ID: 1107966276

View in Genome Browser
Species Human (GRCh38)
Location 13:45601147-45601169
Sequence TTACAGCCAAGGACAGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 286}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107966276_1107966284 28 Left 1107966276 13:45601147-45601169 CCCCACTCTGTCCTTGGCTGTAA 0: 1
1: 0
2: 1
3: 29
4: 286
Right 1107966284 13:45601198-45601220 ATTGAGTCCAGTTCTATACTGGG 0: 1
1: 0
2: 2
3: 14
4: 96
1107966276_1107966283 27 Left 1107966276 13:45601147-45601169 CCCCACTCTGTCCTTGGCTGTAA 0: 1
1: 0
2: 1
3: 29
4: 286
Right 1107966283 13:45601197-45601219 AATTGAGTCCAGTTCTATACTGG 0: 1
1: 0
2: 7
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107966276 Original CRISPR TTACAGCCAAGGACAGAGTG GGG (reversed) Intronic
901013989 1:6217350-6217372 TTAAAGCCAGGGACTGAATGAGG - Intronic
903332633 1:22603792-22603814 CTAAAGCCAAGGACAGACCGGGG + Intergenic
904492035 1:30866968-30866990 TTAGAGCCAAGGGCAGAGCCTGG - Intergenic
906251543 1:44314570-44314592 TTCCAGGCAAGGAAAGGGTGTGG - Intronic
906369156 1:45237404-45237426 TTGGAGCAAAAGACAGAGTGGGG - Intronic
907173275 1:52492319-52492341 TTAAAGCCAATGAGAGAGTATGG + Intronic
909420983 1:75464891-75464913 TTACAGCTAAAGAAAGAGAGAGG + Intronic
909580871 1:77233148-77233170 TGAAAGACCAGGACAGAGTGGGG - Intergenic
910898381 1:92092457-92092479 TGCCATCCAAGGACACAGTGAGG + Intronic
911657477 1:100461397-100461419 ATACAGCCAAGCACACAGCGTGG + Intronic
912695314 1:111837220-111837242 TTACATCAGAGGGCAGAGTGAGG - Intronic
913136345 1:115893201-115893223 TCCCAGCCAATGACTGAGTGTGG + Intergenic
914049755 1:144121735-144121757 CTACAGCCAAGGCCAGAGGCAGG + Intergenic
914129427 1:144843716-144843738 CTACAGCCAAGGCCAGAGGCAGG - Intergenic
919910902 1:202110123-202110145 CTACAGCCAAGGACAGCCAGAGG + Intergenic
921872011 1:220151612-220151634 TTTCAGCCAAGTACACAGTGTGG + Exonic
922504322 1:226117889-226117911 TGACAGCCAAGGCCAGAGGAGGG + Intergenic
1063855015 10:10240420-10240442 TTACAGCCCAGAAGAGAATGAGG - Intergenic
1064878198 10:20019331-20019353 TTACAGGCAAGGGCAGGGTCAGG + Intronic
1065255991 10:23868444-23868466 ATACAGGCAAGGACAGATTCTGG - Intronic
1066373917 10:34840420-34840442 CTCCAGCCTGGGACAGAGTGAGG - Intergenic
1068296446 10:55078139-55078161 TTACAGGCCAGGAGAGAATGGGG - Intronic
1070383105 10:75899553-75899575 TTACATGCAAGGCCAGAATGCGG + Intronic
1070611414 10:77935500-77935522 TAAAATCCAAGGCCAGAGTGGGG - Intergenic
1071991082 10:91101434-91101456 TAAAAGCCAAGGACCTAGTGAGG - Intergenic
1072096670 10:92188378-92188400 TTACAGCCAAGCACGTAGTTTGG + Intronic
1073129402 10:101177299-101177321 ATACAGCCAAGTAAAAAGTGAGG - Intergenic
1074334133 10:112551573-112551595 TAACAGCCAAGGACAGTGCCAGG - Intronic
1075579962 10:123610034-123610056 TTTGAGCCAAGGGCTGAGTGAGG + Intergenic
1076244262 10:128933864-128933886 CTATAGCCAAGGACAGGATGAGG - Intergenic
