ID: 1107966228

View in Genome Browser
Species Human (GRCh38)
Location 13:45600796-45600818
Sequence TATGATAAACATACAGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 1, 2: 20, 3: 115, 4: 379}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107966227_1107966228 4 Left 1107966227 13:45600769-45600791 CCATATCTTTGCTATTGTGAATA 0: 481
1: 5486
2: 28466
3: 17467
4: 10872
Right 1107966228 13:45600796-45600818 TATGATAAACATACAGTTGCAGG 0: 1
1: 1
2: 20
3: 115
4: 379
1107966226_1107966228 29 Left 1107966226 13:45600744-45600766 CCGTTGGTGGACACTTAGGTTGA 0: 22
1: 297
2: 1035
3: 2493
4: 3783
Right 1107966228 13:45600796-45600818 TATGATAAACATACAGTTGCAGG 0: 1
1: 1
2: 20
3: 115
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107966228 Original CRISPR TATGATAAACATACAGTTGC AGG Intronic
900844728 1:5087949-5087971 TGTGATGAACTTACAATTGCAGG - Intergenic
901314828 1:8299569-8299591 TAGGAGAAAAATACAGCTGCAGG + Intergenic
902109476 1:14066268-14066290 TGTGATAAACATACCTGTGCAGG + Intergenic
905545338 1:38793560-38793582 TATGATCATCATACAGATGCTGG + Intergenic
906361207 1:45161206-45161228 AATGATAAACATCCAAGTGCAGG + Intronic
908309406 1:62862008-62862030 TATTATAAACATCCATGTGCAGG + Intronic
908595064 1:65679233-65679255 TGTGATAAACATACATATGCAGG + Intergenic
908884677 1:68774862-68774884 TGTGATAAACATACTAGTGCAGG - Intergenic
909322421 1:74306327-74306349 TATGATAAACATATGAGTGCAGG + Intronic
909743376 1:79061544-79061566 TGTGATAAACATACAAGTGCAGG - Intergenic
911077974 1:93898101-93898123 TTTGATAAACATATATTTGTTGG - Intronic
911136118 1:94442914-94442936 TATGATAAACATACCAGTGCAGG + Intronic
912100444 1:106197235-106197257 TACAATAAACATACAAGTGCAGG - Intergenic
912349971 1:109003025-109003047 TGCGATAAACATACACTTGCAGG - Intronic
912897119 1:113604174-113604196 TATGATAGACATACATAAGCAGG - Intronic
913054701 1:115147431-115147453 TGTGATAAACATATGGGTGCAGG - Intergenic
915085275 1:153383775-153383797 TTTGATAAACATACTAGTGCAGG - Intergenic
915762968 1:158333884-158333906 GAGGTTAAACAGACAGTTGCTGG + Intergenic
916706869 1:167359630-167359652 TGTGATAAACATGCAAATGCAGG + Intronic
917643354 1:177005517-177005539 TATGACAAACATATACATGCAGG - Intronic
918182729 1:182098650-182098672 TGTTATAAACATACATGTGCAGG + Intergenic
918561698 1:185876359-185876381 TATGATAAACATAGGATTGCAGG + Intronic
918872771 1:189997800-189997822 TTTGATAAACATATGATTGCAGG - Intergenic
919238067 1:194871984-194872006 TATGATAATCAAACAGTTATTGG + Intergenic
919696893 1:200586674-200586696 TGTGATAAGCATACACATGCAGG - Intronic
920891543 1:209992043-209992065 TGCAATAAACATACAGGTGCAGG - Intronic
920894689 1:210034923-210034945 TATGATAAACATAGAAGTGCAGG + Intronic
921407276 1:214794297-214794319 TGTGATAAACATACAATTGCAGG + Intergenic
922974648 1:229774044-229774066 TGTGATAAACATACGAGTGCAGG - Intergenic
923058647 1:230449760-230449782 TATTATTAACAAACAGTTACAGG + Intergenic
923229883 1:231975510-231975532 TGTGATAAACATACAAGTGCAGG - Intronic
923397990 1:233586355-233586377 TGTGATAAACATACAAGTTCAGG - Intergenic
923417598 1:233778978-233779000 TGTGATAAACATACAAGTGCAGG + Intergenic
923932359 1:238716525-238716547 TGTGATAAACATACATGTGTAGG - Intergenic
924141766 1:241031426-241031448 TGTGATAAACATACAAGTGCAGG + Intronic
924874825 1:248090735-248090757 TGTGATGAACATACATGTGCAGG + Intronic
1063729480 10:8679368-8679390 TGTGATAGACATATAGGTGCAGG - Intergenic
1064266383 10:13828908-13828930 TGTGATAAACATACAAGTGCAGG + Intronic
1064842449 10:19609841-19609863 TATGATAATCATTCATTTGAAGG + Intronic
1064969106 10:21045909-21045931 TGTGATAAACATGCGATTGCAGG - Intronic
1065766399 10:29034209-29034231 TACAATAAACATACAAGTGCAGG - Intergenic
1066760643 10:38747942-38747964 TGTAATAAACATGCAGGTGCAGG - Intergenic
1067140796 10:43655006-43655028 TATGCAAAACATATAGTTGTTGG + Intergenic
1068553300 10:58429880-58429902 GTTGATAAACATACAAGTGCAGG + Intergenic
1070434494 10:76376519-76376541 TGTGATAAACATACAAGTGCAGG + Intronic
1070900478 10:80023662-80023684 TGTGATAAGCATACAAATGCAGG - Intergenic
1070902223 10:80039542-80039564 TGTGATAAGCATACAAATGCAGG - Intergenic
1070988115 10:80705963-80705985 TATGATAAACATACAAGTGCAGG - Intergenic
1071105897 10:82094533-82094555 TGTGATAAACATACAAATGCAGG - Intronic
1071301518 10:84259337-84259359 TGTGATAAGCATACAAGTGCAGG + Exonic
1071313636 10:84369122-84369144 TGTGATAAACATACATATGCAGG + Intronic
1071662766 10:87521601-87521623 TATTAAAAACATAAAGTTGAGGG - Intronic
1072483869 10:95835389-95835411 TGTGATAAATATACAAGTGCAGG + Intronic
1074757822 10:116639202-116639224 TGTGATCAACATACAAGTGCAGG + Intronic
1075958879 10:126549705-126549727 TGTTATAAACATTCAGATGCAGG - Intronic
