ID: 1107968107

View in Genome Browser
Species Human (GRCh38)
Location 13:45615465-45615487
Sequence AGCAGATGTCAGAAAGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 358}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107968101_1107968107 15 Left 1107968101 13:45615427-45615449 CCAACAACGGCCTTCACAATGGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1107968107 13:45615465-45615487 AGCAGATGTCAGAAAGGCCAAGG 0: 1
1: 0
2: 2
3: 34
4: 358
1107968103_1107968107 5 Left 1107968103 13:45615437-45615459 CCTTCACAATGGGAAGAAGCTGG 0: 1
1: 0
2: 2
3: 31
4: 224
Right 1107968107 13:45615465-45615487 AGCAGATGTCAGAAAGGCCAAGG 0: 1
1: 0
2: 2
3: 34
4: 358
1107968099_1107968107 16 Left 1107968099 13:45615426-45615448 CCCAACAACGGCCTTCACAATGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1107968107 13:45615465-45615487 AGCAGATGTCAGAAAGGCCAAGG 0: 1
1: 0
2: 2
3: 34
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107968107 Original CRISPR AGCAGATGTCAGAAAGGCCA AGG Intronic
901439677 1:9270200-9270222 AGCACCTGTCAGCAAGGCGAGGG - Exonic
901530919 1:9851995-9852017 ACAACATGTCAGAAAGACCATGG - Intronic
901681770 1:10916930-10916952 AGTAGAGGTCAGAAAGGTTAAGG + Intergenic
904556663 1:31369384-31369406 AGCAGATGACAGGAAGGTCAAGG - Exonic
904577881 1:31517251-31517273 AGCACACCCCAGAAAGGCCAGGG + Intergenic
905116407 1:35644930-35644952 AGCAGATTTCAAAAAGTCCTAGG - Intergenic
905348056 1:37325001-37325023 AGGAGAGGACAGAAAGGACAGGG - Intergenic
906680158 1:47720903-47720925 AGGAGATGGTAGAAAGGGCAAGG - Intergenic
907661649 1:56398704-56398726 AGCAGTTGTCAGAAACGCACAGG - Intergenic
907715435 1:56921973-56921995 AGCTGTTGTTATAAAGGCCATGG + Intergenic
907803720 1:57797257-57797279 AGCATATGACAGGAAAGCCATGG - Intronic
908200193 1:61787432-61787454 GGAAGAGGACAGAAAGGCCAGGG - Intronic
908345578 1:63229021-63229043 AGCAGAGGTGAGAAACACCATGG - Intergenic
908482261 1:64553502-64553524 AGCAATGTTCAGAAAGGCCACGG + Intronic
909350213 1:74643799-74643821 AGCTAGTGTCAGATAGGCCAAGG - Intronic
911142728 1:94523607-94523629 GGGAGATGTCAGAAAGGCACAGG + Intergenic
912473480 1:109921751-109921773 GACAGATGTGAGAAAGGCCAAGG + Intronic
913684199 1:121216001-121216023 AGAAGATGGCAGTAAGGTCAAGG - Intronic
913963775 1:143358239-143358261 AGCAGAACTCAGAAAGGTGAAGG - Intergenic
914036039 1:144003616-144003638 AGAAGATGGCAGTAAGGTCAAGG - Intergenic
914058137 1:144183843-144183865 AGCAGAACTCAGAAAGGTGAAGG - Intergenic
914121009 1:144782528-144782550 AGCAGAACTCAGAAAGGTGAAGG + Intergenic
914153420 1:145064329-145064351 AGAAGATGGCAGTAAGGTCAAGG + Intronic
915099106 1:153485675-153485697 AGCAGATCTCACTGAGGCCACGG - Intergenic
915931123 1:160061675-160061697 AGCAGAGGGCAGCAAGGGCATGG + Intronic
915964687 1:160296124-160296146 AGCAGCTGTGAGATAGGCCAGGG + Exonic
916335630 1:163668011-163668033 AGCAGATGAAAGGAAGGCAAGGG - Intergenic
916388186 1:164300755-164300777 AGCAAATGGCAGAAAGGCCAAGG - Intergenic
916504294 1:165413968-165413990 AGCAGATAACAGAGAGACCATGG - Intronic