1076551337 10:131279845-131279867 TTGCAGCGAAAGGCAGAGTGAGG - Intronic
1077408345 11:2392486-2392508 CCACAGCCAAGGACCGAGGGTGG - Intronic
1078158585 11:8819733-8819755 TGAAAGACAAGGACAGACTGAGG + Intronic
1078671560 11:13370250-13370272 ATGCAGCCCAGGACAGAGAGGGG - Intronic
1079256152 11:18832873-18832895 TTACAACCCAGGAGAGATTGGGG - Intergenic
1079566360 11:21887988-21888010 TGGAAGCCAAGGTCAGAGTGAGG + Intergenic
1079630402 11:22667216-22667238 TGCCAACCAGGGACAGAGTGAGG + Intronic
1085753996 11:79188784-79188806 CTAAAGCCAAGGATAGGGTGTGG + Intronic
1085861318 11:80239378-80239400 TGACAGTCAAGGACATAGTCTGG - Intergenic
1086980059 11:93186780-93186802 TTCCAGCCAAGGGAAGATTGAGG - Intronic
1088122440 11:106386002-106386024 TGACAGGCATGGACAGAGGGAGG - Intergenic
1088842103 11:113635785-113635807 TTATAGCCAATGACAGGGTAAGG - Intergenic
1089038181 11:115418732-115418754 TTACACCCAAGCCAAGAGTGAGG + Intronic
1089274984 11:117328508-117328530 CTACTGCCAAGGACTGAGTTAGG - Intronic
1090610508 11:128466786-128466808 TTACACCCAAGGAAAGAGGGAGG + Intronic
1090671784 11:128952607-128952629 TTACAGCTAAGGAGGGAGGGAGG - Intergenic
1092668594 12:10836109-10836131 TTTCAGCCAAAGACAGAGAAGGG - Intronic
1093024158 12:14231711-14231733 TTACAGCCCAGGACTCAGTCAGG + Intergenic
1093135017 12:15439636-15439658 TCACAGCCATGGACAGAGCTGGG + Intronic
1093998131 12:25664770-25664792 TTACAACCCAGAAGAGAGTGGGG - Intergenic
1094345947 12:29469423-29469445 TTACAGCCAAGAAGAGCCTGAGG + Intronic
1094642617 12:32290790-32290812 TTATAGCCAAGAACAGCATGAGG - Intronic
1095237141 12:39810961-39810983 TTTCAGAAAAGGGCAGAGTGGGG - Intronic
1096523797 12:52198854-52198876 TCACAGCCAGGCACAGAGGGTGG - Intergenic
1097105005 12:56616945-56616967 TTCCATCCAAGGACAGAAGGTGG + Intronic
1097950817 12:65426367-65426389 TTACAGGCCAGGAAAGAGTGGGG - Intronic
1099743523 12:86671433-86671455 TTACATGCCAGGAGAGAGTGGGG + Intronic
1100443403 12:94639032-94639054 TTTCAGGCAAGGACAGATAGTGG - Intronic
1100900967 12:99239731-99239753 TTACAAGCAAGAAGAGAGTGGGG + Intronic
1101240905 12:102839156-102839178 GTAAAGCCATGGACAGAATGTGG - Exonic
1102234530 12:111285957-111285979 TTCCACCCCAGGACACAGTGGGG - Intronic
1102258604 12:111430090-111430112 TGGCAGCCCAGGACAGAGTGAGG - Intronic
1103269447 12:119660639-119660661 TTACAGGGAAGGACAGGGTGCGG + Intergenic
1103900593 12:124301802-124301824 TGCCAGCCAATAACAGAGTGGGG - Intronic
1104863516 12:131938646-131938668 TTAGAACCAAGAGCAGAGTGAGG - Intronic
1106047215 13:26154154-26154176 GCACAGCCAAGTACAGTGTGTGG - Intronic
1106556238 13:30810713-30810735 GTGCTGCTAAGGACAGAGTGTGG - Intergenic
1107643228 13:42466307-42466329 TTAGAACCAAGGAAATAGTGCGG + Intergenic
1107966276 13:45601147-45601169 TTACAGCCAAGGACAGAGTGGGG - Intronic
1108017877 13:46095221-46095243 TTACAGTCAAGGAAACAATGTGG - Intronic
1111938244 13:94580640-94580662 TTACAGCTATAGTCAGAGTGAGG - Intronic