1078651815 11:13202279-13202301 TATGATGAACATACAAGTGCAGG - Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079286955 11:19143241-19143263 TATGACAAATATACTGGTGCTGG - Intronic
1079648891 11:22901584-22901606 TATCATATAGATACAGCTGCAGG + Intergenic
1079727577 11:23894948-23894970 TGTGATAAACATACATGTGCCGG - Intergenic
1079771251 11:24462442-24462464 CATGATAAACCTTCACTTGCAGG - Intergenic
1079861944 11:25683968-25683990 TCTGAGAAACATGGAGTTGCTGG - Intergenic
1080609267 11:33889833-33889855 TACGATAAACATACAAGTGCAGG - Intronic
1082274761 11:50209297-50209319 TATGATAAACATACAAGTGCAGG - Intergenic
1082276470 11:50227345-50227367 CATGATAAACATACAGGTGAAGG - Intergenic
1082637339 11:55612663-55612685 TGTTATAAAAATACAGTTTCAGG + Intergenic
1082915652 11:58433545-58433567 TTTGATAAAAATACAAGTGCAGG - Intergenic
1086051106 11:82591514-82591536 TGTGATAAACATACAAGTACAGG + Intergenic
1086235826 11:84629087-84629109 TATAATTAACAGGCAGTTGCAGG - Intronic
1086516192 11:87616113-87616135 TATGATAAACATAAGATTTCAGG + Intergenic
1086523017 11:87692943-87692965 TGTGATAAACATGCACATGCAGG + Intergenic
1086977657 11:93154844-93154866 AATAAGAGACATACAGTTGCTGG + Intronic
1087055475 11:93931821-93931843 TATGATAAACATCCACGTGCAGG - Intergenic
1088059040 11:105623167-105623189 TGTGATAAACATACAAGTGCAGG + Intronic
1088206005 11:107393575-107393597 TGGGATAAACATACAAGTGCAGG - Intronic
1088270586 11:108030339-108030361 TATGATAAGAATACAGTGGCTGG + Intronic
1088520766 11:110697022-110697044 TATGATGAACATAGAAATGCAGG + Intronic
1088629753 11:111763353-111763375 TATGATAATCCTACAGAGGCGGG + Intronic
1089875447 11:121717085-121717107 AATGTTCACCATACAGTTGCAGG + Intergenic
1090121285 11:124030601-124030623 TGTGAAAAACATACAGGGGCAGG + Exonic
1090947345 11:131442929-131442951 TGTGATAAACACACACGTGCAGG + Intronic
1091282295 11:134388905-134388927 TGCGATGAACATACAGGTGCAGG + Exonic
1093395433 12:18675561-18675583 AGTGACAAACATACAGGTGCAGG - Intergenic
1094322118 12:29196147-29196169 TGTGATAAACATACAAGTGCAGG + Intronic
1094397140 12:30020109-30020131 TGTGATAAACATACAAATGCAGG - Intergenic
1094525831 12:31230052-31230074 TAAAAAACACATACAGTTGCAGG - Intergenic
1094732202 12:33190905-33190927 TATGATAAACATGCAAGTGCAGG + Intergenic
1095529690 12:43172162-43172184 AATAATAAACCTACAGTTCCAGG - Intergenic
1097152569 12:56990299-56990321 TGTGATAAACATACTAGTGCAGG - Intergenic
1097285925 12:57877281-57877303 TATGATGAAAATTCAGTTACAGG + Intergenic
1097319993 12:58214742-58214764 TATGATGAACATATATGTGCAGG + Intergenic
1097477676 12:60078921-60078943 TATAATAAACATACACATACAGG + Intergenic
1097649991 12:62285735-62285757 TGTGATAAACATACAAGTGCAGG + Intronic
1098185919 12:67896214-67896236 TGTGATAAGCATACAAGTGCAGG + Intergenic
1098445216 12:70559740-70559762 TATGATAATAATATAGTAGCAGG + Intronic
1098500077 12:71181873-71181895 TGTGATAAACATACACATTCAGG - Intronic
1098836941 12:75434757-75434779 TGTGATAAACATATGGATGCAGG - Intergenic
1099015436 12:77338475-77338497 AAAAATAAACATACATTTGCTGG + Intergenic
1099301725 12:80903631-80903653 TGTGATAAACATACAATTGCAGG + Intronic
1099314942 12:81072671-81072693 TGTGATAAACACACGGATGCAGG - Intronic
1099926492 12:89024885-89024907 TGTGATAAACATACAAATGCAGG + Intergenic
1102402692 12:112643857-112643879 TGTGATAAACATACAAGTGTAGG - Intronic
1104781628 12:131424635-131424657 TATGAAAAACATACATTAACAGG + Intergenic
1105669593 13:22597630-22597652 TGTGATAAACATGCAAGTGCAGG - Intergenic
1105994434 13:25656635-25656657 TATTATTAACATACATTTTCTGG + Intronic
1107311090 13:39079087-39079109 TGTGATAAACATTCAAATGCAGG - Intergenic
1107966228 13:45600796-45600818 TATGATAAACATACAGTTGCAGG + Intronic
1108163056 13:47662911-47662933 TTTGATAAACATACAAGTGCAGG - Intergenic
1108325318 13:49325009-49325031 CATTATAAACATTCAGTAGCAGG + Intronic
1108882592 13:55139092-55139114 TATGATAAACATTCAACTGCAGG + Intergenic
1109394593 13:61739612-61739634 TGTAATAAACATACACATGCAGG + Intergenic
1109679566 13:65732728-65732750 TATGATAATGAGACAGTTCCTGG + Intergenic
1109680631 13:65747833-65747855 TTTCAGACACATACAGTTGCCGG + Intergenic
1109841258 13:67919768-67919790 TATAATAAACATACAAATTCAGG - Intergenic
1109883171 13:68508294-68508316 TGTGATAAACATATAAGTGCAGG + Intergenic
1110050225 13:70887491-70887513 TATTATAAAAATTCAGTTGTAGG + Intergenic
1110059598 13:71025131-71025153 TGTGATAAACATACAAGTGCAGG + Intergenic
1110362847 13:74647079-74647101 TAGGAGAAAGATACACTTGCAGG - Intergenic
1110603818 13:77408197-77408219 TATGATAACCATACAAATGCAGG - Intergenic
1110675156 13:78233912-78233934 TGCGATAAACATACAAATGCAGG + Intergenic