918072482 1:181143091-181143113 AGCAGATGTCACAGAGGCCTGGG - Intergenic
918781658 1:188707722-188707744 AGCACATATCAGAAAGAACAGGG - Intergenic
919700541 1:200627007-200627029 ATCAAAGGCCAGAAAGGCCATGG - Intronic
920471504 1:206234493-206234515 AGAAGATGGCAGTAAGGTCAAGG - Intronic
920649935 1:207829747-207829769 AACTGAGGCCAGAAAGGCCAAGG - Intergenic
921260152 1:213379088-213379110 AGCAGGGCTCAGAAAGGTCAAGG - Intergenic
921345404 1:214178772-214178794 AACAGAACTCTGAAAGGCCATGG + Intergenic
922084514 1:222333142-222333164 AGAAGATCTCAGAAAGGAGATGG - Intergenic
922574033 1:226650674-226650696 AGCAGAGCTCAGAGAGGACAGGG + Intronic
923509339 1:234636348-234636370 AGCAGATTTCAGAAACTCAAGGG - Intergenic
923682439 1:236128972-236128994 AGCATATGTGAGTCAGGCCATGG + Intergenic
924088677 1:240480557-240480579 AGCAAACATCAGAAGGGCCATGG + Intergenic
924563849 1:245179767-245179789 AGGAGGTGTCAGAAAGACCAGGG + Intronic
1063204512 10:3818324-3818346 AGAAGATGTCAGGAAAGACAAGG - Intergenic
1063431144 10:5989238-5989260 ATCAGATGTCGCAAAGGCTATGG - Intergenic
1066282859 10:33934840-33934862 AGCAGAGAGAAGAAAGGCCACGG - Intergenic
1066503794 10:36021067-36021089 AGAAGATGTGAGAGAGACCATGG + Intergenic
1067167871 10:43879738-43879760 AGCAGCTGACTGAAAAGCCACGG + Intergenic
1067761419 10:49050332-49050354 AACAGATGTGAGACAGGACAGGG + Intronic
1068077387 10:52273607-52273629 GGCATATATAAGAAAGGCCATGG - Intronic
1069058854 10:63872507-63872529 AGCAGATGGCAGCAAAACCAAGG + Intergenic
1070743404 10:78917557-78917579 AGCAAATGTCAGTAAAGGCAAGG + Intergenic
1071068333 10:81663288-81663310 AGAAGATGTCTTAAAGGTCAAGG - Intergenic
1071775685 10:88785375-88785397 ATCAGATGTGACTAAGGCCAAGG - Intergenic
1071964536 10:90838710-90838732 AGCAGCTGGCAGAAAGGCCCTGG - Intronic
1073799274 10:107023677-107023699 AAAAGATGTCAAAAAGGTCATGG + Intronic
1074257914 10:111821824-111821846 CACAGACCTCAGAAAGGCCAGGG - Intergenic
1074536143 10:114329771-114329793 AGCAAATGTCAGGGAGGCCCAGG + Intronic
1075581441 10:123621639-123621661 AGCAGTTGGGAGAAAAGCCAAGG + Intergenic
1076593612 10:131609381-131609403 AGCAGAGGGCAGAGAGCCCAGGG + Intergenic
1077202424 11:1317720-1317742 AGCAGCTGTCAGACTGGCCAGGG - Intergenic
1077898335 11:6470883-6470905 AACAGATGTCATGAATGCCAAGG + Intronic
1078507803 11:11965454-11965476 AGGAGCTGGCAGAGAGGCCACGG - Intronic
1080848581 11:36047956-36047978 AGCAGATGTGAAAAGGGGCAGGG + Intronic
1081371070 11:42304258-42304280 AACAGATGTCAGCGAGGCTATGG + Intergenic
1081771431 11:45652490-45652512 AGCAGAAGTCAGCAAGGGCAGGG + Intronic
1083492528 11:63023472-63023494 AGCACATGTGAGAAAAGCCGAGG + Intergenic
1083580843 11:63824281-63824303 AGCAGCTGCCTGAAAAGCCAAGG - Intronic
1084231912 11:67759632-67759654 TTCAGATTTCAGGAAGGCCAGGG - Intergenic
1084573805 11:69975951-69975973 CGCAGAGGACAGCAAGGCCAAGG - Intergenic
1084582135 11:70030609-70030631 AGCTGATGACAGAGAGGACATGG - Intergenic
1085411081 11:76291093-76291115 AGCACATGAGAGGAAGGCCAGGG - Intergenic