1112027614 13:95426127-95426149 TTATAGCCAAGGAGAGGGTAGGG + Intergenic
1112645617 13:101328346-101328368 CTACAGCCCAGGCTAGAGTGCGG + Intronic
1112741426 13:102477688-102477710 TTAAAGAGAAGGAAAGAGTGAGG + Intergenic
1114232006 14:20791571-20791593 TCACTACCAAGGACAAAGTGAGG + Intergenic
1114832528 14:26162575-26162597 TTACAGGCCAGGACAGATTGGGG - Intergenic
1117336068 14:54758278-54758300 TTCCTGCCAATGACAGGGTGTGG + Intronic
1117502167 14:56363904-56363926 CTACAATCCAGGACAGAGTGGGG - Intergenic
1117880899 14:60312462-60312484 TCAAAGCCAAAGACAGAGTGGGG - Intergenic
1117931058 14:60840479-60840501 TTCCAGCCAATGACTGAGTAAGG - Intronic
1119413778 14:74456098-74456120 ATTGAGCCAAGGAAAGAGTGAGG + Intergenic
1119660244 14:76446004-76446026 TACCAGCCAAGCACATAGTGAGG - Intronic
1121307504 14:92916341-92916363 CTACAGCCGAGGACAGAGCCTGG + Intergenic
1121693572 14:95894841-95894863 TTGCAGTGAAGGAGAGAGTGAGG + Intergenic
1121960261 14:98253193-98253215 TGACATGCAAGGACAAAGTGGGG - Intergenic
1122971614 14:105154543-105154565 TTACAGCCAAGTCCAGATGGTGG - Intronic
1123167746 14:106342670-106342692 TTAGAGCAAAAGACACAGTGAGG - Intergenic
1123170372 14:106367381-106367403 TTAGAGCAAAAGACACAGTGAGG - Intergenic
1123221951 14:106865611-106865633 TTTAAGCCAAAGACACAGTGAGG - Intergenic
1123419619 15:20120976-20120998 CTACAGCCAAGGCCAGAGGCAGG + Intergenic
1123446245 15:20332560-20332582 CTACAGCCAAGGCCAGAGGCAGG - Intergenic
1123463013 15:20491888-20491910 TTACAGCTAAAGAGAGAGAGAGG - Intergenic
1123528842 15:21127512-21127534 CTACAGCCAAGGCCAGAGGCAGG + Intergenic
1123655046 15:22508526-22508548 TTACAGCTAAAGAGAGAGAGAGG + Intergenic
1125462735 15:39921247-39921269 CTACACCCAAGGACTGACTGAGG - Intergenic
1127917018 15:63463227-63463249 TTAAAGCCTGGCACAGAGTGAGG - Intergenic
1128829022 15:70749487-70749509 TTATCGCCCAGGCCAGAGTGCGG - Intronic
1130706690 15:86239562-86239584 ATCCAGCCAATGACACAGTGAGG - Intronic
1130736900 15:86559888-86559910 TTACAGCCAAGTGCAGAAGGTGG - Intronic
1130872204 15:87980209-87980231 ATACAGCCATGGACTGAGTTAGG + Intronic
1131277921 15:90997750-90997772 TGACAACAAAGGACAGAGAGAGG + Intergenic
1131831789 15:96359409-96359431 GTGCAGGCAGGGACAGAGTGCGG - Intergenic
1136551868 16:30986247-30986269 TCAAGGCCAAAGACAGAGTGGGG - Intronic
1137976316 16:53035291-53035313 TTACAGCCAAGGAGCAAGTTGGG + Intergenic
1137976783 16:53038767-53038789 TTACAGCCAAGGAGCAAGTTGGG + Intergenic
1138278363 16:55753294-55753316 TTCCAGACCAGGACACAGTGAGG + Intergenic
1138278374 16:55753414-55753436 TTCCAGACCAGGACACAGTGAGG + Intergenic
1138278398 16:55753654-55753676 TTCCAGACCAGGACACAGTGAGG + Intergenic
1139950333 16:70665217-70665239 TCACAGCCAAGGGCAGAGCATGG + Intronic
1140294614 16:73696090-73696112 TTCCAGCCAAGGGCAGAGGTAGG + Intergenic
1142213222 16:88818160-88818182 TGACAGCGAAGGACGGAGAGGGG + Intronic
