenic
926008994 2:9393687-9393709 CCTGGGCAGGTGAGGTCAGAGGG - Intronic
926689672 2:15724667-15724689 CCTGGTGAGCTGGGGGCGAGTGG + Intronic
926923722 2:17965454-17965476 CCAGGAGAGCTGACTGCAGAGGG + Intronic
927505793 2:23613791-23613813 CCTGGTGAGCTGAGAGTGGTGGG - Intronic
927513849 2:23660607-23660629 CCTGGTGAGCTGGGGGCTGTGGG - Intronic
929397518 2:41540445-41540467 TCTGGTGAGCTGAGTGCTAAAGG + Intergenic
929667579 2:43845233-43845255 CCTGGGGAGCTGTGGGAATATGG - Intronic
929738703 2:44579168-44579190 TCTGGTCAGATTAGGGCAGAAGG + Intronic
930891440 2:56392891-56392913 TCTGGTAACCTGAGGGCAGTAGG + Intergenic
931709136 2:64972677-64972699 CCTTGTAAGCTGATGGCAGCAGG + Intergenic
931890291 2:66663710-66663732 GCTGGGTAGCTGAGGACAGAGGG + Intergenic
932368588 2:71169225-71169247 CCTGGGATGATGAGGGCAGAGGG - Intergenic
932403722 2:71500029-71500051 CCTGATGAGCAGAGGGCACCTGG + Intronic
933970635 2:87467171-87467193 TCTGGCAAGCAGAGGGCAGATGG - Intergenic
935205128 2:100890509-100890531 CCTGATGACCTGAGGGTACAGGG - Intronic
936323094 2:111483011-111483033 TCTGGCAAGCAGAGGGCAGATGG + Intergenic
936918218 2:117661585-117661607 CCTGGGGACCCGAGGGAAGAGGG + Intergenic
937854708 2:126663821-126663843 CCAGGTGAGCCGAGGGAAGGAGG - Intronic
938068561 2:128294604-128294626 CCTGGAGAGCTGGGAGAAGAAGG + Intronic
938139249 2:128782931-128782953 CCTGGTGAGCAGTGTGGAGAGGG - Intergenic
938178792 2:129161491-129161513 CCTGCTGAGCTGAGGCCAAAAGG + Intergenic
938422618 2:131156596-131156618 CCCTGTGAGGTGGGGGCAGAAGG + Intronic
938950348 2:136249386-136249408 GCTGGGGAGCTGTGGGCACAGGG + Intergenic
939756552 2:146119400-146119422 AATGGTGAGATGAGGACAGAAGG + Intergenic
942074651 2:172345530-172345552 CTCGGGGGGCTGAGGGCAGAAGG + Intergenic
943748046 2:191482842-191482864 GATGGGGAGCTGAGGGGAGAGGG + Intergenic
944610504 2:201400456-201400478 TCTGGAGAGCTGGGGGGAGAGGG + Intronic
944673043 2:202011964-202011986 CCTGGAAAGCTGAGGCCAGAGGG + Intergenic
945916518 2:215710404-215710426 CCTGGTGGGGTGAAGGAAGAAGG - Intergenic
946231150 2:218292045-218292067 GCTGGTGAGAAGAGGGAAGAGGG - Intronic
947718592 2:232354088-232354110 CATGGGGAGCTGAGTGGAGAAGG + Intergenic
947872103 2:233444919-233444941 GCTGGTGAGCTCTGGGCAGTGGG + Intronic
948505486 2:238424787-238424809 TCTGGAGAGGTGAGGTCAGAGGG + Intergenic
948604192 2:239124301-239124323 CCTGGGCTGCTGCGGGCAGATGG - Intronic
948671932 2:239574440-239574462 CCTGCAGGGCTGAGAGCAGAAGG + Intergenic
948858296 2:240740828-240740850 CCTGGTGCCCTGGGGGCAGCTGG - Intronic
1168816700 20:742773-742795 ACTGGCAAGCCGAGGGCAGAGGG - Intergenic
1168914277 20:1473701-1473723 TCTGGGGAGATGAGGTCAGAGGG + Intronic