1110887800 13:80659702-80659724 TGTGATAAACACACATATGCTGG + Intergenic
1113252078 13:108464607-108464629 TGTGATGAACACACAGGTGCAGG - Intergenic
1114684578 14:24516425-24516447 TATGATAACCATACAAGTGCAGG + Intergenic
1115324274 14:32120762-32120784 TATAATAAACATTCAGTTCAAGG - Intronic
1115719041 14:36139509-36139531 TCTCATAATCATCCAGTTGCAGG - Intergenic
1115945019 14:38650071-38650093 TGTAATAAACACACAGGTGCAGG + Intergenic
1116011776 14:39359780-39359802 TGTGATAAACACACAAGTGCAGG + Intronic
1116202695 14:41819178-41819200 TGTGATAAACATACCAGTGCAGG + Intronic
1116274707 14:42817586-42817608 TTTGATAAACACACAGAAGCAGG - Intergenic
1116359822 14:43979591-43979613 TGTGATAAACATAAAAATGCAGG + Intergenic
1116369821 14:44116093-44116115 TGTGATAAACATACAAATGCAGG + Intergenic
1116885802 14:50220054-50220076 TATGCTAAGCATACAGGTGTAGG - Intronic
1119709319 14:76810025-76810047 TCTGATTAACAGTCAGTTGCTGG - Intronic
1119970571 14:78965531-78965553 TAAGATAAAGTAACAGTTGCTGG + Intronic
1123766723 15:23487647-23487669 TGTGATAAACATACAAATGCAGG - Intergenic
1123973421 15:25530088-25530110 TGTGATAATCATACAAGTGCAGG + Intergenic
1125073907 15:35590488-35590510 TGTGATAAACATACATGTGCTGG + Intergenic
1125764899 15:42128110-42128132 TGTGATAAACATAAAAGTGCAGG + Intergenic
1126220279 15:46205437-46205459 TATTATAAACATATATTTCCAGG + Intergenic
1127805418 15:62515208-62515230 TATGATAAATATACTTTTGGGGG - Intronic
1128087531 15:64896259-64896281 TATGCTAGACACACAGATGCCGG - Intronic
1129562938 15:76590729-76590751 TGTGATAAACATACAAGTGCAGG - Intronic
1131572910 15:93557235-93557257 TGTGATAAACATACAAGTACAGG + Intergenic
1133178892 16:4037510-4037532 TGTGATGAACATACAAGTGCAGG + Intronic
1135506848 16:23045523-23045545 TGCGATAAACATACAAGTGCAGG - Intergenic
1135866538 16:26107842-26107864 TGTGATAAACATACGTGTGCAGG + Intronic
1136722121 16:32330085-32330107 TGTAATAAACATGCAGGTGCAGG + Intergenic
1136840445 16:33536052-33536074 TGTAATAAACATGCAGGTGCAGG + Intergenic
1137067085 16:35858129-35858151 TGTGATAAACATACATGTGCAGG - Intergenic
1137337428 16:47564126-47564148 TGTGATAAATATACACATGCAGG + Intronic
1137510796 16:49098351-49098373 CAGGATAAACATACAAATGCAGG - Intergenic
1137823756 16:51470929-51470951 TATTATAAAGACACAATTGCTGG + Intergenic
1138919318 16:61507997-61508019 TGTGATAAACATACAAGTACAGG - Intergenic
1138938984 16:61766439-61766461 TGTGATAAACATACACATGCAGG + Intronic
1139048267 16:63090092-63090114 TATGATAAACATACAAATGCAGG - Intergenic
1139122696 16:64040370-64040392 TATCATAAAAATACTGATGCTGG - Intergenic
1139142005 16:64276781-64276803 CATAATAAACATACAAATGCAGG - Intergenic
1139142065 16:64277739-64277761 TGTAATAAACATACAGGTGCAGG - Intergenic
1140336521 16:74112102-74112124 TGTGATAAACATACAAGGGCAGG - Intergenic
1140501506 16:75437434-75437456 CAAGATAAACAAATAGTTGCCGG - Intronic
1141332415 16:83123655-83123677 TATGATAAACACACAAGTGCAGG + Intronic
1141474196 16:84261176-84261198 TATGAGAGACAAACAGTGGCTGG - Intergenic
1203004310 16_KI270728v1_random:187689-187711 TGTAATAAACATGCAGGTGCAGG - Intergenic
1203135920 16_KI270728v1_random:1724107-1724129 TGTAATAAACATGCAGGTGCAGG - Intergenic
1203150611 16_KI270728v1_random:1836345-1836367 TGTAATAAACATGCAGGTGCAGG + Intergenic
1142923284 17:3209970-3209992 GATGATAAAAAGCCAGTTGCTGG - Intergenic
1143291488 17:5834659-5834681 AATGAATCACATACAGTTGCTGG - Intronic
1145855662 17:28154528-28154550 TATTGTAAACATCCAGTGGCAGG + Intronic
1146721124 17:35124231-35124253 TATGATAAAAATAAACTGGCTGG + Intronic
1148247355 17:46042339-46042361 GATGATAAACACACAGTGCCTGG - Intronic
1149024187 17:52005802-52005824 TATGATAAACAACCAGCGGCTGG + Intronic
1150964735 17:69955335-69955357 TTTGATAAACATACAAGTGCAGG - Intergenic
1155735314 18:29215172-29215194 TCTGATAAACCTACATTTGGGGG + Intergenic
1155969925 18:32072983-32073005 TATGATAAACATTCAATAACTGG - Exonic
1156272674 18:35551430-35551452 TATGATAAAAATTGAGGTGCGGG + Intergenic
1156895208 18:42238573-42238595 TGTGATAAACATACAGGTGCAGG + Intergenic
1158702121 18:59757677-59757699 TGTGATAAACATACGCGTGCAGG + Intergenic
1159148244 18:64482762-64482784 TGTGATAAACATATGGGTGCAGG + Intergenic
1159164079 18:64681276-64681298 TGTTATAAACATCCATTTGCAGG + Intergenic
1159482849 18:69013061-69013083 TGTAATAAACATACAGGGGCAGG - Intronic
1159712171 18:71774350-71774372 TATGATAAACATGCAAGCGCAGG + Intronic
1161866775 19:6838645-6838667 GATGATAAACAGACAGGTGATGG - Intronic
1162178943 19:8853402-8853424 TGTGATAAACACACAGGTTCAGG - Intronic
1162181090 19:8869208-8869230 TGTGATAAACACACAGGTGCGGG - Intronic
1162202527 19:9031184-9031206 TGTGATAAACCTACAAGTGCAGG - Intergenic