1203137462 16_KI270728v1_random:1737763-1737785 CTACAGCCAAGGCCAGAGGCAGG - Intergenic
1144720342 17:17464956-17464978 TTATACCCAAGGACAGAGTTGGG - Intergenic
1145734033 17:27213877-27213899 TTACAGACCAGGACAGGGTAGGG - Intergenic
1147158099 17:38555084-38555106 TGAAAGCCAAGGCCTGAGTGTGG - Intronic
1148819565 17:50352813-50352835 TTCAAGCCAGGGACTGAGTGTGG + Intronic
1149639876 17:58195592-58195614 TAGAAGCCAAGGACAGTGTGGGG + Intronic
1149990934 17:61383206-61383228 CTACAGCCCAGGACACGGTGAGG - Intronic
1151364431 17:73607994-73608016 TCACAACCAAGGAAAGAATGTGG + Intronic
1155164095 18:23218700-23218722 TTAAAGCCAAGAACAAAATGTGG - Intronic
1155785592 18:29895826-29895848 TCACAGCCAAGGGAAGTGTGAGG + Intergenic
1158869664 18:61673202-61673224 TTAATGCCAAGGACAGATTGAGG - Intergenic
1162286457 19:9742609-9742631 TTACAGCCTAGGACTCAGTCAGG + Intergenic
1163254753 19:16148909-16148931 GGACAGACAAGGACAGGGTGGGG - Intronic
1163266749 19:16226604-16226626 TTACAGCCTAGGGCAGGGTTGGG + Intronic
1166764318 19:45243916-45243938 TAAAAGAGAAGGACAGAGTGCGG - Intronic
1166930609 19:46299104-46299126 TTCCAGCCAAGAACAGGGGGTGG - Intronic
1168281027 19:55305377-55305399 TCACAGGGAAGGAAAGAGTGGGG + Intronic
1168511397 19:56976615-56976637 TAATAGCCAAGGACAGAGGCAGG + Intergenic
1202689144 1_KI270712v1_random:74298-74320 CTACAGCCAAGGCCAGAGGCAGG + Intergenic
925150660 2:1612563-1612585 TTACAGCCAGGAGCAGAGGGTGG - Intergenic
925307907 2:2862976-2862998 TCACAGCCAAGGACAGTCAGAGG + Intergenic
925387531 2:3472498-3472520 CTACAGTCAGGGAAAGAGTGGGG + Intronic
925858931 2:8156588-8156610 TCACAGCCGAGGCCTGAGTGTGG + Intergenic
926682304 2:15673241-15673263 TTAGAGCCAGGGCAAGAGTGTGG + Intergenic
927026614 2:19074524-19074546 TTACAGCTGAGAACAGAATGGGG - Intergenic
927358980 2:22209301-22209323 TTCCAGCCAATGACAGACAGTGG + Intergenic
927499811 2:23575138-23575160 TTACTGCCAAGCACAGTGGGCGG + Intronic
927576071 2:24202701-24202723 GGAAAACCAAGGACAGAGTGAGG - Intergenic
928134224 2:28676093-28676115 TTACAGACGAGGACATAGTTTGG - Intergenic
929578464 2:43067549-43067571 GGACAGCCAAGGAGAGAGTCTGG - Intergenic
931232904 2:60389346-60389368 TTCCAGCCAAGCACAGAGGAAGG + Intergenic
933957294 2:87381793-87381815 CTACAGCCAAGGCCAGAGGCAGG - Intergenic
934241411 2:90273685-90273707 CTACAGCCAAGGCCAGAGGCAGG - Intergenic
934271763 2:91543001-91543023 CTACAGCCAAGGCCAGAGGCAGG + Intergenic
934495372 2:94791712-94791734 CTAGAGCAAAGGGCAGAGTGCGG + Intergenic
935454361 2:103250048-103250070 TTTCAGCCAATGGCTGAGTGTGG + Intergenic
935759694 2:106309765-106309787 TTAGAGCCAGTGACCGAGTGCGG + Intergenic
938680175 2:133681576-133681598 ATACAGCCCAGGACAGTGTGTGG - Intergenic
940190285 2:151033605-151033627 TGCCAGCCACTGACAGAGTGAGG + Intronic
940398388 2:153220291-153220313 TCACAGCCAAGGCCAGGGAGAGG + Intergenic
940433073 2:153616959-153616981 TTACAGCTAAAGAAAGAGAGAGG + Intergenic
