ID: 1107966194

View in Genome Browser
Species Human (GRCh38)
Location 13:45600313-45600335
Sequence GGAAGTGCACAGATGAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 1, 2: 10, 3: 49, 4: 277}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107966194_1107966199 30 Left 1107966194 13:45600313-45600335 CCCAGATTCATCTGTGCACTTCC 0: 1
1: 1
2: 10
3: 49
4: 277
Right 1107966199 13:45600366-45600388 TTTATTTTGTAAAAATTTATGGG 0: 1
1: 5
2: 40
3: 360
4: 2411
1107966194_1107966198 29 Left 1107966194 13:45600313-45600335 CCCAGATTCATCTGTGCACTTCC 0: 1
1: 1
2: 10
3: 49
4: 277
Right 1107966198 13:45600365-45600387 TTTTATTTTGTAAAAATTTATGG 0: 1
1: 1
2: 43
3: 505
4: 2857

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107966194 Original CRISPR GGAAGTGCACAGATGAATCT GGG (reversed) Intronic
900812571 1:4818275-4818297 GGAAGTGCACAGATGGGCCAAGG + Intergenic
900824980 1:4919104-4919126 GTGAGTGCACAGAAGAATCGGGG - Intergenic
900842944 1:5070461-5070483 GGAAGTGCACAGATGGGCCTAGG - Intergenic
900883859 1:5401814-5401836 GGAAGTGCACAGATGGGCCTAGG - Intergenic
901746462 1:11376983-11377005 TCAAGTGCACAGATGGACCTGGG - Intergenic
902183366 1:14706692-14706714 GGACTTGAACATATGAATCTGGG + Intronic
903349540 1:22709971-22709993 GGAAGTCCATGGGTGAATCTGGG - Intergenic
904316425 1:29669036-29669058 GGAGGCGCAGAGATGAAACTAGG - Intergenic
907452305 1:54553373-54553395 GGATGTGCCCAGTTGAACCTGGG + Intronic
907487431 1:54787563-54787585 TGAGGTGCACAGATGAGTGTAGG + Intronic
907492748 1:54819283-54819305 GGAGGTGCACAGTGGAATGTAGG - Intronic
907570201 1:55476386-55476408 GGAAGTGTGCAGGTGAAGCTGGG + Intergenic
908395856 1:63725161-63725183 GGAAGTGTACAGATGGGCCTAGG - Intergenic
908964247 1:69738788-69738810 GGAATTACACATTTGAATCTTGG + Intronic
909611026 1:77552001-77552023 GGAAGTGCACAGATGGGCCTAGG - Intronic
910460469 1:87443601-87443623 GGAATTCAACATATGAATCTGGG - Intergenic
911324545 1:96454622-96454644 GGCAGAGCACAGAGGAATTTTGG - Intergenic
912587318 1:110778874-110778896 GGAGGTGCACAAATGAATAAAGG + Intergenic
912617400 1:111117610-111117632 GGAAGAGCCCACATGAATCCAGG + Exonic
913420532 1:118663147-118663169 GAAAATAAACAGATGAATCTAGG + Intergenic
916265822 1:162888852-162888874 AGCAGTGCAGAGATGCATCTGGG + Intergenic
918983138 1:191589128-191589150 GGTAGTGCACAGATGAGTCTAGG + Intergenic
919342893 1:196336422-196336444 GGAAGTGAAAAGATGTATTTTGG - Intronic
920055883 1:203191363-203191385 GGAAGTGCACAGATGGGCCTAGG - Intergenic
920069733 1:203293844-203293866 GGAAGTTCAAAGATAAATTTAGG + Intergenic
920830065 1:209456498-209456520 GGGAGAGCACAGATGACTTTAGG - Intergenic
922232572 1:223699670-223699692 GGAAGTGCACAGATGGGCCTAGG - Intergenic
922767553 1:228163743-228163765 GCAAGTGCACAGATGGGCCTAGG - Intergenic
922818214 1:228466306-228466328 GAAAGTGCACAGATGGACCCAGG - Intergenic
924431250 1:243998573-243998595 GGAAGTGGACAGATGGAGCGCGG - Intergenic
924809892 1:247391736-247391758 GGAAATGCACAGATGGGTCTAGG - Intergenic
1063023853 10:2157986-2158008 GGAATTCAACATATGAATCTGGG - Intergenic