1164598465 19:29545784-29545806 TATGATGAACATACAGGTGCAGG + Intronic
1164922768 19:32102061-32102083 TACAATAAACATACAAATGCAGG + Intergenic
1165263767 19:34643100-34643122 TGTGATAAACATACAAGTGCAGG - Intronic
1165366425 19:35370083-35370105 TGTGACAAACATACACATGCAGG - Intergenic
1168198441 19:54794105-54794127 TGCAATAAACATACAGGTGCAGG + Intronic
925042317 2:741122-741144 TTTGATAGACTTACAGTTTCTGG - Intergenic
925679372 2:6401682-6401704 TATGATAAACATTTAAGTGCAGG + Intergenic
926273391 2:11385111-11385133 TATTATAAACCCACAGTTACAGG - Intergenic
926327943 2:11801296-11801318 TGTGATAAACATGGAGATGCAGG - Intronic
927254775 2:21031144-21031166 TGTGATAAACATATGGGTGCAGG - Intronic
927364574 2:22279142-22279164 TGTGATAAACATACAAGTGTGGG + Intergenic
930555497 2:52890354-52890376 TATGATAAACATATAAATGCAGG + Intergenic
932795809 2:74694979-74695001 TGTTATAAACATACATGTGCAGG + Intergenic
932815700 2:74859862-74859884 TGTGATAAACATACAAGTGCAGG - Intronic
932872639 2:75418164-75418186 TATAATAAACATATACTTACTGG + Intergenic
933294853 2:80477841-80477863 TGTGATAAACATACACATGCAGG + Intronic
933475739 2:82788290-82788312 TGTGATAAACATACAAATGCAGG - Intergenic
933538473 2:83608208-83608230 TGTGATAAACATACAATTTCAGG - Intergenic
934894066 2:98097546-98097568 TGTGAGAAACATACATGTGCAGG + Intronic
935313651 2:101809886-101809908 AATGATTTACATACAGTTGCAGG - Intronic
935476837 2:103532649-103532671 TGCTATAAACATACACTTGCAGG + Intergenic
935489705 2:103702427-103702449 TTTGATAAACATATAAGTGCAGG + Intergenic
935709003 2:105881163-105881185 CATGAGAAAAATACGGTTGCTGG - Intronic
938799250 2:134745672-134745694 TATGAAAAAGAGACAGTTCCTGG + Intergenic
939831124 2:147072346-147072368 TGTGATAAACATAAAAGTGCAGG + Intergenic
940946089 2:159619808-159619830 TAACATAATCATACAGTTGAGGG + Intergenic
941044924 2:160664020-160664042 TATGATACAAATACAATTGCAGG + Intergenic
941692912 2:168519878-168519900 TGTGATGAACATACAAGTGCAGG + Intronic
941997561 2:171615058-171615080 TGTGATAAACATACAAGTGCAGG - Intergenic
942643574 2:178086966-178086988 TGTGATAAACATACAGATGCAGG - Intronic
942992634 2:182219723-182219745 TATCATAAATATTCAGTGGCAGG - Intronic
943212172 2:184980956-184980978 TTTGACAAAGATGCAGTTGCTGG - Intergenic
943372749 2:187036009-187036031 TATTATAGAGATTCAGTTGCAGG - Intergenic
943391134 2:187269347-187269369 TGTGATGAACATACAAGTGCAGG + Intergenic
943606219 2:189980104-189980126 TGTGATAAACAGACAAGTGCAGG - Intronic
943901666 2:193446507-193446529 TATGATAAACATACAATTGCAGG + Intergenic
945704212 2:213209055-213209077 GATGATAAAAATTCAGTTGAAGG - Intergenic
1168747045 20:252654-252676 TGTAATAAACATACAAGTGCAGG + Intergenic
1169880968 20:10346004-10346026 TATAATAAACATACATTTATTGG - Intergenic
1171286319 20:23941625-23941647 TGTGATAAAAATACAAGTGCAGG - Intergenic
1172205345 20:33159294-33159316 TATGAGAAACATGGAGTAGCAGG - Intergenic
1173044425 20:39495932-39495954 TATGATAAACATACAAGTACAGG - Intergenic
1173490526 20:43476367-43476389 TATGATAATCATACAAATGCAGG - Intergenic
1174785912 20:53432423-53432445 TGTGATAAACATACATGTGCAGG + Intronic
1175019358 20:55827888-55827910 TGTGATAAACATACTACTGCAGG + Intergenic
1175462435 20:59161711-59161733 TGTGATAAACATACGAGTGCAGG + Intergenic
1175829799 20:61957171-61957193 TGTGATAAACACACATGTGCAGG - Intronic
1177029707 21:15967278-15967300 TATGATGAACAGCCAGATGCAGG - Intergenic
1177448155 21:21225866-21225888 TATGATAAACATATAAATGCAGG - Intronic
1177450922 21:21264536-21264558 TATTATAAACATACAAGTCCAGG - Intronic
1178197399 21:30363099-30363121 TATGATAACCATACCAGTGCAGG - Intronic
1178606144 21:34037653-34037675 TGTGATAAACCTACAGATGCCGG + Intergenic
1178677535 21:34644018-34644040 TAAGTTAAACATAAAGTTTCTGG - Intergenic
1179318326 21:40266541-40266563 TGTGATAAACATAGACATGCAGG - Intronic
1181613113 22:24032763-24032785 TATGATAAAGTTGCAGTTTCTGG + Intronic
1184625450 22:45724136-45724158 TGTGATAAACATACGCGTGCAGG + Intronic
949316325 3:2759669-2759691 TATGTTTAACATACAGTAACTGG + Intronic
949753901 3:7386718-7386740 TGTGATAAACATTCAAGTGCGGG + Intronic
951094561 3:18613527-18613549 AATAATAAAAAAACAGTTGCTGG + Intergenic
951514706 3:23545704-23545726 TGTGATAAACATATATGTGCAGG - Intronic
952519059 3:34136923-34136945 TGTGATAAACATACCAGTGCAGG - Intergenic
952685263 3:36140620-36140642 TGTGATAAACATACAAATGTAGG + Intergenic
955123372 3:56084397-56084419 TGTGATAAACATACACATACAGG - Intronic
956055852 3:65298202-65298224 TATTAAAAACATACATTGGCCGG + Intergenic
956223905 3:66934594-66934616 TAGCATATACATACAGTTACAGG + Intergenic
956615675 3:71169616-71169638 TAAGATGAAGATACATTTGCGGG - Intronic
957023623 3:75153083-75153105 TGTGATAAACATACACATGCTGG + Intergenic