944150317 2:196551300-196551322 TTACAGCCAAGGACAGGGGCAGG + Intronic
944333497 2:198501139-198501161 ATACAGTCAAAGACAGAGTTAGG - Intronic
944336755 2:198543277-198543299 TTATAGACAAGGAGAGAGTTTGG + Intronic
946160491 2:217832795-217832817 GGACATCCAAGGACAGAGTGAGG - Intronic
947453005 2:230225574-230225596 TTCCTGCCAAGGAAAGAGGGTGG - Intronic
1168901794 20:1371114-1371136 TCACAGCCAAGGCCTGGGTGAGG - Intronic
1169028923 20:2393174-2393196 TCACAGACATGCACAGAGTGCGG + Intronic
1169933250 20:10856447-10856469 TTACAGCCAGGCACAGAGCCTGG + Intergenic
1170486577 20:16822667-16822689 TTACAAGCAAGGAGAGATTGAGG + Intergenic
1171452406 20:25245505-25245527 TTATAGCCAAGGACTGGGGGAGG + Intergenic
1172043301 20:32061384-32061406 TCCCAGCCAATGACTGAGTGTGG - Intronic
1173021118 20:39268972-39268994 TTTCAGCCATGGACACGGTGGGG - Intergenic
1173071967 20:39776803-39776825 CTACAGCCAAGGAGAAACTGAGG + Intergenic
1173306328 20:41853908-41853930 TTCCTGCCCAGGACAGAGTAGGG + Intergenic
1173708855 20:45136928-45136950 TCCCAGCCAATGACTGAGTGAGG + Intergenic
1174651757 20:52131731-52131753 TTACAGCTAAAGAGAGAGTTAGG + Intronic
1175319399 20:58074674-58074696 TTACCCCCAAGGTCAGAGTTTGG - Intergenic
1177940270 21:27401595-27401617 TTACAGGCAAGGTCAAAATGAGG - Intergenic
1178479446 21:32967044-32967066 TTATAGCCAAGGAGTGAGAGGGG + Intergenic
1179043651 21:37826816-37826838 TTAAAGCCAAGGAAACAGGGTGG + Intronic
1179057318 21:37948197-37948219 TTGAAGCCAAGAGCAGAGTGAGG + Intergenic
1179184299 21:39072620-39072642 TCACAGCCAAGGAATGACTGGGG + Intergenic
1180257626 21:46643508-46643530 TCAAAGCCAAGGAAAGCGTGAGG - Intronic
1180552281 22:16550316-16550338 CTACAGCCAAGGCCAGAGGCAGG - Intergenic
1180725518 22:17944056-17944078 TCCCCGCCAAGGACAGAGTCAGG + Intronic
1180741735 22:18057840-18057862 TTAAAGCCAAGAACAGTGAGAGG - Intergenic
1181139746 22:20795839-20795861 ATAAAGGCAAGGACAGAGAGAGG + Intronic
1181345330 22:22215909-22215931 TAACAGCCATGGGCAGTGTGTGG + Intergenic
1181351748 22:22263726-22263748 CTACAGCCAAGGCCAGAGGCAGG + Intergenic
1181715962 22:24729067-24729089 CTACAGACAAGTACACAGTGCGG + Intronic
1183021977 22:35034562-35034584 TTTATGCCAAGAACAGAGTGTGG - Intergenic
1183179104 22:36246680-36246702 TCACAGCCAACACCAGAGTGAGG + Intergenic
1183646915 22:39132377-39132399 TGACAGCCAAGGAAAGACAGGGG + Exonic
1183809387 22:40241445-40241467 TGACAGTCAAGGAAAGATTGAGG - Intronic
1183865816 22:40703351-40703373 ACACAGACAAGGACACAGTGGGG - Intergenic
1184080668 22:42217389-42217411 TTACAGCCAGGGAAAAGGTGTGG - Intronic
1184788484 22:46684165-46684187 ATACAGCCATGGACAGAGGCAGG + Intergenic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
952674703 3:36013580-36013602 TCACAGCCAAAGACTGAGTGTGG - Intergenic
952681309 3:36096753-36096775 CTACAGACAGGAACAGAGTGGGG - Intergenic
954668561 3:52274869-52274891 CTCCAGCCTAGGAAAGAGTGAGG + Intronic