1170003913 20:11645726-11645748 CATGGTGTGGTGAGGGCCGAAGG + Intergenic
1170428889 20:16259711-16259733 CCTGGTGCGCTGGGGCCAGCAGG - Intergenic
1170539217 20:17371139-17371161 GCTGGAGAGCTGAGGGCACATGG + Intronic
1170691020 20:18614992-18615014 CCTGGTGGTCTCAGGGCAGTTGG + Intronic
1171564913 20:26172856-26172878 CCTGGTGGCCTCATGGCAGAGGG - Intergenic
1172104975 20:32511315-32511337 CCAGGTGGGGTGAGGGGAGACGG + Intronic
1172362633 20:34324741-34324763 TGAAGTGAGCTGAGGGCAGAGGG + Intergenic
1172601576 20:36187523-36187545 CCTCCTGCTCTGAGGGCAGAGGG + Intronic
1173801090 20:45894925-45894947 CCTGGTGAGGTGGGGGCAGGGGG + Intronic
1173926436 20:46784672-46784694 CCTGGTGACCTGAGGGAGGGAGG + Intergenic
1174173507 20:48631041-48631063 CCTGGGGAGCAGAGGGCTGGGGG - Intronic
1174340051 20:49889946-49889968 CCTGGTGACGAGGGGGCAGACGG - Exonic
1174508738 20:51034938-51034960 CCTGGTGTGCAGAGGGCTGCTGG - Intergenic
1175385537 20:58592630-58592652 CGGGGTGAGATGAGGGAAGATGG + Intergenic
1175389481 20:58617623-58617645 CCTCGTGAGGTGAGGGTTGAAGG + Intergenic
1175557464 20:59878193-59878215 CCTGGTGGCCTGAGGCCACATGG - Intronic
1175605363 20:60308233-60308255 CCTGGTGCGTGGAAGGCAGAAGG - Intergenic
1176267699 20:64219229-64219251 CCTGGTGTGCTGAGTGAAGGGGG + Intronic
1176411917 21:6453788-6453810 CCTGCTCAGGTGAGGGCAGGAGG - Intergenic
1177816948 21:25988020-25988042 TCGGGAGAGCTGAGGGGAGAGGG + Intronic
1178238095 21:30867399-30867421 CCTCGGAAGCTGAGGGAAGAGGG + Intergenic
1178270684 21:31186671-31186693 CCTGGGGGGCTGAGGTGAGAGGG + Intronic
1179229380 21:39487841-39487863 CCTGGTGACCTGAAGGAGGAAGG + Intronic
1179273071 21:39866414-39866436 GCTGCTGAGCTGAGGAGAGAGGG + Intergenic
1179556723 21:42183189-42183211 ACTGGTCAGCTGAGGGATGAGGG + Intergenic
1179563349 21:42231143-42231165 CCTGGTGAGAAGAGGGAAGCTGG - Intronic
1179687411 21:43062110-43062132 CCTGCTCAGGTGAGGGCAGGAGG - Intronic
1179889974 21:44330535-44330557 CCTGCTGGGCTGAGGGCAACAGG - Exonic
1180024705 21:45153834-45153856 CCTCTTGAGGTGAGGGCAGAGGG - Intronic
1180581940 22:16846089-16846111 CCTGGTGTGTGGAGGGCAGGGGG - Intergenic
1180918477 22:19505981-19506003 CCTTGTGAGCCAAGGGCAGCGGG + Intronic
1181268167 22:21642962-21642984 CCCGGTGCGCTGCGGGCAGGCGG + Exonic
1181533567 22:23530532-23530554 TCAGGTGGGCTGAGGGCAGAGGG + Intergenic
1181569015 22:23757022-23757044 CCTGGAGAGATTAGGGCAGGTGG - Intergenic
1181630184 22:24147083-24147105 CCAGGGCAGCTGGGGGCAGAGGG - Intronic
1181727505 22:24821605-24821627 CATGGTGGGCTGCGGGCACAGGG + Intronic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1182286855 22:29253916-29253938 CCTGCTGCGCTGAAGGCAGGGGG - Intronic