1063042384 10:2356553-2356575 GGAACTGAAGAGATGAAACTGGG - Intergenic
1063484883 10:6410555-6410577 GGAAATGCACAGGGGCATCTGGG + Intergenic
1063974219 10:11402345-11402367 GGAGGTGTACAGATGAGCCTCGG - Intergenic
1064641079 10:17416380-17416402 AGAACTGCACATATCAATCTGGG - Intronic
1065982147 10:30910044-30910066 AGAAGTGCCCAGTTGAACCTAGG - Intronic
1066014009 10:31219990-31220012 GGGAATGAACACATGAATCTTGG + Intergenic
1066292295 10:34025505-34025527 GGAAGGGCAAAGTTGGATCTGGG - Intergenic
1067250021 10:44578279-44578301 GGAAATGCACAGATGGGTCCAGG + Intergenic
1067969814 10:50956948-50956970 GGAAATGCACTGATGTATTTAGG + Intergenic
1068139984 10:52993747-52993769 TGAAGAGCACAGATGGACCTAGG - Intergenic
1068243847 10:54339661-54339683 GGAAGTATACAGATGAGCCTAGG - Intronic
1068721634 10:60252280-60252302 GGATCTGCTCAGATGAATCCTGG - Intronic
1069605405 10:69735775-69735797 AGAAGTGCACGAATGAATTTAGG - Intergenic
1070278347 10:75029618-75029640 GGGAGTGGACGGATGAAACTGGG - Exonic
1071223111 10:83492987-83493009 GAAAGTGCACAGATGGGCCTAGG + Intergenic
1071425019 10:85540617-85540639 GGAAGTGCATAGATGGGCCTGGG + Intergenic
1072764856 10:98087029-98087051 TGAAGTTTACAGATAAATCTTGG + Intergenic
1073539289 10:104305382-104305404 GGACACGCACAGATGAACCTAGG + Intergenic
1073556973 10:104463250-104463272 GGAAGGCCACTGATGAAGCTGGG + Intergenic
1074058896 10:109946948-109946970 GAAGATGCACAGATGAATCGTGG - Intronic
1075121668 10:119669147-119669169 GGAAGTGCACAGATGGGCCTAGG + Intronic
1076705810 10:132301044-132301066 GGAAGCTCAGAGCTGAATCTGGG - Intronic
1077967535 11:7151226-7151248 GTAAGCTCACACATGAATCTTGG + Intergenic
1078882234 11:15463680-15463702 GGAAGAGGACAGATAATTCTAGG - Intergenic
1079183214 11:18212456-18212478 TGAAGTGCACACATGAATGAGGG - Intronic
1079410099 11:20179579-20179601 GGAAGGGGACAGATGAGGCTGGG - Intergenic
1080478844 11:32624476-32624498 GGAAGTGGACAGATTAATTATGG + Intronic
1081506490 11:43722358-43722380 GGAAGTATACAGATGTATATTGG + Intronic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1087357890 11:97117930-97117952 GGAAGTACACAGATGGTCCTAGG + Intergenic
1088352668 11:108907672-108907694 GGAAGGGCAGAGATGTTTCTGGG + Intronic
1088639714 11:111859668-111859690 GGTAGAGCACAGATGCATTTAGG + Intronic
1090220931 11:125024620-125024642 GGAAATGCACAGTTGATTTTTGG + Intronic
1090286760 11:125506346-125506368 GGAAGTGCACAGATTGATCTAGG - Intergenic
1091812398 12:3410367-3410389 GGAATTGCAGAGAGGAAGCTGGG - Intronic
1091945789 12:4540038-4540060 GGAATGGAACAGATGAATTTGGG + Intronic
1092010792 12:5110765-5110787 GGATGTGAACATATGAATTTTGG - Intergenic
1093833547 12:23797315-23797337 GGATATACACAGATGTATCTTGG + Intronic
1094303752 12:28994978-28995000 GGCAGAGGACTGATGAATCTTGG - Intergenic
1095208787 12:39468983-39469005 GTAATTTCTCAGATGAATCTAGG + Intergenic
1096498393 12:52051472-52051494 GGGAGTGCACAGAAGAACTTCGG + Intronic
1096710921 12:53454922-53454944 GGAAGAGCAGACATGCATCTTGG + Intronic
1097074538 12:56383247-56383269 AGAAGTGCACGGATGAGTCTTGG - Intergenic
1097387089 12:58962937-58962959 GGAGGTGCACAGATGGGCCTAGG - Intergenic