957592332 3:82215948-82215970 TGTGATAAACATACAATTGCAGG + Intergenic
958265268 3:91430796-91430818 TGTGATAAACATAAAAGTGCAGG + Intergenic
958452381 3:94289897-94289919 TATAATAAACATACAAGTACAGG + Intergenic
958811854 3:98868918-98868940 TATGATAAACATACTAGTGCAGG + Intronic
960717318 3:120589505-120589527 TACTATAAACATCCACTTGCAGG - Intergenic
961994399 3:131226368-131226390 TGTGATAAACATAAACGTGCAGG - Intronic
963026153 3:140921311-140921333 TATTATAAACATCCATGTGCAGG + Intergenic
963177848 3:142320025-142320047 TGTGATAAACATACAAATGCAGG + Intronic
963967935 3:151394383-151394405 TGTGTAAAACATACAGTTGTTGG - Intronic
964488208 3:157207495-157207517 TATGATAAACATATGAATGCAGG - Intergenic
964929782 3:162002952-162002974 TATGATAAACATACAAGTAGAGG + Intergenic
965423719 3:168495767-168495789 TATCATAAATATACACTGGCAGG - Intergenic
965559472 3:170047591-170047613 TATGATAAACATATGCATGCAGG - Intronic
965716434 3:171609417-171609439 TGTGATAAACATACAAGTGCAGG - Intronic
966254985 3:177907816-177907838 TATAATAAAAATTCAGTGGCTGG + Intergenic
966323194 3:178723934-178723956 CATGGTAAACATACAAGTGCAGG + Intronic
966340502 3:178920537-178920559 TGAGATAAACATACAAGTGCAGG - Intergenic
967045194 3:185730402-185730424 GATGATAAACATACAAGCGCAGG + Intronic
967328955 3:188271292-188271314 TATGTTCAACACATAGTTGCAGG + Intronic
968890064 4:3364063-3364085 TATGAATAAAATACAGTTCCTGG - Intronic
970310195 4:14774752-14774774 TGTGATAAACATACAGGTGCAGG - Intergenic
970482402 4:16489777-16489799 TAAGATAAACATACTGTTTCTGG - Intergenic
970773380 4:19642316-19642338 TACAATAAACATACAAATGCAGG + Intergenic
970799633 4:19957264-19957286 TGTGATAAACATATAAGTGCAGG - Intergenic
971104360 4:23506331-23506353 TGTGATAAACATACGCATGCAGG + Intergenic
971147049 4:23989113-23989135 TTTGATAAATATATACTTGCAGG - Intergenic
971628380 4:28955070-28955092 TGTGATGAACATACAAATGCAGG + Intergenic
972179994 4:36452261-36452283 TTTGATGAACATACATGTGCGGG - Intergenic
972232291 4:37088344-37088366 TGTGATAAACATACAAGTGCAGG + Intergenic
972920642 4:43937054-43937076 TGTGATAAACATACAAGTGCAGG - Intergenic
973020732 4:45202797-45202819 TGTGATAAGCATACAAGTGCAGG + Intergenic
973096417 4:46206781-46206803 TGTGATCAACATACAAGTGCAGG - Intergenic
973577635 4:52306715-52306737 TGTGGTAAACATACAAGTGCAGG + Intergenic
973633794 4:52843476-52843498 TATGATAAAGATGCAGTGTCTGG - Intergenic
974081944 4:57223054-57223076 TATCATAAACACACATGTGCAGG + Intergenic
974472957 4:62341505-62341527 TGTGATAAACATACAGGTGCAGG - Intergenic
975701203 4:77068345-77068367 TATGATAAAACTACATTGGCAGG + Intronic
975791109 4:77951984-77952006 TATGATAATCATACAAATGCAGG + Intronic
977100850 4:92813152-92813174 TATGATAAAAATATATTTCCTGG + Intronic
977424480 4:96849831-96849853 TATGATTAACTTAGAGTTGTAGG - Intergenic
977509562 4:97945509-97945531 TACAATAAACATACACATGCAGG + Intronic
978029508 4:103922360-103922382 TATAATTCACATACTGTTGCAGG + Intergenic
978483720 4:109225639-109225661 TCTGATACACATACAAGTGCAGG - Intronic
978554660 4:109966492-109966514 TGTGATAAACATACAAGTGCAGG + Intronic
979132395 4:117063811-117063833 TATGAAAAACATACATATGAGGG - Intergenic
979300793 4:119084948-119084970 TGTGATAAACATACAGGTGCAGG - Intergenic
979454738 4:120914696-120914718 TGTGATAAACATACATGTGCAGG - Intronic
979620636 4:122795196-122795218 TATTATAGACATTCAGTTGTAGG + Intergenic
980100443 4:128536510-128536532 TATAATAAACATGCAAGTGCAGG + Intergenic
980378607 4:131979236-131979258 TGTGATAAACATACAGGTGCAGG - Intergenic
980531034 4:134054821-134054843 TATGATAAACATTCATGTACAGG + Intergenic
980851258 4:138385442-138385464 AAAGAGAAACATAAAGTTGCAGG - Intergenic
981165935 4:141556964-141556986 TGTGATAAACATATAAGTGCAGG + Intergenic
981438949 4:144760288-144760310 TGTGATAAACATACATGTGCAGG - Intergenic
981918983 4:150066463-150066485 TATGCTACACATAAAGGTGCTGG + Intergenic
982071303 4:151697172-151697194 TGTGATAAACATTCGCTTGCAGG - Intronic
982608541 4:157544033-157544055 TGCGATAAACATACAAGTGCAGG + Intergenic
982672751 4:158341505-158341527 TATGATAAAAAAACAGTTTAAGG + Intronic
982762655 4:159305129-159305151 TGCAATAAACATACAGGTGCAGG + Intronic
983423008 4:167544717-167544739 TATGATAAACATACAAGTGTAGG + Intergenic
983745944 4:171200484-171200506 TGTAATAAACATACATCTGCAGG - Intergenic
983859531 4:172687841-172687863 GATTATAAATATTCAGTTGCTGG + Intronic
984041972 4:174746184-174746206 TGTGATAAACGTACAAGTGCAGG - Intronic
984107905 4:175573212-175573234 TATGATAAACACACAAGTGCAGG + Intergenic
984321743 4:178206382-178206404 TACAATAAACATACAAATGCAGG - Intergenic
985596335 5:791449-791471 TGTGATAAACATACAAGTGCAGG - Intergenic