1182683982 22:32106526-32106548 GCCTGTGAACTGAGGGCAGATGG + Intronic
1182791923 22:32960286-32960308 CCTGGGGTGATCAGGGCAGATGG - Intronic
1184109030 22:42384433-42384455 CATGTTGGGGTGAGGGCAGAGGG - Exonic
1184373675 22:44098382-44098404 GCTGGGGAGCTGAGGTCTGAAGG + Intronic
1184445604 22:44545171-44545193 CCGGGTGAGCTGGGTGGAGATGG - Intergenic
1184533565 22:45071657-45071679 CCTGGTGGGCTGGGGGCAGTTGG + Intergenic
1184795338 22:46728855-46728877 CAGGGTGTGCTGAGGGCAGAGGG + Intronic
1185141143 22:49102016-49102038 CCTGGTGGGCGCAGGGCAGCAGG - Intergenic
949578269 3:5360094-5360116 CCAGGGGAGCTGAAGTCAGAGGG + Intergenic
949858731 3:8486118-8486140 CTTGGTGAACTCAGGGCAAAGGG + Intergenic
950460600 3:13120088-13120110 CCTGGGGAGCTGAATGCACATGG + Intergenic
950535339 3:13575060-13575082 GCGGGTGGGCTGAGGACAGACGG + Intronic
952210869 3:31227999-31228021 TCTGGGGAGCTGAGGGTAGAAGG + Intergenic
952876237 3:37946797-37946819 CCTGCTGGGCTGAGGTCAAAGGG + Intronic
952881642 3:37989587-37989609 GCGGGTGGGCTGAGGGGAGATGG + Intronic
952889706 3:38031711-38031733 CCCTGGGAGTTGAGGGCAGAGGG - Intergenic
953383931 3:42493998-42494020 CCTGGTGAGGTGAGGGGACCTGG - Intronic
953391182 3:42534764-42534786 CCAGGAGGGCTGGGGGCAGAAGG + Intronic
953658298 3:44871497-44871519 CTTGGAGAGCAGAGAGCAGAGGG + Intronic
953821205 3:46208887-46208909 CTTGGGGAGCAGAGAGCAGAGGG - Intronic
953926514 3:46985442-46985464 CCTGGAGGGCTGAGGGCTGGTGG - Intronic
954036996 3:47856194-47856216 CCATGTGAGCTGAGAGGAGATGG - Intronic
954460789 3:50625814-50625836 CCTGGCAGGCTGAGGGCAGGCGG + Intronic
954468419 3:50672374-50672396 CCAGCTGAACTGAGGGCAGTTGG + Intergenic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
955343864 3:58146679-58146701 CCACGTGAGCTGTGGGCAAAGGG - Intronic
957076347 3:75605973-75605995 CCTGGAGGGCTGTGGGTAGAAGG - Intergenic
957469323 3:80638272-80638294 CCTGGGAACCTGAGGGGAGAGGG - Intergenic
960228290 3:115193143-115193165 CATGGTGGGTTGAGAGCAGAAGG - Intergenic
960814802 3:121661542-121661564 GCTGGTCAGCTGATGGAAGAAGG + Intergenic
960846045 3:122005385-122005407 CCTGGTATGCTGAGGAGAGAGGG + Exonic
961440855 3:126952440-126952462 GCTGGTGTGCTGAGGGGACAAGG + Intronic
961451894 3:127005920-127005942 CCTGGTCACCTGGGGGCTGAGGG + Intronic
961480448 3:127176128-127176150 CCTTGCTAGCTGAGTGCAGATGG + Intergenic
961995294 3:131235582-131235604 CCTGGTAATCTGAAGGCACAGGG + Intronic
962342082 3:134594303-134594325 GCTGGTGGCATGAGGGCAGAGGG - Intergenic
962954344 3:140250355-140250377 CATGGTGAAATGGGGGCAGATGG + Intronic
963141922 3:141953354-141953376 TCTTTTGTGCTGAGGGCAGAAGG - Intronic