1098878392 12:75891188-75891210 GAAAGTACACAGATGAGCCTAGG - Intergenic
1099493854 12:83320199-83320221 GGAAATGGAAAGATAAATCTTGG - Intergenic
1099926752 12:89027917-89027939 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1100641466 12:96485657-96485679 GGGAGTTCTAAGATGAATCTCGG - Intergenic
1100751366 12:97701934-97701956 GGAAATGCACAGATGGGCCTAGG - Intergenic
1100950377 12:99842427-99842449 GGAAGTACACAGATGGGCCTAGG - Intronic
1101153840 12:101908779-101908801 GGAAGTGCACAGATGGACCTAGG + Intronic
1101880136 12:108620797-108620819 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1102049280 12:109850606-109850628 GGAATTTCACATAAGAATCTTGG - Intergenic
1102082146 12:110107094-110107116 GTAGGTGCAGAGATGGATCTTGG + Intergenic
1103099550 12:118161050-118161072 TGAAGTGCACACATGACTGTGGG - Intronic
1104633163 12:130421949-130421971 GGAGGTGCCCAGATGGATGTGGG + Intronic
1107021623 13:35757967-35757989 GGAAGTACACCAATGAATCCAGG + Intergenic
1107443797 13:40452056-40452078 GGAAGGTCACAGAAGAATTTAGG - Intergenic
1107502341 13:40993374-40993396 GGCAGTGCACCGATGGGTCTGGG + Intronic
1107594314 13:41946834-41946856 GGAAGTACACAGGTGTGTCTAGG - Intronic
1107963355 13:45578044-45578066 GGAAGTGCACAGATGGACCTAGG - Intronic
1107966194 13:45600313-45600335 GGAAGTGCACAGATGAATCTGGG - Intronic
1108481243 13:50874146-50874168 GGAAGTGCCCAGATGGGGCTAGG + Intergenic
1109627595 13:64995733-64995755 GGAAGTGCAAAGATGGGCCTAGG + Intergenic
1113066761 13:106380614-106380636 TGAAGTGCAGAGATGACTTTGGG - Intergenic
1116189794 14:41649537-41649559 TGAAGTGCACAGATGGGCCTAGG - Intronic
1117467954 14:56013179-56013201 AGAAGAGCAGAGAAGAATCTGGG + Intergenic
1117496461 14:56310387-56310409 GGCAGGGCACAGATCAATCAGGG + Intergenic
1117626727 14:57647692-57647714 GGAAGAACACAGATGGGTCTAGG - Intronic
1118523236 14:66611019-66611041 GAAAGTGCACAGATGGGCCTAGG + Intronic
1119962078 14:78870178-78870200 GGAAGTGCACAGATGAGCCTAGG + Intronic
1121992695 14:98574943-98574965 GGGTGTGGACAGATGAATTTGGG - Intergenic
1122717185 14:103702769-103702791 GGACGTGCACAGATGGGCCTAGG - Intronic
1124235765 15:27988322-27988344 GGAGGTGAACATATGAATTTTGG - Intronic
1128820703 15:70650187-70650209 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1129121393 15:73399012-73399034 GGATCTGCACAGAGGAAGCTGGG + Intergenic
1129141941 15:73606845-73606867 GGAAGTTCACAGATGGGCCTAGG - Intronic
1131232863 15:90672124-90672146 GGATTTCAACAGATGAATCTGGG - Intergenic
1131417925 15:92276934-92276956 GGAACTGGACAAATGAATCAGGG - Intergenic
1131588061 15:93717506-93717528 AGAAGTGCACACATGGATCCAGG + Intergenic
1132142209 15:99405426-99405448 GGAAATGCAAAGATGAGCCTAGG + Intergenic
1135586133 16:23672530-23672552 GCAAGTGAACAAATGAGTCTGGG + Exonic
1138761074 16:59545140-59545162 GGAAGTGCAATGTGGAATCTGGG - Intergenic
1138761597 16:59550425-59550447 GGAAATGCACAGATGAGCCTAGG + Intergenic
1143508370 17:7381913-7381935 GGAAGGACACAGATGAGCCTGGG + Intronic
1144588201 17:16501747-16501769 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1144646525 17:16978388-16978410 GGCAGTGCACAGATGTTTCTCGG + Intergenic