1086403844 11:86483389-86483411 TCCAGATATCAGAGAGGCCAAGG + Intronic
1086837579 11:91644341-91644363 TGCAGATTTCAGAAGGGGCAAGG - Intergenic
1088572034 11:111231681-111231703 AGCAGATGTAACAAAGCCCAGGG - Intergenic
1088610816 11:111574862-111574884 AGCAGATTACAAAAAGGGCATGG + Intergenic
1089149689 11:116355221-116355243 AGCAGAAGCCAGAGAGGTCAGGG - Intergenic
1089427052 11:118386592-118386614 ACCTGATGTGAGAAAGGCAAGGG - Exonic
1090206297 11:124886404-124886426 AACAGTTGTTAGAAAGGCAAGGG + Intronic
1090363427 11:126188372-126188394 GGCAGAGGTCAGAAAGCCCAGGG - Intergenic
1090873642 11:130769720-130769742 AGCAGGTGTCAGAAAGAGCAAGG + Intergenic
1090940610 11:131384926-131384948 TCCAGATGGCAGAAAGGCCTGGG - Intronic
1091681980 12:2533719-2533741 AGCACATGTCAAAAGCGCCAGGG + Intronic
1093576777 12:20740250-20740272 GGAAGATGTCAGAAAGACAATGG + Exonic
1095925756 12:47577446-47577468 ACCAGATGTGAGAAAGACAAAGG - Intergenic
1096174187 12:49501319-49501341 GGCAGATGGCAGAAGGGCAAGGG + Intronic
1096686542 12:53291917-53291939 TGCAGAAGTCAGAAGGGGCATGG - Intronic
1097133695 12:56834163-56834185 AGGACAAGTCAGAAAGACCAGGG - Intergenic
1100748425 12:97670841-97670863 AGAGGATGTCAGAGAGGACAAGG - Intergenic
1100767739 12:97886421-97886443 AGCAGATTTCAGAAATGGAATGG + Intergenic
1101434048 12:104650048-104650070 GGCAGAAGTCAGAGAGGGCAGGG + Intronic
1101487067 12:105175338-105175360 TGGAGAGGTCAGAAAGACCAAGG - Intronic
1102448719 12:113024398-113024420 AGCAGAGCTCATAGAGGCCACGG + Intergenic
1102549135 12:113678478-113678500 AGCAGAGGTCAGAGAAGTCATGG + Intergenic
1103006292 12:117423026-117423048 ACCAGATGTCAGAAAGAAGAAGG - Intronic
1103532636 12:121612971-121612993 TCAAGATGTCAGCAAGGCCACGG + Intergenic
1104036843 12:125103628-125103650 TACAAATGTCAGAAAAGCCAAGG - Intronic
1104544545 12:129699408-129699430 AACAGTTGTCAGAAAGGACAGGG - Intronic
1105305681 13:19167224-19167246 AGCTGATATCAGACAGCCCAAGG + Intergenic
1106472493 13:30069874-30069896 AGCTGCTCTCAGAAATGCCAGGG + Intergenic
1107968107 13:45615465-45615487 AGCAGATGTCAGAAAGGCCAAGG + Intronic
1108804730 13:54140480-54140502 AGAAGATGTTATAGAGGCCATGG - Intergenic
1110435067 13:75470004-75470026 AGTAGGTTTCAGAAAGGACATGG + Intronic
1110473945 13:75891335-75891357 AGGCCAAGTCAGAAAGGCCAAGG - Intergenic
1110741297 13:79000348-79000370 AGAAGATGCCAGAAAGGAAAAGG + Intergenic
1112349611 13:98621988-98622010 AGCAGATGTCAAAAATGTCCAGG - Intergenic
1114936976 14:27550548-27550570 ATCACATGCCAGAAAGACCAAGG + Intergenic
1116900245 14:50355711-50355733 AGAAGATGTTATAGAGGCCAGGG + Intronic
1116991751 14:51284619-51284641 AGCAGATGTAATGATGGCCATGG + Intergenic
1117296107 14:54380747-54380769 AGCAGATGCCAGAAAGGATGTGG + Intergenic
1117411897 14:55457478-55457500 AGTAGATGCCAGAAAGGCAGTGG - Intergenic
1117707316 14:58484203-58484225 AGCAGATTTCAGCAAAGCCATGG - Intronic
1118207694 14:63738510-63738532 AGCAGGTGTCAAAAATGGCAGGG - Intergenic
1118856356 14:69626263-69626285 AGCAGAGAACAGAAAGGGCAAGG - Intronic