957208274 3:77227801-77227823 TGACAGTCAATGACAGAGTAAGG - Intronic
958755309 3:98244763-98244785 TTACAGCCCAGGACTCAGTCAGG + Intergenic
962333584 3:134504415-134504437 TTACAGACCAGGAGAGAATGGGG - Intronic
962627015 3:137235851-137235873 TTCCAACCAATGACTGAGTGTGG - Intergenic
962900274 3:139755732-139755754 AGACAGCGAAGGAGAGAGTGGGG + Intergenic
963236071 3:142957940-142957962 CTACAGCCAAGGTCAGAGTTTGG + Intronic
965471480 3:169098320-169098342 TTAAAGGCAAGGAAAGACTGAGG - Intronic
967707745 3:192672002-192672024 TGAGACCCAAAGACAGAGTGCGG + Intronic
967754698 3:193156166-193156188 TTGCCGCCAAAGACAGACTGCGG - Intergenic
967872682 3:194245290-194245312 TTCTAGCCAGGCACAGAGTGAGG + Intergenic
969807367 4:9619717-9619739 TTACAACCCAGAAGAGAGTGGGG + Intergenic
970996506 4:22273615-22273637 TTACAGTCAAATACAGAGTGTGG + Intergenic
973799413 4:54461588-54461610 CTACAGGCCAGGAGAGAGTGGGG + Intergenic
974784385 4:66598709-66598731 TTACAGGCCAGGAGAGAATGGGG + Intergenic
974880764 4:67754230-67754252 TTCCAGACAAGGTCAGAGTGGGG + Exonic
975289896 4:72665426-72665448 TTACAGCCAAGTATGGGGTGAGG - Intergenic
975741584 4:77434489-77434511 TTCCAGCCAACGACTGAGTCTGG + Intergenic
979283879 4:118898883-118898905 TTCCAGCCAAGGACACAGCAGGG - Intronic
982453347 4:155578127-155578149 TTCTAGACAAGGACGGAGTGTGG + Intergenic
983199683 4:164847588-164847610 TTAAATGCAAGGAAAGAGTGTGG - Intergenic
984445241 4:179828469-179828491 TCACAGCCAAAGACAAAGTATGG + Intergenic
985064638 4:186108393-186108415 TTAAAGCCAAGTACAGAATCAGG - Intronic
985879720 5:2628987-2629009 TTGCAGCTATGGACAGTGTGAGG - Intergenic
986007542 5:3680730-3680752 TGACCGGCAAGAACAGAGTGTGG + Intergenic
987302448 5:16608522-16608544 TTACAGTTGAGGACAAAGTGGGG - Intronic
988693668 5:33597475-33597497 TTACAGCCAAGGACACTGAGGGG + Intronic
990483460 5:56234527-56234549 TTACAGCCTAGCACAGAGAGGGG + Intergenic
990966497 5:61454285-61454307 TTCCAGCCTAGGCAAGAGTGAGG - Intronic
992097399 5:73375740-73375762 CTACATCCAAAGGCAGAGTGAGG + Intergenic
992689007 5:79225280-79225302 TCTCAGCCAATGACTGAGTGTGG + Intronic
993042615 5:82832376-82832398 TTATAGCAATGGGCAGAGTGAGG - Intergenic
993540511 5:89144777-89144799 TTACAGGAAAGGAAAGAATGGGG - Intergenic
994821337 5:104654393-104654415 TTACAGGCCAGGAAAGAATGGGG + Intergenic
994961922 5:106616010-106616032 TTACAGCCAAGGAGAGACTAAGG + Intergenic
995084087 5:108087336-108087358 TTGCAGCCAACTACAGGGTGGGG + Intronic
995590024 5:113689735-113689757 TGAGAGACTAGGACAGAGTGAGG - Intergenic
996524482 5:124463518-124463540 TTGCAGCAAAGGACAGAGTAGGG - Intergenic
996794007 5:127324605-127324627 TTGGAGGCAAAGACAGAGTGTGG - Intronic
996820749 5:127624293-127624315 TTGCAGCCAAGGACAGCGAAGGG + Intergenic
997591278 5:135074087-135074109 TTATAGCCAAAGCCAGAGAGGGG + Intronic
998507245 5:142681866-142681888 TTACAGCCAAGCACAGTGCTTGG + Intronic
998591783 5:143486474-143486496 TCACAGCCCAGGAGAGGGTGGGG + Intergenic