1148047071 17:44750760-44750782 GGAAGTGACCAGATGAGACTGGG - Exonic
1149415098 17:56450717-56450739 GCAAGTGGACAGATGATTCTTGG + Intronic
1150432681 17:65131027-65131049 GGAAGTGCAGAGATAAAGGTTGG + Intergenic
1150857519 17:68767497-68767519 GGAAGGACAAGGATGAATCTTGG + Intergenic
1153045649 18:853532-853554 AGAAGTGCAGAGATGAATTTCGG - Intergenic
1153944233 18:10004630-10004652 GGAAATGCACATATGGGTCTAGG - Intergenic
1155978545 18:32157589-32157611 GGAAGTGCACGCATCATTCTGGG - Intronic
1159140916 18:64393173-64393195 GGAAGTTCACAGATGTGCCTAGG - Intergenic
1159507452 18:69355785-69355807 GGAAATGCACAGATGGGCCTAGG - Intergenic
1161243632 19:3236682-3236704 GGAAGGACAAAAATGAATCTAGG + Intronic
1161688033 19:5713261-5713283 AGAAGAGCACAGAGGAATGTTGG + Intronic
1162060109 19:8089830-8089852 GGCAGTGCGGAGATGGATCTGGG + Intronic
1163407302 19:17130881-17130903 AGAAGTGCACAGATGGGACTGGG - Intronic
1164502536 19:28831813-28831835 GGACTTCCACAGATGAATTTGGG + Intergenic
1164694398 19:30232742-30232764 GGAACTTAACAGATGAACCTGGG + Intronic
1165722152 19:38087097-38087119 GGAGGTGCACAGATGGGCCTAGG + Intronic
925352878 2:3214451-3214473 GGACTTCCACACATGAATCTGGG - Intronic
928683247 2:33724525-33724547 AGCAGTGCTCAGATGATTCTGGG - Intergenic
930241788 2:48943016-48943038 GGAAGAGCACAGAGGATTCTAGG - Intergenic
930273824 2:49288241-49288263 GGAAGTGCACAGATGGGCTTGGG + Intergenic
930787182 2:55282256-55282278 GGAACTGCCCAGAGGGATCTCGG - Intergenic
931768130 2:65474878-65474900 GGAAGTGTACAGATAAATGTAGG + Intergenic
931804042 2:65787743-65787765 GGAAGTGTACAGATGGACTTAGG - Intergenic
931831428 2:66055770-66055792 GGATGTGAACATATGAATTTGGG - Intergenic
932280224 2:70485077-70485099 GGCAGTGAATAGATGAAACTTGG - Intronic
932601429 2:73129213-73129235 GGAAGTGCACAGGTGGGCCTAGG - Intronic
935736262 2:106108863-106108885 GGAAGTGCACAAATGGGCCTAGG - Intronic
936740092 2:115494636-115494658 GGAAATGCTCAAATAAATCTAGG - Intronic
937258530 2:120571130-120571152 GGAAGTGGAGGGATGAATTTGGG + Intergenic
937371085 2:121297727-121297749 GGAAGAGCACAAAAGATTCTAGG - Intergenic
937840945 2:126524054-126524076 GGAAGCACACAAATGAACCTAGG + Intergenic
938182874 2:129199543-129199565 GGAAGTACACAGATGGGCCTAGG - Intergenic
938337485 2:130512355-130512377 GGACGTGCACAGATGGACGTAGG - Intergenic
938352353 2:130608380-130608402 GGACGTGCACAGATGGACGTAGG + Intergenic
939243628 2:139594687-139594709 GGCAGTGCAGAGAGGAATGTGGG + Intergenic
939828356 2:147043122-147043144 GGCAGTGCACAGAGGATTTTAGG + Intergenic
939856365 2:147363648-147363670 GGAATTACACAGTTGAATTTGGG + Intergenic
940912380 2:159219920-159219942 GGAAGTGAACAGCTCAATCCAGG + Intronic
941670209 2:168284812-168284834 GGATGTGCAAAGATCAGTCTGGG - Intergenic
944138282 2:196425412-196425434 GGAATTTCTCTGATGAATCTGGG + Intronic
944883582 2:204040491-204040513 AGAAGGGCACAGATAAATTTGGG + Intergenic
945322196 2:208437352-208437374 TGAAGCACACAGATGAATTTTGG + Intronic
945510803 2:210700513-210700535 GGTAGCCCACAGATGAGTCTAGG - Intergenic