986277703 5:6293768-6293790 TATGATAAACATGCAAGTGCAGG + Intergenic
986931030 5:12821642-12821664 TATGATAAACATACAAGTGGAGG + Intergenic
987223548 5:15816150-15816172 TGTGATAAACATATAGGTGCAGG - Intronic
987878079 5:23706846-23706868 TATTATAAAGATTCAGTTGCAGG + Intergenic
988152248 5:27399444-27399466 TGTTATAAACATACAAGTGCAGG - Intergenic
988446273 5:31289420-31289442 TATGATAAACATATGAATGCAGG + Intronic
988820426 5:34878884-34878906 TACGATAAACATACAAGTGCAGG - Intronic
989078665 5:37592044-37592066 TATGAAAAACCTACAGGTTCAGG + Intronic
989236502 5:39154178-39154200 TATCATCAGCATACCGTTGCTGG + Intronic
989237557 5:39166484-39166506 TGTGATAAACATACAAGTGCAGG - Intronic
989534054 5:42543084-42543106 TGTGATAAACATACATGAGCAGG + Intronic
990081450 5:51920191-51920213 GATAATAAACATACACCTGCAGG + Intergenic
991147867 5:63328239-63328261 TGTGATAAACATACAAATGCAGG + Intergenic
991540942 5:67727382-67727404 TGTAATAAACATACACATGCAGG - Intergenic
993086501 5:83369701-83369723 TGTGATGAACATACAGGTGCAGG + Intergenic
993564870 5:89461347-89461369 TGTCATAAACATACAAGTGCAGG - Intergenic
993977336 5:94498454-94498476 GATGATTAAAATACAGTTGAAGG + Intronic
994021798 5:95035261-95035283 TGTGATAAACATATAAATGCAGG - Intronic
994046131 5:95312519-95312541 TGTGATAAACATATAAGTGCGGG - Intergenic
994337033 5:98579082-98579104 TGTGATAAACATATAAGTGCAGG + Intergenic
994942603 5:106344441-106344463 TATGATAAACATATGAGTGCCGG - Intergenic
994995156 5:107052776-107052798 TATGAAAAGTCTACAGTTGCTGG + Intergenic
995117524 5:108498726-108498748 TGTGATAAGCATACAAGTGCAGG + Intergenic
995203499 5:109452518-109452540 ATTTATAAACATAGAGTTGCTGG - Intergenic
995782103 5:115788440-115788462 TGAGCTAAATATACAGTTGCAGG - Intergenic
996165792 5:120221166-120221188 TGTGATAAACATAAAAGTGCAGG + Intergenic
996194085 5:120581997-120582019 TGCGATAAACATACCATTGCAGG - Intronic
996274777 5:121651562-121651584 TATGATAAATATTCAAATGCAGG - Intergenic
996504046 5:124249280-124249302 TGTGATAAACATACATGTGCAGG - Intergenic
996962771 5:129271055-129271077 TATCATAAACATCCATTTGCAGG - Intergenic
997045115 5:130306824-130306846 CATGATAAACATCCAAGTGCAGG - Intergenic
999025413 5:148225147-148225169 TGTGATAAACATATAAGTGCAGG + Intergenic
999510702 5:152248392-152248414 TATGATAAAATGACAGTGGCAGG + Intergenic
1000107636 5:158075478-158075500 TTGCATAAACATAAAGTTGCCGG - Intergenic
1000134106 5:158328173-158328195 TACTATAAACATCCATTTGCAGG + Intergenic
1000625803 5:163536761-163536783 TATAATGAACATACATGTGCAGG + Intergenic
1000696080 5:164386032-164386054 TGTGATAAACATACGAGTGCAGG - Intergenic
1001090100 5:168733480-168733502 TGTGATAGACATACAAGTGCAGG - Intronic
1003002674 6:2350626-2350648 TGTGATAAACATACAAGGGCAGG + Intergenic
1003080871 6:3020234-3020256 TGTGATGAACATACAAGTGCAGG + Intergenic
1003667605 6:8126325-8126347 TATGATAAACACACACGTGCAGG - Intergenic
1003943276 6:11049575-11049597 TATGATGAACATACAAGTGCAGG + Intergenic
1004612258 6:17254088-17254110 TGTGATAAACATACAAGTGCAGG - Intergenic
1004639607 6:17502705-17502727 TGTTATAAATATACAGTTTCTGG + Intronic
1004913555 6:20309993-20310015 TACAATAAACATACAGGTACAGG - Intergenic
1005159430 6:22841972-22841994 CATGATAAATATACAAATGCAGG - Intergenic
1005280934 6:24272900-24272922 TGTGATAAAAATACAAGTGCAGG - Intronic
1005345892 6:24890193-24890215 TACATTAAACATACAGGTGCAGG - Intronic
1006933489 6:37701501-37701523 TCTGAAAATCATACAGTGGCAGG + Intergenic
1006967029 6:37998007-37998029 CATGATAAACATTCATATGCAGG - Intronic
1007314373 6:40973719-40973741 TGTGACAAACATACACATGCAGG + Intergenic
1008649212 6:53546023-53546045 TATGATAAATACACACTTTCTGG - Intronic
1009178684 6:60490400-60490422 TGTGATAAACATAAAAGTGCAGG - Intergenic
1009308853 6:62124690-62124712 TATGATAAATACACAAGTGCAGG + Intronic
1009487945 6:64249090-64249112 TATGATAAACATATGAGTGCAGG - Intronic
1009624415 6:66120860-66120882 TACAATAAATATACAGGTGCAGG + Intergenic
1010272601 6:73931220-73931242 TATGATGAACATACAAGTGCAGG + Intergenic
1010498353 6:76563916-76563938 TGTGATAAACATACAGGTGTAGG + Intergenic
1010658938 6:78546215-78546237 TATGATAAACATATGAGTGCAGG - Intergenic
1011066499 6:83332447-83332469 TGTGATAAACATACATGTGCAGG - Intronic
1011294725 6:85814060-85814082 TGTGATAAACATACAGGTGCAGG + Intergenic
1011585017 6:88915308-88915330 TGTGGTAAACATACAAGTGCGGG - Intronic
1011866924 6:91840710-91840732 TGTGATAAACATACAAGTGCAGG + Intergenic
1012822121 6:104098443-104098465 TAAGATAAATATACAGTTTTTGG - Intergenic
1012830540 6:104199223-104199245 TGTGATAAACATACATGTGCAGG - Intergenic
1013471114 6:110466816-110466838 TGTGATAAACAGACAAATGCAGG - Intronic