1119793546 14:77376387-77376409 AGAGGATGGCAGCAAGGCCAGGG + Intronic
1121592931 14:95133140-95133162 AGCAGATGTTAGAAAAGAAAAGG + Intronic
1121956069 14:98214644-98214666 GGCAGGTGTCAGAAAGGTGAGGG - Intergenic
1202924115 14_KI270724v1_random:8406-8428 GCCTGATGTCAGGAAGGCCAGGG - Intergenic
1124008014 15:25810231-25810253 ATCTGCTGTCAGAAAGCCCAAGG + Intronic
1124137180 15:27045234-27045256 AGCAGAGGTCAGCCAGGCGAAGG + Intronic
1125985724 15:44049655-44049677 TGGAGATGACAGAAAGGACAAGG - Intronic
1126182041 15:45794774-45794796 AGAAGGAGTGAGAAAGGCCAGGG + Intergenic
1126666193 15:51078034-51078056 AGCACATGTCAGGGACGCCACGG - Intronic
1127734799 15:61830674-61830696 TGCAGATTTGAGAAATGCCAGGG + Intergenic
1128520748 15:68373174-68373196 AGTTTATGTGAGAAAGGCCAGGG - Intronic
1129549486 15:76432245-76432267 AGCAACTGAGAGAAAGGCCAGGG + Intronic
1129911376 15:79229928-79229950 GGCAGAAGGCAGAAAGGCAAGGG - Intergenic
1130137974 15:81197512-81197534 AGCAGGAGAGAGAAAGGCCACGG + Intronic
1131098750 15:89672048-89672070 AGCAGATGGCAGTGAGGCCTTGG + Intronic
1131853305 15:96565516-96565538 AGCAGATGTCTGTTAGCCCATGG + Intergenic
1132090493 15:98944488-98944510 AGCACAGGTCAGGAAGGCTAGGG + Intronic
1132540966 16:509590-509612 TGAAGATCTCAGGAAGGCCAGGG + Intronic
1133605692 16:7385552-7385574 AGCAGAAATGTGAAAGGCCATGG + Intronic
1134378782 16:13704475-13704497 CGCAGGTGTCAGACAGGCCAAGG + Intergenic
1134657134 16:15955525-15955547 AGAAGAGGTCAGGGAGGCCAAGG - Intronic
1135798862 16:25474117-25474139 GTCAGATGTCAGAAAGGGGATGG - Intergenic
1137037301 16:35577636-35577658 AGGAGAAGTCATAAAGGACATGG - Intergenic
1138231773 16:55342938-55342960 GGCATATGTCAGAAAGGTGAGGG - Intergenic
1140017433 16:71201093-71201115 AGGGGATGTCAGAGAGGTCAAGG - Intronic
1142196863 16:88742999-88743021 AGCAGGTGCCTGAAATGCCAGGG - Intronic
1142475271 17:185031-185053 AGCAGAAGGCAGAGAGGCAAGGG - Intergenic
1142902902 17:3024392-3024414 AACAGATGTCAGAGAGGATATGG + Intronic
1143465086 17:7131182-7131204 AACAGATGGCAGAGAGGCCAGGG - Intergenic
1143782496 17:9236624-9236646 AGCAGATCTCAGCAACTCCAGGG - Intronic
1147402185 17:40187474-40187496 AGCAGAAGGCAGAAAGGGAAGGG - Intronic
1148150193 17:45392457-45392479 AGCTACTCTCAGAAAGGCCATGG - Intergenic
1148809906 17:50283755-50283777 AGCAGATGCCAGAAGGGCTGGGG - Intergenic
1149719983 17:58833878-58833900 AACAGATGTCGGAAAGGCTGTGG - Intronic
1150603594 17:66672068-66672090 AGCTAATCTCAGAAAGGGCAAGG + Intronic
1150824942 17:68466058-68466080 CGCAGAAGTCAGTAAGGTCAGGG - Intergenic
1150861122 17:68802124-68802146 AGCAGATGGGAGAATGGCCCAGG + Intergenic
1151102177 17:71568540-71568562 AGCAGAGGTCAGATATGGCATGG - Intergenic
1151535265 17:74735801-74735823 AGCTGATGTCAGAAAATACAGGG + Intronic
1151813490 17:76459105-76459127 AGCAGGAGTCAGAATGGCCAAGG - Intronic
1153259498 18:3209560-3209582 AGAGGATGTCAGAAAGGTGATGG - Intronic
1153440941 18:5118271-5118293 ATGAGATTTGAGAAAGGCCAGGG + Intergenic