999185980 5:149709317-149709339 GTACAGCCAGGGCCAGAATGAGG + Intergenic
999250050 5:150177096-150177118 GGCCAGGCAAGGACAGAGTGTGG - Intronic
1003186572 6:3836844-3836866 TTGAAGCCAAGGACAGAGGGAGG + Intergenic
1003194531 6:3903104-3903126 TAATTGCCAAGGACAGAGGGAGG - Intergenic
1003373474 6:5551388-5551410 TGACAGGCAAGGAAAAAGTGAGG - Intronic
1003799686 6:9649700-9649722 TGACAGCCAGGAACAAAGTGTGG - Intronic
1004001258 6:11599290-11599312 TTACAGCAAGGAACAGAGTGAGG - Intergenic
1004341229 6:14809239-14809261 TTACAGACATGCTCAGAGTGGGG - Intergenic
1006044517 6:31283376-31283398 CTCCAGCCCAGGCCAGAGTGAGG + Intronic
1007710200 6:43818006-43818028 TTACACCCTAGGACTGACTGTGG + Intergenic
1008284767 6:49635645-49635667 TGAAAGCTAAGGACAGAGTTAGG - Intronic
1008491297 6:52089818-52089840 TCCCAGCCAAGGACTGAGTGTGG + Intergenic
1008772111 6:54991862-54991884 ATCCAGCCAAGGAGGGAGTGGGG + Intergenic
1009374049 6:62945769-62945791 TTAGAGCCAAGTACAGTGAGAGG - Intergenic
1009771049 6:68143401-68143423 TTACAACCCAGGAGACAGTGTGG - Intergenic
1010393741 6:75366887-75366909 TTACAGACAAGGAAACAGTCAGG - Intronic
1010411231 6:75564249-75564271 TTACAAGCAAGGAGAGACTGGGG + Intergenic
1010885600 6:81235588-81235610 TTACAGGCCAAGAGAGAGTGGGG + Intergenic
1010904387 6:81469816-81469838 CTACAGGCAAGAAGAGAGTGGGG + Intergenic
1011546933 6:88491675-88491697 TTACTCCCAGGGAAAGAGTGGGG + Intergenic
1013453197 6:110305090-110305112 TTACAGGCAAGGAAATACTGAGG + Intronic
1016221104 6:141670586-141670608 TAACAGGCCAGGACAGATTGGGG + Intergenic
1017605612 6:156129290-156129312 TTATGGCCAAGGAAAGAGTTGGG - Intergenic
1018813211 6:167312761-167312783 CCACAGCTAAGGACATAGTGGGG - Intronic
1022877970 7:34554481-34554503 TTACAGACAAGCAAAGACTGAGG + Intergenic
1023803765 7:43856721-43856743 TCACAGTCAAGGTCAGAGTGAGG + Intergenic
1023969426 7:44979982-44980004 TTTCATCCCAGGACAGACTGGGG + Intergenic
1028946278 7:96584295-96584317 TTACAGGCCAGAAGAGAGTGGGG - Intronic
1029044360 7:97612458-97612480 GCACAGCTAAGGACAGGGTGAGG - Intergenic
1030193257 7:106830481-106830503 TTACAGCCGAGGACTCAGTCAGG + Intergenic
1031329119 7:120441817-120441839 TTACAGCCATGGGCAGAGTGTGG - Intronic
1033218929 7:139514978-139515000 TAACAGCCAAGAATAGACTGAGG + Intergenic
1035482533 7:159198781-159198803 TTAGAGCCACGGACAGAGAACGG + Intergenic
1036086311 8:5616852-5616874 TGACTGCCAAGGACAGAATGAGG - Intergenic
1037059355 8:14487147-14487169 ATACAGCTAAGGAAAGAGAGAGG - Intronic
1037134359 8:15444387-15444409 TTATAGCCAAGGAGTGAGTCAGG + Intronic
1037712519 8:21366640-21366662 TTACAGGCCAAGATAGAGTGAGG + Intergenic
1037819654 8:22129567-22129589 ATACAGCATAGGACAGAGTCAGG - Intronic
1038700020 8:29841222-29841244 TGACAGCTGAGGCCAGAGTGCGG - Intergenic
1039398478 8:37247551-37247573 TTTCAGCCAGTGACAGAGGGAGG - Intergenic
1039895662 8:41714916-41714938 TTAGAGGCAAGGACAGAGGATGG - Intronic