1013506148 6:110802223-110802245 TATGATAAATATACGAGTGCAGG - Intronic
1013661707 6:112304365-112304387 TCTGATAAACATACTAGTGCAGG + Intergenic
1014396862 6:120934433-120934455 TGTGATAAACATACAAGTGCAGG - Intergenic
1014545560 6:122731292-122731314 TATGATAAATATACTGGTGTAGG - Intergenic
1014705536 6:124742032-124742054 TATGAGAAACATAGAGTTGATGG - Intronic
1015175456 6:130302619-130302641 TGAGATAAACATACAAGTGCAGG - Intronic
1015255986 6:131179982-131180004 TGTGGAAAACATACATTTGCAGG - Intronic
1016253382 6:142073431-142073453 TGTGATAAACATATGATTGCAGG - Intronic
1016633845 6:146264985-146265007 TCTGATAAACATACAATTGCAGG + Intronic
1016689539 6:146920883-146920905 TGTGATAAACATAAACGTGCAGG - Intergenic
1016865615 6:148762953-148762975 TATGATAAACATACAAGGGCAGG + Intronic
1018943796 6:168330430-168330452 ACTGATGAACATTCAGTTGCTGG + Intergenic
1019033968 6:169039199-169039221 TGTGATAAACATACAAGGGCAGG - Intergenic
1020534656 7:9381703-9381725 TGTGATAAACATATAAATGCAGG + Intergenic
1021437328 7:20634347-20634369 TACAATAAACATACAAGTGCAGG + Intronic
1021622308 7:22560878-22560900 TTTATTAAACATACAGATGCAGG - Intronic
1021770079 7:23990969-23990991 TGTGATAAACATACACAGGCAGG - Intergenic
1022100653 7:27167107-27167129 AATGAAAAACACACTGTTGCAGG - Intronic
1024187237 7:46962812-46962834 TGTGATGAACATACAAGTGCAGG - Intergenic
1024909273 7:54426881-54426903 TATGATAAGCATATAGATCCTGG + Intergenic
1025072000 7:55907909-55907931 TGTGATAAACATACAAGTGCAGG + Intronic
1025215841 7:57055453-57055475 TGCGATAAACATACAAGTGCAGG - Intergenic
1025655538 7:63515249-63515271 TGCGATAAACATACAAGTGCAGG + Intergenic
1026190352 7:68120101-68120123 TGTGATAAACATACAAGTGCAGG - Intergenic
1026317994 7:69244057-69244079 TGTGAAGAACATACAGGTGCAGG + Intergenic
1026414948 7:70170018-70170040 TATTAAAAACATTCATTTGCTGG + Intronic
1026591696 7:71701622-71701644 TGTGATGAACATACAAGTGCAGG - Intronic
1026944639 7:74307785-74307807 TATGAAGAACCTACTGTTGCCGG - Intronic
1029958649 7:104666943-104666965 TATGATAAACACGGAGGTGCAGG + Intronic
1031163945 7:118204304-118204326 AATGATAAGCATACACATGCAGG - Intergenic
1031603853 7:123746936-123746958 AATGAAAAAAATTCAGTTGCTGG - Intronic
1031812005 7:126382124-126382146 TATGTTCAACATACATTTGAAGG + Intergenic
1032331168 7:130981510-130981532 TGTGATAAACATACGAGTGCAGG - Intergenic
1034205671 7:149312342-149312364 TGTGATAAACATACAAGTGAAGG + Intergenic
1034576569 7:152004902-152004924 TGTGATAAACATACAATGGCAGG + Intronic
1034784638 7:153914422-153914444 TCTTATAAACATACAGCTCCAGG - Intronic
1035902656 8:3474280-3474302 TATGATAATCATACAAATGCAGG + Intronic
1036724281 8:11205720-11205742 AATGATATACAAAGAGTTGCAGG + Intergenic
1036832307 8:12030456-12030478 TATGATAAACAAACAGGTATTGG - Intergenic
1037183954 8:16039323-16039345 TAAGATAATCACACAGTTCCAGG + Intergenic
1037478494 8:19280762-19280784 TATGATAAACATACATGTATGGG + Intergenic
1038309137 8:26432175-26432197 TGTGATAAACATACAAGTGCAGG + Intronic
1038754445 8:30327625-30327647 TATAATGAACATACATTTACTGG + Intergenic
1038858048 8:31354604-31354626 TGTGATAAACATACACATGCAGG - Intergenic
1039091005 8:33829620-33829642 TGTGATAAACATACAAGTGCAGG + Intergenic
1039231092 8:35449142-35449164 TGTGATAAACATACAAGTACAGG + Intronic
1039446094 8:37634115-37634137 TGTGATAAACACACAAGTGCAGG - Intergenic
1039786584 8:40839515-40839537 TGTAATAAACATACAAGTGCAGG - Intronic
1039836160 8:41258006-41258028 TGTAATAAACATACAGGTGTAGG + Intergenic
1040656656 8:49518407-49518429 TGTGATACACACACAGGTGCAGG - Intergenic
1042123839 8:65516830-65516852 AAAGATAAAAATCCAGTTGCAGG + Intergenic
1042447412 8:68902443-68902465 TGTGATAAATATACAGGTACAGG - Intergenic
1042702708 8:71634289-71634311 TGTGATAAACACACAAGTGCAGG + Intergenic
1042770812 8:72380097-72380119 TGTGATAAACTTACGGGTGCAGG - Intergenic
1042784525 8:72533624-72533646 TGTGATAAACATGTTGTTGCAGG + Intergenic
1042943814 8:74134671-74134693 TATGATAAACATATGAGTGCAGG - Intergenic
1042988994 8:74617657-74617679 TGTGATAAGCATACAAGTGCAGG + Intronic
1043358773 8:79444945-79444967 CTTGATAAACATACATGTGCAGG + Intergenic
1044284953 8:90400330-90400352 TATGATAAGCATACAAGTGGAGG + Intergenic
1044475159 8:92617368-92617390 TGTCATAAACATACAGATGTGGG - Intergenic
1044863846 8:96550191-96550213 TTTGATTAAAATACAGTTACAGG + Intronic
1044970081 8:97610932-97610954 TGTGATAAACATACAAGTGCAGG + Intergenic
1045817788 8:106297035-106297057 CATGAAACACATACAGTTTCAGG - Intronic
1046202563 8:110946616-110946638 TATTATAGAGATTCAGTTGCAGG - Intergenic
1046231113 8:111359638-111359660 GATGATAGACATACAGGTGATGG + Intergenic
1046299801 8:112273397-112273419 TATGTTAGCCATACAGTTGTAGG + Intronic