1153673191 18:7432187-7432209 AGCAGCTCTCAGGCAGGCCAAGG + Intergenic
1153948019 18:10033745-10033767 AGCAGTCGTCAGAGAGACCATGG + Intergenic
1155336076 18:24766687-24766709 TCAAGATGTCAGCAAGGCCATGG - Intergenic
1156354383 18:36328912-36328934 TACAGATGTCAAATAGGCCATGG + Intronic
1157229334 18:45899426-45899448 AGCAGCGGTAAGAAATGCCAAGG - Exonic
1157254844 18:46129812-46129834 AGCAGATGTGACAAAAGCAAAGG + Intergenic
1157905735 18:51568374-51568396 AGCAGCTGTGAAAAAAGCCAAGG - Intergenic
1158871268 18:61690684-61690706 GGGACATGTGAGAAAGGCCATGG - Intergenic
1160587906 18:79922873-79922895 ATCAGAGGGCAGAGAGGCCAGGG + Intronic
1161231576 19:3177377-3177399 AGCCGTTGTCAGCAGGGCCATGG + Intronic
1161324384 19:3656319-3656341 AGCAGATGTCTGCAAGGCTTGGG - Intronic
1164378332 19:27709474-27709496 AGTAGGTGTTGGAAAGGCCAAGG - Intergenic
1164518992 19:28963124-28963146 GGCAGTTATCAGAAAGACCAAGG + Intergenic
1165294072 19:34911986-34912008 AGTAGGTGACAGCAAGGCCAGGG + Intergenic
1166338289 19:42122100-42122122 AGCACCTGTCAGAACAGCCAGGG - Intronic
1166612687 19:44213013-44213035 AGGATACGACAGAAAGGCCATGG - Intronic
1166875560 19:45895149-45895171 AGCTGAGGTCAGGAAGGCAATGG - Intronic
1202697620 1_KI270712v1_random:136500-136522 AGCAGAACTCAGAAAGGTGAAGG - Intergenic
926001234 2:9334428-9334450 ATCTGAAGCCAGAAAGGCCATGG - Intronic
926706900 2:15843540-15843562 CGCAGATGCCAGCAGGGCCACGG + Intergenic
926732954 2:16050922-16050944 AGCAGAATTCTGAAAGGCCAGGG + Intergenic
927615559 2:24590329-24590351 AGTAAATGTAAGAAAAGCCAAGG - Intronic
928088780 2:28361517-28361539 AGCTGTTCTCAGAAAGGACAGGG + Intergenic
928236891 2:29550377-29550399 AGCTGCTTTCATAAAGGCCAAGG - Intronic
928741842 2:34363822-34363844 ACCAGATGACAGAAAACCCATGG + Intergenic
930081059 2:47449151-47449173 AGCAGGTATCAGAATGTCCACGG + Intronic
930851211 2:55962557-55962579 AGCAGTTTTCAGAATGACCAGGG - Intergenic
931814315 2:65885710-65885732 AGCAGATAGAAGAAAGGCCAAGG - Intergenic
932730748 2:74220378-74220400 AGCAAAGGTCAGAAAGGGTATGG - Intronic
933276388 2:80288795-80288817 AGCAGATGTGAGAGAGGAAAAGG - Intronic
933633805 2:84684855-84684877 AGTAGAAGCCAGAAGGGCCAGGG + Intronic
933824620 2:86147809-86147831 AGAAGAAGTCAGAGATGCCATGG - Exonic
933890567 2:86765416-86765438 AGGAGATGTGAGAAAGAGCAAGG + Intronic
934278793 2:91593496-91593518 AGCAGAACTCAGAAAGGTGAAGG - Intergenic
934866210 2:97814896-97814918 AACAAATGTCAGAAAGGAAATGG + Intronic
936032235 2:109081667-109081689 AGCAGGTGTCAGGATGGGCAAGG - Intergenic
936265317 2:111000627-111000649 ACCAGAAGCCAGAAAGGGCAAGG - Intronic
936934028 2:117820575-117820597 CCCAGATGTCAGCAATGCCAAGG + Intronic
937319257 2:120951264-120951286 AGGAGATGTCAGAGATGACAGGG - Exonic
938063702 2:128270055-128270077 AGGACATGTCAGAAAGCCCCAGG + Intronic
938453147 2:131441979-131442001 AGGAGGTGTCATAAAAGCCAAGG + Intergenic
938770722 2:134498725-134498747 AGGAGTAGCCAGAAAGGCCAGGG + Intronic
939230831 2:139424409-139424431 ACCAGATGACAGAAAACCCATGG + Intergenic