964668595 3:159200824-159200846 CCTGGACAGATGAGGGGAGAAGG + Intronic
966913367 3:184571447-184571469 CCTGGTGAGATGAGGGGGCACGG - Intronic
967641484 3:191869988-191870010 AATGCTGAGCTGTGGGCAGAAGG + Intergenic
967846417 3:194046634-194046656 CCTGGTGGCCTCAGGGCAGTTGG + Intergenic
967855218 3:194112305-194112327 CCAGGTCAGATGTGGGCAGATGG + Intergenic
968670606 4:1848902-1848924 CTTGGAGAGCTGGGGACAGAAGG - Intronic
968970535 4:3791359-3791381 CCAGGGAAGGTGAGGGCAGACGG - Intergenic
970483922 4:16505721-16505743 TGTGGGGAGCTGAGGGCATATGG - Intronic
970685908 4:18567105-18567127 CTTGCTGAGCTGCGGGCAGCAGG - Intergenic
972655356 4:41058802-41058824 CATGGTGAGCTGAGGTGACAGGG + Intronic
973616074 4:52679210-52679232 CCTCGTCAGATGAGGGAAGACGG + Intergenic
974362936 4:60906445-60906467 CCTGGAGGGCTGAGGCCAGTAGG - Intergenic
974844620 4:67336484-67336506 CTTGGTAAGCTGACGGCTGAGGG + Intergenic
976140805 4:81989533-81989555 CATTTTGAGCTGAGGGCAAATGG - Intronic
978330581 4:107608781-107608803 TCTGGTGAGCTGGAGGCAGGAGG + Intronic
978331250 4:107614919-107614941 GCTGGGGAGTAGAGGGCAGAGGG - Intronic
978856591 4:113401037-113401059 CCTAGTGAGCTGTGAGAAGAGGG + Intergenic
979881132 4:125961726-125961748 TCTGTTGGGCTGTGGGCAGATGG + Intergenic
980607431 4:135111242-135111264 TTTGGTGAGCTGAGAGAAGAAGG - Intergenic
982226272 4:153170402-153170424 CCTGGTGAGCTTCAGGCTGATGG + Intronic
985833512 5:2253020-2253042 CCAGGTGAGCGGAGTGCTGAAGG - Intergenic
986135808 5:4976655-4976677 CCTGTAGAGCTGAAGGCGGAAGG - Intergenic
988602547 5:32653428-32653450 GTTGGTAAGCAGAGGGCAGAGGG + Intergenic
990514157 5:56516705-56516727 GAGGGTGGGCTGAGGGCAGAAGG + Intronic
990557469 5:56951337-56951359 ACTGGTGAGCTGGGGGGAGGGGG - Intronic
991165538 5:63562679-63562701 CTTGCTGAGCTGCGGGCAGCAGG + Intergenic
991642720 5:68770741-68770763 CCTGGGGAGATGCAGGCAGAAGG + Intergenic
992097580 5:73377199-73377221 TCTGGGGAGCTGAAAGCAGAGGG + Intergenic
992198730 5:74364012-74364034 ACTGGTGAGCTGAGGGCTTTTGG - Intergenic
994157603 5:96521343-96521365 CCTGGTAAGGTGAGGCCAGAAGG - Intergenic
995612259 5:113923349-113923371 CCTGGCGAGATGAACGCAGAAGG + Intergenic
996103490 5:119470299-119470321 CATGGTGGGATGATGGCAGATGG + Intronic
996523533 5:124452762-124452784 CCTGGTTTGCAGAGTGCAGAGGG + Intergenic
996832117 5:127752099-127752121 TTTGATGAGCTGAGGGAAGAAGG - Intergenic
998133414 5:139662310-139662332 CCTGGGGTGCTGAGAGCTGAGGG + Intronic
998241646 5:140451614-140451636 CTTGGGAGGCTGAGGGCAGAGGG - Intronic
998446814 5:142205006-142205028 CCAGGTGAGATGAGGGCACCAGG + Intergenic
998489575 5:142534569-142534591 GCTGGTGTGAGGAGGGCAGAAGG - Intergenic