946494739 2:220184476-220184498 GGAAGTACACAGATGGGCCTGGG - Intergenic
946950189 2:224865808-224865830 GGAGGTTAACAGTTGAATCTGGG - Intronic
948655469 2:239474172-239474194 GGAAGCTCAGAGAAGAATCTGGG - Intergenic
1170130409 20:13012959-13012981 GGAACTCCAGAGATGAATGTAGG + Intronic
1170155506 20:13265571-13265593 GGGAAGGCACAGATGAATTTGGG - Intronic
1170833230 20:19861412-19861434 GGAAGTGCTCAGAAGCACCTAGG - Intergenic
1172264686 20:33600787-33600809 GGAAGTTCAGAGATGAAGGTAGG - Intronic
1172849625 20:37951845-37951867 GGAAAAGCAAAGATGAATCCAGG - Intergenic
1178664187 21:34532289-34532311 GGAAGTGCACAGGTGAGCCTAGG + Intronic
1180800435 22:18629354-18629376 GGAAGTGCTCAGATGTGCCTAGG + Intergenic
1180851670 22:19024910-19024932 GGAAGTGCTCAGATGTGCCTAGG + Intergenic
1181141632 22:20809769-20809791 GGAACTGCCCAGATGCAACTTGG + Intronic
1181221284 22:21365908-21365930 GGAAGTGCTCAGATGTGCCTAGG - Intergenic
1181804348 22:25366089-25366111 GGCAGTGCCCAGATGAGGCTGGG - Intronic
1182942340 22:34288808-34288830 AGAAGAGCACAGAAGAACCTGGG - Intergenic
1183292954 22:37014031-37014053 GGAAGGGCTGAGATGAACCTGGG + Intronic
1183840064 22:40492081-40492103 GCAGGTGGACTGATGAATCTTGG + Intronic
1183877263 22:40794054-40794076 AGATGTTAACAGATGAATCTGGG + Intronic
1184910833 22:47532885-47532907 GGAAGTGCACAGATGGGGCTAGG + Intergenic
1184965142 22:47966038-47966060 GGAAGTGCACAGGTGGGTCTGGG - Intergenic
949508088 3:4745254-4745276 GGGAGAGCAGAGATGACTCTAGG - Intronic
950041330 3:9921151-9921173 GGAAATAGAAAGATGAATCTTGG + Intronic
950321888 3:12063535-12063557 GGAAGTTCACAGATAAACATGGG + Intronic
950562548 3:13743015-13743037 GGAAGTGCAGAGGGGAATTTGGG + Intergenic
950924799 3:16729697-16729719 GGAAGTGCACAGATGGGCCCTGG + Intergenic
951591242 3:24267503-24267525 GGAAGTGCATAGATGAGCCCAGG - Intronic
953441939 3:42925715-42925737 GGTGAAGCACAGATGAATCTAGG - Intronic
953638539 3:44684433-44684455 GGAAGTGCAAAGAGGCATCAGGG - Intergenic
953799977 3:46015406-46015428 GGAGTTGAACATATGAATCTGGG + Intergenic
955055125 3:55447944-55447966 GGAATTCAACATATGAATCTTGG - Intergenic
956132043 3:66063439-66063461 TGAGGGGCACACATGAATCTTGG + Intergenic
956177202 3:66484171-66484193 GGAAATACACAGATGAAGCCTGG + Intronic
956252319 3:67247535-67247557 GCCAGTGGACAGATGAATCCTGG - Intergenic
957782252 3:84834626-84834648 GGAAGTGCAAAGGTGGACCTAGG + Intergenic
959980902 3:112516552-112516574 GGAGGTGCACAGATGGGCCTAGG - Intergenic
961350217 3:126295701-126295723 GGAAGTGCACAGATGGGTCAAGG - Intergenic
965242713 3:166224339-166224361 AGAAGTGCACAGAAGAATCAGGG + Intergenic
965463115 3:168993450-168993472 GGAAGTGCACAGATGGGCCTAGG - Intergenic
965681853 3:171259975-171259997 GGAAGTGCATAGATGGGCCTAGG - Intronic
966193763 3:177294176-177294198 GGAAGAGCAGAGATGCAGCTGGG + Intergenic
966774007 3:183528318-183528340 GGAAGAGAAAAGATGAAGCTTGG - Intronic
967223575 3:187270258-187270280 GGAAGTGCACAGATGAGTTGAGG - Intronic
968243168 3:197111663-197111685 AGAAGTGCACAGTTGAACATCGG - Intronic
968617859 4:1588313-1588335 GGAAGGGCACTGAAGAATCTGGG - Intergenic