939258663 2:139778548-139778570 AGTTGAGGTCAGAAAAGCCACGG + Intergenic
939329074 2:140735111-140735133 AGCAGTTGTCAAAGAGGACACGG + Intronic
942654591 2:178201856-178201878 AGCACATGTAAGAATGGTCATGG - Intronic
942905213 2:181172854-181172876 TGCACATAACAGAAAGGCCAAGG + Intergenic
943767181 2:191675968-191675990 AGCAGTTCTCAGAAAGGAAATGG - Intergenic
945473295 2:210252001-210252023 AACAGATGTCAGAATGGAGAAGG - Intergenic
945501876 2:210585917-210585939 AACAGGTGTCAGGAAGGGCATGG - Intronic
946999690 2:225439710-225439732 AGCAAATGTCAGGAAGCTCAAGG + Intronic
948214660 2:236219827-236219849 GGCAAAAGTCAGAAAGGCCTGGG + Intronic
1169401096 20:5281429-5281451 AGCAGATCTTGGGAAGGCCACGG + Intergenic
1170569444 20:17624725-17624747 AGCTGGTGTCAGACAGGACAGGG + Intronic
1173021028 20:39268499-39268521 AGTGGATCCCAGAAAGGCCAGGG + Intergenic
1174391789 20:50222271-50222293 GGATGAGGTCAGAAAGGCCATGG - Intergenic
1174717044 20:52770679-52770701 GGCTGGTGTCAGAGAGGCCAGGG + Intergenic
1175780201 20:61677211-61677233 CGCAGATATCACAGAGGCCAGGG - Intronic
1176052040 20:63124976-63124998 AGCAAAAGTGAGAAAGGCCAGGG + Intergenic
1178537221 21:33420350-33420372 GACAGACTTCAGAAAGGCCAAGG - Intronic
1178894822 21:36549639-36549661 AGCTGCTGTCAGAAAGATCACGG + Intronic
1179330108 21:40391950-40391972 AGCAGATGTGAAAAAGAGCATGG + Intronic
1179548022 21:42125242-42125264 AGCAGAGGCCAGAAAGCCCCAGG + Intronic
1181437194 22:22917858-22917880 AGCTGGTGTCAGGAATGCCAGGG - Intergenic
1181593060 22:23896448-23896470 AGGGGATGTGATAAAGGCCAGGG - Intronic
1181914482 22:26268602-26268624 AGCAGAGGGCACATAGGCCAGGG + Intronic
1182432720 22:30309815-30309837 AGCAGATGTCTAGAAGGACAAGG - Intronic
1182962844 22:34492344-34492366 AGAAGGTGACAGAAAAGCCATGG + Intergenic
1183308374 22:37096099-37096121 GGCAGAAGTGAGAGAGGCCAGGG + Intronic
1183387061 22:37520855-37520877 AGCAGAGCTCAGAGAGGGCAAGG + Intergenic
1184108711 22:42383202-42383224 AGCTGAGGTCAGAGAGGCCCAGG + Exonic
1184937035 22:47732296-47732318 AGCTGAGATCAGAAAGGCAATGG - Intergenic
1184937046 22:47732356-47732378 AGCTGAGATCAGAAAGGCAATGG - Intergenic
1184937057 22:47732416-47732438 AGCTGAGATCAGAAAGGCAATGG - Intergenic
1184937067 22:47732476-47732498 AGCTGAGATCAGAAAGGCAATGG - Intergenic
1184937078 22:47732536-47732558 AGCTGAGATCAGAAAGGCAATGG - Intergenic
1184937089 22:47732596-47732618 AGCTGAGATCAGAAAGGCAATGG - Intergenic
1184937100 22:47732656-47732678 AGCTGAGATCAGAAAGGCAATGG - Intergenic
1184937111 22:47732716-47732738 AGCTGAGATCAGAAAGGCAATGG - Intergenic
1184937121 22:47732776-47732798 AGCTGAGGTCAGAGAGGCAATGG - Intergenic
1184972892 22:48039678-48039700 AGCAGATGCCATAAAACCCAAGG + Intergenic
1185140309 22:49096930-49096952 AGCAGATGGCAGAATGGCCAAGG - Intergenic
950791909 3:15478798-15478820 AGAAGTTGACAGAAAGGGCAAGG + Intronic
951031055 3:17882129-17882151 AGATGAGGTCAGAAAGGCAATGG + Intronic
951523733 3:23632896-23632918 AGCAGATTTGACAAAGGTCAGGG + Intergenic
951707003 3:25553631-25553653 GGCAGATGTTATCAAGGCCAAGG - Intronic