998823403 5:146077180-146077202 CCTTGTGAGGGGAGGGCAGGTGG - Intronic
999180360 5:149665966-149665988 CCTGGACAGCTGGGAGCAGAGGG - Intergenic
1000096596 5:157976612-157976634 CCTGGTGAGTAATGGGCAGAAGG + Intergenic
1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG + Intergenic
1001549946 5:172595480-172595502 CCTGGTGTGATCAGGGCAGGGGG + Intergenic
1002103929 5:176870592-176870614 CCTGGGGAGGTGGGGGCTGAGGG + Intronic
1002695667 5:181086690-181086712 TCTGGGGAGCTGGGGGCAGCGGG + Intergenic
1004312224 6:14555640-14555662 CTTGGAGGGCTGAGGGCAGGAGG - Intergenic
1004498525 6:16187541-16187563 GCTGATGGGTTGAGGGCAGAAGG - Intergenic
1004927740 6:20431966-20431988 CCCGGTGAGCTTATGACAGAGGG - Intronic
1005969377 6:30749297-30749319 CATGGTGATCTGGGGGAAGATGG - Intergenic
1005994482 6:30922998-30923020 CGGGGTGAGCAGAGGGCAGCGGG + Intronic
1006547242 6:34790447-34790469 TCTGGTGAGAGGTGGGCAGAGGG + Intergenic
1006644798 6:35508797-35508819 CCTGGGGAGCTCAGGGCTGTAGG + Intronic
1006791456 6:36703954-36703976 CCTGAAGAGATGAGGGCAGGTGG + Intronic
1006897154 6:37478556-37478578 CCTGGCGAGGAGAGGGGAGAGGG - Intronic
1007257629 6:40539922-40539944 CCTGGAGAGGTGATGGAAGAGGG - Intronic
1007425368 6:41743009-41743031 CCTGGGGAGCTCAGAGAAGAAGG - Intronic
1007843901 6:44738488-44738510 CCAGGAGGGCTGAGAGCAGAGGG + Intergenic
1008036782 6:46753556-46753578 CCTGGTGAGAAGAGGGAAAAGGG + Intronic
1011124015 6:83986995-83987017 CCAGGTGAGATGAGGGCAGATGG - Intergenic
1013457310 6:110342282-110342304 CCTGGGGAGCTGTTGGGAGAGGG + Intronic
1015437019 6:133201345-133201367 ATTGGTAAGCTGAGGGTAGAAGG - Intergenic
1017991711 6:159494826-159494848 GGTGGGGAGCTGAGGACAGATGG - Intergenic
1018616494 6:165691752-165691774 CCTGCTGAGCTGAGAGGCGAAGG - Intronic
1018636985 6:165871435-165871457 CCTGGTGAGGTGAATGCAGGGGG + Intronic
1018861955 6:167717515-167717537 CCAGGTGAGGTGGAGGCAGAAGG - Intergenic
1019215357 6:170439449-170439471 CCTGGTGTGATGAGGACACATGG + Intergenic
1019354766 7:572706-572728 CCTGGAGAGCCGAGGGGAGCAGG + Intronic
1022477752 7:30722884-30722906 CCTTTGGAGCTGAGGGCAGGGGG + Intronic
1023965388 7:44961212-44961234 GCTGGGGGGCTGAGGGCTGAGGG + Intergenic
1023965433 7:44961333-44961355 GCTGGGGGGCTGAGGGCTGAGGG + Intergenic
1023994887 7:45153328-45153350 CCTGGTGGGAGCAGGGCAGAGGG + Intergenic
1024830819 7:53453919-53453941 CCTGGTGATCTGAGTACAGGTGG + Intergenic
1026088824 7:67283582-67283604 CCTGAAGAGCTGAGAGTAGAGGG - Intergenic
1026116845 7:67502934-67502956 CTTGCTGAGATGTGGGCAGAAGG + Intergenic
1026875625 7:73877439-73877461 CCTGGGGAGCTGTGGCCTGAAGG + Intergenic
1027118416 7:75498900-75498922 CCTGAAGAGCTGAGAGTAGAGGG - Intergenic