968692979 4:2005350-2005372 TGAAGTGCACAGAAAAATCAAGG + Intronic
969527978 4:7713740-7713762 GGAAGTGCTCAGATGGGCCTAGG + Intronic
969850072 4:9948970-9948992 GGAAGTACACAGATGGGCCTAGG - Intronic
970471931 4:16387590-16387612 GAAAGTGCATAGATGAGCCTAGG - Intergenic
970921945 4:21404948-21404970 GGAAGTGCACAGATAGGCCTAGG - Intronic
975758784 4:77597718-77597740 GGAAGTGCACAAATGGCTCTTGG + Intronic
975914399 4:79306563-79306585 AGAAGTTCACACATGAATTTTGG + Intronic
976034544 4:80798431-80798453 GGGAGGACACTGATGAATCTCGG - Intronic
976125485 4:81829684-81829706 AGAATTTCACAGATGAATTTGGG + Intronic
976284653 4:83359887-83359909 GGGAGTACAAAGAAGAATCTGGG - Intergenic
976332979 4:83852960-83852982 GAAAGTGCACAGATGGGCCTAGG - Intergenic
976601975 4:86946238-86946260 GGGAGTGCAGAGAGGAATCAAGG - Intronic
976985269 4:91287665-91287687 GTAAGTGCACATATGTATTTAGG + Intronic
977409394 4:96642326-96642348 TGAAGTTCACAGATCAATATAGG + Intergenic
977993679 4:103476422-103476444 GGAAGTGCACAGATGAACCTAGG + Intergenic
979209399 4:118080892-118080914 GGAAAACCAAAGATGAATCTAGG + Intronic
979540686 4:121877543-121877565 GGAACTGCACAGGAGAATCTGGG + Intergenic
979689200 4:123542829-123542851 GGAAGTGCACAGATGGGCCTAGG - Intergenic
980933019 4:139199413-139199435 GGAAGTACACAGATGAGCCTAGG - Intergenic
982022649 4:151219107-151219129 GGAAGTACACAGATGGGACTAGG - Intronic
983004115 4:162461468-162461490 GGCAGTGGAGAGATGCATCTTGG - Intergenic
983426401 4:167589205-167589227 GGAAGTGCACATATGGACTTAGG + Intergenic
983927330 4:173416119-173416141 GGAAGTGGGCAGATGACTTTGGG - Intergenic
984438918 4:179740728-179740750 TTCAGTGCACAGATGAGTCTTGG + Intergenic
984719882 4:182959638-182959660 GGAAGTACACAGATGGGCCTAGG + Intergenic
985077772 4:186234208-186234230 AGAAGTGTCCAGATGAATATGGG - Intronic
985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG + Intronic
985948509 5:3204907-3204929 GCACGTGGACAGATGACTCTAGG - Intergenic
986613679 5:9594720-9594742 GGAAGTGCACAGATGGGCCCAGG + Intergenic
987027523 5:13942500-13942522 GGAAGTGTACAGATGGGCCTAGG - Intronic
987072237 5:14349511-14349533 GGAAGAGCACAGCTTAACCTTGG - Intronic
987259786 5:16191804-16191826 GGAAGTGCACAGATGGGCATAGG - Intergenic
989709972 5:44387212-44387234 GGAAGTCAACAGAGTAATCTGGG + Intronic
990276366 5:54201409-54201431 AGAAGTGCACAGATGGGTTTAGG - Intronic
990380636 5:55219466-55219488 TGAACTGCACAGATAAAACTGGG - Intergenic
991257811 5:64634351-64634373 GGAAGTACACAGATGGGCCTAGG + Intergenic
993953365 5:94202098-94202120 GGAAGTGCACAGATGGACCTAGG + Intronic
994865798 5:105268103-105268125 GGAAGTGCACAGATGAACGTTGG - Intergenic
996387385 5:122923728-122923750 GAAAGAACACAGGTGAATCTTGG + Intronic
998636269 5:143958360-143958382 GCAAGTGGACATATGAATCTGGG + Intergenic
999351277 5:150873953-150873975 TGAAGAGGACAGATGGATCTTGG + Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001939152 5:175728767-175728789 GGAAGTGAACATAGGAATGTAGG - Intergenic
1002130168 5:177076365-177076387 GGAAGTGCACAGATGGACCTAGG - Intronic