952562338 3:34609889-34609911 AGCAGGTGATAGAAAGCCCAGGG + Intergenic
953240879 3:41148391-41148413 AGCAGATCCCAGAAAGCACATGG - Intergenic
953802056 3:46031747-46031769 AGCAGAGGGGAGAAAGTCCATGG - Intergenic
954439196 3:50512269-50512291 AGCAGGGCTCAGCAAGGCCATGG - Intergenic
954863800 3:53712196-53712218 TGCAGATCTCAGAAAGACAATGG - Intronic
955385411 3:58475360-58475382 AGCAGCTGTCACAAAGGCTTTGG - Intergenic
956891912 3:73622253-73622275 TGCAGCTGACAGACAGGCCAGGG + Intronic
958609812 3:96410582-96410604 AGCAGGGGTTATAAAGGCCAAGG - Intergenic
958753209 3:98217792-98217814 AACAGATGCCAGAAAGGCTGTGG + Intergenic
959496845 3:107061543-107061565 AGCAGCTTTCAGAAAGGAGAAGG + Intergenic
960109837 3:113834976-113834998 AGTATATGTCAGAAAGTTCATGG - Intronic
960570870 3:119184040-119184062 AGGACATGACAGAAATGCCAGGG - Intronic
960843050 3:121979373-121979395 ATGAGATTTCAGAAGGGCCAGGG + Intergenic
961666185 3:128494209-128494231 AGCAGGGGTCACAAAGACCAGGG - Intergenic
961826574 3:129602288-129602310 AGCACATGACACAAGGGCCAGGG - Intronic
964507616 3:157416633-157416655 AGCACATGTCACAAAGACCTTGG - Intronic
964841643 3:161000088-161000110 AGGTGATGGCATAAAGGCCACGG + Intronic
965737484 3:171836792-171836814 AGCAGATGCCAAGATGGCCAAGG - Intergenic
966329407 3:178794185-178794207 AGCAGACGTGTGAAGGGCCAAGG - Intronic
967364539 3:188670912-188670934 AGCTGAAGTCAGAAAGACAATGG - Intronic
968014827 3:195319861-195319883 ATGAGATTTGAGAAAGGCCAGGG + Intronic
968775029 4:2535615-2535637 CGCAGATGTCTGCAAGGCCGCGG + Intronic
969232973 4:5844624-5844646 AGCAGATGTCCAAAAGGTGATGG + Intronic
969602804 4:8187024-8187046 GGCAGGTGTCAGAGAGGGCAAGG - Intronic
970234078 4:13940620-13940642 AGCAGGTGAAAGAAAGGCAAAGG + Intergenic
970715932 4:18922897-18922919 AGCTGATGTCAGAGATGGCAGGG + Intergenic
970938965 4:21608615-21608637 GGCAGATGTGATAAAGGCTATGG - Intronic
971260771 4:25054722-25054744 AACAGAAGGCAGAAAGGCCCTGG + Intergenic
971849481 4:31965210-31965232 AAAAGTTCTCAGAAAGGCCAAGG - Intergenic
971960848 4:33485314-33485336 AGGAGGTGGCAGAAAGGCCATGG - Intergenic
973942032 4:55920822-55920844 AGCTGAAGTCAGACAAGCCAGGG - Intergenic
974240477 4:59239109-59239131 AACAGATGTTACAAAGGCTATGG + Intergenic
976166397 4:82259796-82259818 AGCAAATGTCAGAAAGGATATGG + Intergenic
977557710 4:98501741-98501763 AGCAAATGTCACACAGGCCATGG + Intronic
978928286 4:114277805-114277827 AACAGATGTCGGAAAGGCTGTGG - Intergenic
980204983 4:129706205-129706227 AGAAGATGCTAGAGAGGCCATGG - Intergenic
980663127 4:135893490-135893512 AGCAGATGTTGGAAAGGCAGTGG - Intergenic
981013286 4:139948399-139948421 AGCAGATGTGGCAATGGCCATGG - Intronic
981931126 4:150190322-150190344 GATAGATGTCAGAAAGGCCTGGG + Intronic
982621762 4:157716563-157716585 TGCAGTTGTCAGAAATGCAATGG + Intergenic
985046461 4:185945885-185945907 AGCAGCAGTCAGAAAGGCAAGGG + Intronic
985546285 5:510776-510798 AGGAGCTGTGGGAAAGGCCAGGG + Intronic
986830511 5:11572169-11572191 AGCAGATGTCACAAAGACCTGGG - Intronic