1028905753 7:96152327-96152349 CCTAGGGAGCAGAGGGGAGAGGG + Intronic
1029221658 7:98995219-98995241 CCTGGTGAGCCGGTGGGAGATGG + Intronic
1031041506 7:116843140-116843162 CCAGTTGAGCTGAGGCCTGATGG - Intronic
1031931486 7:127690388-127690410 CTGCATGAGCTGAGGGCAGAAGG - Intronic
1031988879 7:128182843-128182865 CATAGGGAGCTGAGGACAGAGGG + Intergenic
1032425069 7:131815969-131815991 CCTGGGGAATAGAGGGCAGAGGG - Intergenic
1032547518 7:132756128-132756150 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1034098550 7:148431729-148431751 CCTGGTGAGTTCAAGGCAGGAGG - Intergenic
1034348532 7:150401939-150401961 GGTGGTGAGCAGAGGGGAGAAGG - Intronic
1034355751 7:150449690-150449712 CCTGCTGTGCAGAGCGCAGAGGG + Intergenic
1034488073 7:151378697-151378719 CCTGGTGAGCTGAGGTGACGCGG + Intronic
1034904122 7:154929069-154929091 CCCTGTGAGCTGAGGGCACTTGG - Intronic
1035369664 7:158371999-158372021 CCAGGAGGGCTGATGGCAGAGGG - Intronic
1035419088 7:158712089-158712111 TCTGGTGAGCTGAGGGGAAGGGG + Intergenic
1035734542 8:1878656-1878678 CATGGTGGGCTGTGGACAGAGGG + Intronic
1036197522 8:6733347-6733369 CCTGGTGAGGGGAGGGCAGGAGG - Intronic
1036212628 8:6854582-6854604 CCATGGGAGCTGAGGGCTGAAGG - Intergenic
1036238653 8:7064407-7064429 CCTGGTGACCTGCAGGAAGATGG + Intergenic
1036816776 8:11908354-11908376 CCTGGTGGACTGTGGGTAGAAGG - Intergenic
1037756161 8:21711416-21711438 CCAAGTGAGCTCAGGGCAGCAGG + Intronic
1037837207 8:22221325-22221347 CCTGGGGAGCTGGGGGGCGAGGG - Exonic
1039251976 8:35676115-35676137 TCTGGTTAGCTGGGGACAGAAGG - Intronic
1039894223 8:41704912-41704934 GGTGCTGAGATGAGGGCAGATGG + Intronic
1040554598 8:48467838-48467860 CCTGGGGTGATGAGGGCAGGTGG + Intergenic
1040866649 8:52054706-52054728 CCCGGTCAGCTGAGGACAGTGGG - Intergenic
1041362001 8:57064527-57064549 CCTGGAGAGCGGAGTGCACAAGG + Intergenic
1042264209 8:66892030-66892052 TCTGCTGAGCTGTGGGCAGCAGG - Intronic
1044537646 8:93375612-93375634 CCTGGTGAGGAGATGGGAGAAGG - Intergenic
1044656248 8:94551578-94551600 CCTTGAGAGCATAGGGCAGATGG - Intronic
1044792570 8:95863194-95863216 CCTGGAGTGATTAGGGCAGATGG - Intergenic
1047267376 8:123319052-123319074 CCTGGGAGGCTGAGGGCAGGAGG - Intergenic
1047365764 8:124209940-124209962 CCTGGAGATCTGAAAGCAGATGG - Intergenic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1049282239 8:141755604-141755626 CCTGGTCAGCTGAGGGTTGCAGG + Intergenic
1049421683 8:142519415-142519437 GCTGGAGAGCAGAGGGCACAGGG - Intronic
1049635478 8:143686062-143686084 GCTGTTGAGCTGAGGGGAGAGGG + Intronic
1049647007 8:143739984-143740006 CCGGGTGAGCTGTTGGCAGGGGG + Intergenic