1002272521 5:178082022-178082044 GGAAGCACACAGATGGGTCTAGG - Intergenic
1005214960 6:23515145-23515167 GGAAGTGCACAGATGGACCTAGG - Intergenic
1005821612 6:29603810-29603832 GGAAGGGCACAGAAAAATGTAGG + Intronic
1006302058 6:33199086-33199108 GGAAGTTCACACAAGGATCTGGG + Intronic
1007199100 6:40090288-40090310 AGAAATGCAAAGATGAATATGGG + Intergenic
1007247434 6:40472591-40472613 GGAAGTGCACAAATCCAGCTCGG - Intronic
1007265497 6:40592620-40592642 GCAAGTGCTCAGGTGCATCTGGG + Intergenic
1008157195 6:48031086-48031108 GAAAGTGCACAGATTAGCCTAGG - Intronic
1008619215 6:53255378-53255400 GGAAGTGCAGTGGTGGATCTTGG + Intergenic
1008664477 6:53702496-53702518 GGAAGTGCCCAGAAGAGTCGTGG + Intergenic
1008766095 6:54916751-54916773 GATAGTACACAGATGAATGTGGG + Intronic
1009622895 6:66098277-66098299 GGAAGTGCACAGATGGGACGAGG + Intergenic
1010004816 6:70984102-70984124 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1010427540 6:75743748-75743770 GGAAGGACACAGATGGACCTAGG + Intergenic
1010508829 6:76692154-76692176 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1010917484 6:81638417-81638439 GGAAATGCGCAGATGAACTTAGG - Intronic
1011770250 6:90667737-90667759 GGATGTTAACACATGAATCTTGG + Intergenic
1014226375 6:118852569-118852591 GCAAGTTCACAGCTGAAGCTTGG - Intronic
1015996402 6:138999260-138999282 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1016443541 6:144109343-144109365 GGAAGTGCACAGATGGGCCCAGG + Intergenic
1016999089 6:149983272-149983294 GGAAGGTGACAGATGATTCTGGG + Intergenic
1017112917 6:150949512-150949534 GGAAGTGAACAGAAGAAGGTGGG - Intronic
1017554556 6:155548921-155548943 GTAAGTCCACAGCTGATTCTGGG - Intergenic
1019150425 6:170001818-170001840 GCAAGTGCACAGAAGAATTGAGG - Intergenic
1022378841 7:29841029-29841051 GGGAGTGCACAGATGGGCCTGGG + Intronic
1025963449 7:66245569-66245591 AGAAGTGCACAGATGGTCCTAGG + Intronic
1026819429 7:73537019-73537041 TGGAGGTCACAGATGAATCTTGG + Exonic
1028137017 7:87232618-87232640 GGAAGTGCACAGATGAGCCTAGG + Intergenic
1029221530 7:98994473-98994495 GGGAGTGCAGAGATGACCCTGGG + Intronic
1030440179 7:109579507-109579529 AGAAGTGCAGAGATGAACATGGG + Intergenic
1030785057 7:113650030-113650052 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1030989305 7:116281024-116281046 GGAAGTGCAAAGAGCAAACTGGG + Intergenic
1032850550 7:135791546-135791568 GGAAATGCACAGATTCATCTAGG - Intergenic
1033937164 7:146600757-146600779 GGAAATGCATAGATGAATAAGGG - Intronic
1033991048 7:147287422-147287444 GGAATTGCACAGATGGGCCTTGG + Intronic
1036151690 8:6305074-6305096 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1036744905 8:11399875-11399897 GAAAGTACACAGATGAGCCTTGG + Intronic
1037282244 8:17255070-17255092 GGAAATACAGAGATGAATATGGG - Intronic
1038779288 8:30556843-30556865 GGAAGGGGACAGAAGAGTCTAGG - Intronic
1039733920 8:40309549-40309571 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1039734246 8:40313877-40313899 GAAAGTGCACAGATGGGCCTAGG - Intergenic
1040891455 8:52321238-52321260 GGAGGAGCACAGAGGAAGCTGGG + Intronic