1047515761 8:125553438-125553460 TATGATAAACATGCAGGTGCAGG + Intergenic
1047905309 8:129466832-129466854 TGCCATAAACATACAGGTGCAGG + Intergenic
1048088554 8:131212249-131212271 TATAATAAACATATAAGTGCTGG + Intergenic
1048454239 8:134563717-134563739 GATGATGAACATGCAGTTCCTGG + Intronic
1048515350 8:135103703-135103725 TGTGATAAACATACAACTGCAGG + Intergenic
1050045713 9:1542767-1542789 TGTGATAAACATACACGTGCAGG + Intergenic
1050273712 9:3974187-3974209 TATGAATTACATACAGTGGCAGG + Intronic
1050400873 9:5252916-5252938 TACAATAAACATACAAGTGCAGG + Intergenic
1050473329 9:6015819-6015841 TAAGATAAACGTGCACTTGCAGG + Intergenic
1052692285 9:31830478-31830500 TGTGATAAACATACAGGTACAGG - Intergenic
1052711483 9:32061941-32061963 TGTAATAAACATACGCTTGCAGG + Intergenic
1053264528 9:36701026-36701048 TAGGATAAACATGAAGTTTCCGG - Intergenic
1054826875 9:69582258-69582280 TAAGATAAACAAACAGTGGGAGG + Intronic
1058665832 9:107314620-107314642 TGTGATTAACATACAAGTGCAGG + Intronic
1059643875 9:116244851-116244873 TGTGATAAACATATGGGTGCAGG - Intronic
1060319821 9:122547743-122547765 TACAATAAACATACAGGTGCAGG + Intergenic
1185844473 X:3424809-3424831 TGTGATAAACACACACGTGCAGG + Intergenic
1185931074 X:4204026-4204048 TATGATAAACACACAAGTGCAGG - Intergenic
1186011371 X:5138125-5138147 TGTGATGAACATACAGCTGCAGG + Intergenic
1186135791 X:6519021-6519043 TATGATAAATATACAAGTGTAGG + Intergenic
1186893414 X:13982614-13982636 TATTATAGAGATTCAGTTGCAGG + Intergenic
1187632503 X:21190180-21190202 TGTGATAAACATAAAAATGCAGG - Intergenic
1187632687 X:21192351-21192373 TATGATAAACATACAAGTGCAGG - Intergenic
1188264932 X:28061454-28061476 TGTGATAAACATGCATGTGCTGG + Intergenic
1188406263 X:29814040-29814062 TGTGATGAACATACAAGTGCAGG + Intronic
1188648975 X:32606600-32606622 TATGATAAACATACAACTGCAGG - Intronic
1188825739 X:34832226-34832248 TGTGATAAACACACAAATGCAGG - Intergenic
1188961496 X:36498182-36498204 TATGATAAACATACAAATGCAGG - Intergenic
1189237607 X:39499850-39499872 TGTGATAAACATACATGTGCAGG + Intergenic
1189449707 X:41117724-41117746 TCTAATAAACATACAATAGCGGG - Intronic
1189665009 X:43344810-43344832 TGTGATGAACATACAAGTGCAGG + Intergenic
1189878441 X:45462632-45462654 TGTGATAAACATATATGTGCAGG - Intergenic
1189879451 X:45474070-45474092 TGCAATAAACATACGGTTGCAGG + Intergenic
1190837446 X:54113941-54113963 TGCAATAAACATACAGGTGCAGG - Intronic
1191146489 X:57171208-57171230 TGTGATAAACATACACATACAGG + Intergenic
1191834377 X:65448437-65448459 TGTGATAAACATACACGTGCAGG - Intronic
1191836321 X:65467401-65467423 TGTGATAAACATACATGTGCAGG + Intronic
1192155428 X:68742778-68742800 TGTGATATACATACATGTGCAGG - Intergenic
1192298985 X:69880834-69880856 TATGCAAAACATAGAGTGGCAGG + Intronic
1192726246 X:73755914-73755936 TGTGATAAACATACACATGCAGG + Intergenic
1192771761 X:74200219-74200241 TGTTATAAACATTCATTTGCAGG - Intergenic
1193307529 X:79966918-79966940 TGTGATAAACATACATATGCAGG + Intergenic
1193649716 X:84115646-84115668 TGTGATAGACATACAAGTGCAGG - Intronic
1193874703 X:86848031-86848053 AGTGATAAACATACAAATGCAGG + Intergenic
1193891972 X:87059100-87059122 TTTGATAAACAACCAGTTTCGGG + Intergenic
1193958725 X:87896646-87896668 TATTATAGAGATTCAGTTGCAGG - Intergenic
1194021022 X:88692565-88692587 TACAATAAACATACAAGTGCAGG - Intergenic
1194535180 X:95097032-95097054 TGAGATAAACATATAGGTGCAGG - Intergenic
1194547742 X:95258634-95258656 TGTGATAAACATACACATGCAGG + Intergenic
1194695140 X:97038313-97038335 TGTGATAATCATACAAGTGCAGG + Intronic
1195210316 X:102648014-102648036 TATGACAGATATACAGTTGAGGG + Intergenic
1196485981 X:116207541-116207563 TGTGATAAACATATAAATGCTGG - Intergenic
1197078362 X:122379797-122379819 TACAATAAACATACAAGTGCAGG + Intergenic
1197141280 X:123120669-123120691 TGCAATAAACATACACTTGCAGG - Intergenic
1197219628 X:123898822-123898844 TATAATATACATACAGTAGCCGG + Intronic
1197431517 X:126372465-126372487 TATGATAAACATAGAGTTTCAGG - Intergenic
1197511798 X:127378900-127378922 TGTGATAAACATAGAAGTGCAGG - Intergenic
1197576421 X:128217781-128217803 TGTGATGAACATACAGGTGCAGG - Intergenic
1197580097 X:128271569-128271591 TGTGATAAACATACAAGTGCAGG - Intergenic
1197739456 X:129878321-129878343 TGTGATAAACATACTATTGCAGG + Intergenic
1199181281 X:144856732-144856754 TGTGATAAACATATAAGTGCAGG - Intergenic
1199364632 X:146966065-146966087 TATGATAAATATACGAGTGCAGG - Intergenic
1199422692 X:147662962-147662984 TGCGATAAACATACAAGTGCAGG + Intergenic
1199904808 X:152214387-152214409 TGTGATAAACATACAATTGTAGG + Intronic
1200377290 X:155796558-155796580 TGTGATAAACATACAAGTACAGG + Intergenic
1200427603 Y:3038751-3038773 TGTGAAAAACATACGGATGCAGG - Intergenic