1049656942 8:143803216-143803238 GCTGGGGAGCTGTGGGCGGAGGG - Intronic
1049754589 8:144304196-144304218 CATGGTGAGCTGGGGTGAGAGGG + Intronic
1050412916 9:5385015-5385037 CAAGGTGAGATGAGGTCAGATGG + Intronic
1052896835 9:33755125-33755147 CCAGGTCATCTGAGGGCAGGTGG + Intronic
1054452532 9:65410921-65410943 CTAGGTGACCTGAGGGCTGAAGG - Intergenic
1055724473 9:79212545-79212567 TCTGGTGAGAGGAAGGCAGAAGG + Intergenic
1056019154 9:82423507-82423529 CTTGGAGAGCTTTGGGCAGATGG - Intergenic
1056081811 9:83102787-83102809 CCTGGGGTGATGAGGACAGACGG + Intergenic
1056363604 9:85882308-85882330 CCTGGGGAGGAGAGGTCAGATGG - Intergenic
1056787477 9:89603683-89603705 CCTGGGGAGTAGAGGGCAAAAGG - Intergenic
1057220971 9:93257526-93257548 ATGGGTAAGCTGAGGGCAGATGG - Intronic
1057521240 9:95762259-95762281 CCAGGTGAACTGAGGCCAGCTGG + Intergenic
1058968186 9:110056158-110056180 CCTGGTGAGGTGTGTGTAGAAGG + Intronic
1059537366 9:115093911-115093933 CATGGTGGTCTGAGGGCAGTGGG + Intronic
1060002179 9:119968788-119968810 CCTGGTGAGCTGGGGCCACAGGG + Intergenic
1060196829 9:121629307-121629329 CCTGGCCGGCTGATGGCAGAGGG + Intronic
1060892420 9:127197276-127197298 CCAGGTCAGCTGAGGACAGGTGG + Intronic
1061246911 9:129405312-129405334 TCATGTGGGCTGAGGGCAGAGGG - Intergenic
1061945574 9:133906758-133906780 CCTGGAGAGCTGGGGGCAGCGGG + Intronic
1062139107 9:134945666-134945688 CCTGGAGAGCGGAGGGCAGAGGG + Intergenic
1062466812 9:136685236-136685258 CCTGGAGAGGTGAGGGCGGCAGG + Intronic
1185506383 X:634592-634614 CGTGGGGAGCGGAGGGCACAGGG - Intronic
1186139929 X:6561273-6561295 CCTGGAGAGCTGAGGGTGCAAGG - Intergenic
1186145056 X:6616402-6616424 CCTGGTGAGATGTGAGCAGAAGG - Intergenic
1187152371 X:16693122-16693144 TCTGGTGAGTTGAGGACAGTGGG - Exonic
1187989960 X:24859517-24859539 CCTGGACAGCTGAGTGAAGAAGG - Intronic
1188935913 X:36175285-36175307 CTTGATGAGCTGAGAGAAGAAGG - Intergenic
1189447448 X:41094094-41094116 CATGCTGAGCTGAGGCAAGAGGG + Intronic
1191811761 X:65196770-65196792 CCTGGTGATATTAGGGCTGAGGG - Intergenic
1192227294 X:69238205-69238227 CCTGCAGGGCTGAGGGCAGAGGG - Intergenic
1193127279 X:77883289-77883311 CCTCGTGATCTGCCGGCAGATGG - Intronic
1193543460 X:82799049-82799071 CATTGGCAGCTGAGGGCAGATGG - Intergenic
1195770904 X:108350115-108350137 TCTGTTGATCGGAGGGCAGAAGG + Intronic
1195886684 X:109645679-109645701 TCTGGCGAGCTGAGAGAAGAAGG + Intronic
1196318453 X:114258112-114258134 CCTGCTGAGATGAGAGCAGCAGG - Intergenic
1197822770 X:130558306-130558328 CCAGGGGAGCTGATGGCTGAGGG + Intergenic
1201519980 Y:14862247-14862269 TCTGGTGAGATGAGAGAAGAAGG + Intergenic
1202037161 Y:20646921-20646943 CCTGGAGAACTGTGGGCATAAGG + Intergenic