1041322331 8:56626168-56626190 GGAAGTGCAAAGATGGGCCTAGG - Intergenic
1041511746 8:58660404-58660426 GGAAGTGCACACAAGGACCTGGG + Intergenic
1042206798 8:66337724-66337746 GGAAGTGCACAGTTGGGCCTAGG - Intergenic
1042375490 8:68046438-68046460 TGAATTGCACAGATGGTTCTTGG + Intronic
1042584307 8:70318329-70318351 GGAAGTACACAGATGAGCCTAGG - Intronic
1044510323 8:93069947-93069969 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1047441799 8:124885239-124885261 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1047757241 8:127928084-127928106 GGAAGTACACAGATGGGCCTAGG - Intergenic
1050432911 9:5580115-5580137 AGAAGTCCACAGATGCATTTGGG - Intergenic
1051008976 9:12386652-12386674 GAAAGTGCATAGATTTATCTGGG + Intergenic
1051464397 9:17360610-17360632 GGAAGTGCACAGATGGGCTTAGG + Intronic
1051775991 9:20634621-20634643 GGAAGTGCACAAATGGGCCTAGG + Intergenic
1052533203 9:29714772-29714794 TGAAGGGCACAGCTGAATCCGGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053268156 9:36731018-36731040 GTAAGTGCACAGTCTAATCTGGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053537185 9:38937619-38937641 GGAAGTGCACAGATGGGCCTTGG + Intergenic
1054628950 9:67426311-67426333 GGAAGTGCACAGATGGGCCTTGG - Intergenic
1055804816 9:80081040-80081062 GGAGGTAGACAGATGATTCTTGG + Intergenic
1056531897 9:87495856-87495878 GGAAGGGCACACAGGAATCAAGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057137018 9:92698761-92698783 GGGAGTGCAGAGCTGAGTCTTGG - Intergenic
1057630334 9:96714913-96714935 GCAAGTGCACAGATGTGCCTAGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059306912 9:113360907-113360929 TGAAGTGCACAGATGGGCCTGGG - Intronic
1059512805 9:114865076-114865098 GCAACTGCACAGATAATTCTAGG + Intergenic
1059558271 9:115304858-115304880 GGAAATTCCCAGATGAATCAAGG + Intronic
1060013534 9:120065880-120065902 GGAAGTACACAGATGTGCCTTGG + Intergenic
1060035106 9:120248594-120248616 GTAAGTGAACAAATGAATCCTGG + Intergenic
1060564924 9:124582262-124582284 GCAAGGACACAGATGAAGCTGGG + Intronic
1061230100 9:129310727-129310749 GCAAGTGCACAGTTGTTTCTTGG + Intergenic
1061494459 9:130963756-130963778 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1185579841 X:1203414-1203436 GGATGTGGACAGATGTTTCTGGG - Intronic
1188421914 X:30000606-30000628 GGAAATGCACAAATGAATTTCGG + Intergenic
1190110204 X:47584427-47584449 GGAAGTGCACAGATGGGCCTAGG + Intronic
1190379748 X:49828418-49828440 GGAAATGCACAGATGGGCCTAGG + Intergenic
1190973862 X:55379966-55379988 GGGAGTGCAGAGCTGAACCTTGG + Intergenic
1192614242 X:72601628-72601650 GGAAGTGCACAAATGGGCCTAGG + Intronic
1193552499 X:82914332-82914354 GGAAGTGTACAGATGAGCCTAGG - Intergenic
1196143054 X:112286502-112286524 GGAAGCACAGAGATCAATCTCGG + Intergenic
1198505020 X:137292849-137292871 GAAAGTGCACAGATGAGCCAAGG + Intergenic
1199673775 X:150167321-150167343 GCAATTGCACAGATGCATCATGG - Intergenic
1200403618 Y:2785603-2785625 GGAAGTGCACAGGCGAGTCTAGG + Intergenic
1200773664 Y:7150633-7150655 GGAAGTACACAGGAGAATTTTGG - Intergenic
1201589648 Y:15601036-15601058 GGAAGTGCACAGATGGGCCTGGG - Intergenic