1040101250 8:43508597-43508619 CTAGAGCAAAGGGCAGAGTGTGG - Intergenic
1040459169 8:47630688-47630710 TGACAGCCAAGGCCAATGTGTGG - Intronic
1043081741 8:75774770-75774792 TTTCAGGCAAGGAGAGAATGAGG + Intergenic
1043600258 8:81928891-81928913 TTACAGCCAGTGAAAGAGTGTGG + Intergenic
1043655577 8:82661510-82661532 TTACAAGCCAGGAGAGAGTGGGG - Intergenic
1047755930 8:127918305-127918327 GCACAGCCAGGGAAAGAGTGTGG + Intergenic
1050823720 9:9916034-9916056 TTAGAGGCAAGGAGAGAATGAGG + Intronic
1051021494 9:12549008-12549030 TTGCGGCCAGGAACAGAGTGAGG - Intergenic
1051632309 9:19151579-19151601 TCTCAGCCAGTGACAGAGTGTGG - Intergenic
1052199619 9:25762681-25762703 TTTCAGGCCAGGACAGAGTGAGG + Intergenic
1052711919 9:32067600-32067622 GAACAGCAAAGGACAGAGAGAGG + Intergenic
1053524412 9:38814065-38814087 TCACATCCAAGGAAAGAGCGTGG + Intergenic
1054196646 9:62038474-62038496 TCACATCCAAGGAAAGAGCGTGG + Intergenic
1054641759 9:67550211-67550233 TCACATCCAAGGAAAGAGTGTGG - Intergenic
1055486662 9:76762956-76762978 TTGGAGCCAAAGACACAGTGGGG - Intronic
1056587045 9:87934618-87934640 CTAGAGCAAAGGGCAGAGTGCGG + Intergenic
1057162521 9:92899010-92899032 CTAGAGCAAAGGGCAGAGTGAGG + Intergenic
1057592098 9:96381486-96381508 TTGGAGCCAAGACCAGAGTGAGG - Intronic
1058208054 9:102132615-102132637 CTACAGGCCAGGAGAGAGTGGGG + Intergenic
1059112577 9:111570892-111570914 TTACAGTCAGGGACAGAATATGG + Intronic
1059586385 9:115611974-115611996 CAACAGCTAAGGACAGAGAGTGG - Intergenic
1059754622 9:117281262-117281284 TTACAGCTCAGGAGAAAGTGAGG + Intronic
1060206724 9:121686687-121686709 TTACAGACAGGGAAAGAGAGTGG - Intronic
1061338893 9:129962797-129962819 GTAGAGCCAAGGACAGGGTTAGG + Intronic
1186191517 X:7071542-7071564 TTACAGAGAAGAACAGAGGGTGG - Intronic
1186778919 X:12893498-12893520 TGACAGGCAAGGAGGGAGTGAGG + Intergenic
1186890772 X:13957192-13957214 TCCAAGCCAAGGACACAGTGGGG - Intergenic
1187046431 X:15651686-15651708 TTACAGCACAGGACAGACTTGGG - Intronic
1188773003 X:34177176-34177198 TTACAGAAAAGGAGAGACTGGGG - Intergenic
1189960613 X:46321395-46321417 TTACAGTCAAAGACATTGTGTGG + Intergenic
1192291041 X:69795696-69795718 TGACAGCCTAGGCCAGTGTGTGG - Intronic
1192714818 X:73628179-73628201 TGAGAGCAAAGGAAAGAGTGGGG - Intronic
1192764825 X:74129742-74129764 TTACAGCCCAGGACTCAGTCAGG - Intergenic
1193404659 X:81085739-81085761 TTACAAGCCAGGAGAGAGTGGGG + Intergenic
1193443410 X:81569706-81569728 TTATAGACAAGGAGAGAGTGGGG + Intergenic
1195820290 X:108937968-108937990 TTACAGGCCAGGAGAGAATGAGG - Intergenic
1197102305 X:122670808-122670830 GGACAGTCAAGGACAGTGTGAGG - Intergenic
1198519190 X:137435111-137435133 CTACAGCCCAGAAGAGAGTGGGG + Intergenic
1200018619 X:153183327-153183349 TTGCAGCCAAGGCCAGTGGGAGG + Exonic
1202070168 Y:20983980-20984002 TTACAAGCAAGAAGAGAGTGGGG - Intergenic
1202092831 Y:21212045-21212067 TTAAAGCCAAGGACAGTTTTAGG - Intergenic