988934981 5:36072693-36072715 AGTAGATGTTGGCAAGGCCATGG - Intergenic
989423235 5:41265254-41265276 AGAAAATGTCAGAAAGATCACGG + Intergenic
990024149 5:51164881-51164903 AGAAGGAGTCAGAAAAGCCAAGG + Intergenic
991256031 5:64615854-64615876 ACCAGATGACAGAAAACCCATGG - Intergenic
991600150 5:68343831-68343853 TACTGATGTCAGAAAGGGCAGGG + Intergenic
992085260 5:73272555-73272577 AACAGATGTCATACAGGGCAGGG - Intergenic
992434721 5:76745130-76745152 AGGAGATGACAGAAAGGAAAGGG - Intergenic
993194827 5:84728309-84728331 AGCAGATTTCAGGTAGGACATGG + Intergenic
993940091 5:94047835-94047857 TGCAGATGCCAAAAAGGACAAGG + Intronic
995439340 5:112172877-112172899 AGAAAATGTCAGTAGGGCCAAGG - Intronic
995470874 5:112500927-112500949 ACCAGAAGTCAGAAGAGCCAAGG - Intergenic
997234510 5:132265043-132265065 AGTTGATGTCAGAAAGGTCCTGG - Intronic
997440690 5:133906826-133906848 GGCTGAGGTCAGAGAGGCCAAGG - Intergenic
997974304 5:138430460-138430482 AGCAGAAATAAGAAAGCCCATGG - Intronic
998498740 5:142613913-142613935 AGAAGATGTCAGAAAGGGAAGGG + Intronic
999812283 5:155139224-155139246 AGCACATCTCAGATAGGCCTGGG + Intergenic
1000391883 5:160730946-160730968 ACCAGGTCTCAGAAAGGACAGGG - Intronic
1000453432 5:161419307-161419329 AGCAGATGTTGGCAAGGACATGG + Intronic
1002054324 5:176590045-176590067 GGCAGATGTCACAGAGGCCTGGG - Intronic
1002194648 5:177495370-177495392 AGCTGTTGTCAGGAAGCCCAAGG - Intronic
1002824865 6:763575-763597 AGCAGAGGCCAGAAGGGCTAAGG - Intergenic
1003004092 6:2364547-2364569 ATCAGATGACAGAGAGGTCATGG + Intergenic
1003126826 6:3362524-3362546 AAGAGATCTCAGAAAGGTCATGG - Intronic
1003395260 6:5747517-5747539 AGCATATGGCAGACAGGACAGGG - Intronic
1003412758 6:5880034-5880056 ACCATATGGCAGCAAGGCCAAGG - Intergenic
1004128721 6:12898951-12898973 AGCACATTTCAGACAGGCCCAGG - Intronic
1004350785 6:14888605-14888627 AACAGAGCTCAGAAAGTCCATGG - Intergenic
1005249582 6:23929259-23929281 AGCACATTTCAGAAGTGCCAAGG - Intergenic
1006635334 6:35457623-35457645 AGAAGATGGAAGAAAGGCTATGG - Intronic
1006879162 6:37323847-37323869 AGCTGGTGTGAGAAAGGGCACGG + Intronic
1007173164 6:39878655-39878677 AGCAGGTGTCGGAGAGGCCAAGG + Intronic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1010090653 6:71977056-71977078 AGCGGATGGCAGAAATGTCAGGG + Intronic
1010630089 6:78189021-78189043 ATGAGATTTCAGAGAGGCCAAGG - Intergenic
1011562728 6:88638435-88638457 AGTAGACTTCAGAAATGCCATGG - Intronic
1011584722 6:88912105-88912127 AGAAGAAGACAGAAAGGCCTGGG + Intronic
1012906736 6:105075573-105075595 AGCACATATCAGGAAAGCCAAGG + Intronic
1014330194 6:120055135-120055157 AGGAGCTGTCAGAGAGCCCATGG + Intergenic
1015020267 6:128464896-128464918 AACAGAGGTCACAAAGGCTATGG + Intronic
1015200768 6:130577654-130577676 TGCAGCTCTCAGAAAGTCCACGG + Intergenic
1016247673 6:142003263-142003285 AGCAGATTTCAGCGAGGACAGGG + Intergenic
1016305496 6:142679400-142679422 AGGAAATGGCAGAAAGGCCAGGG + Intergenic
1019567576 7:1692089-1692111 AGCAGATGCCAGGAGGGTCATGG - Intronic
1020575141 7:9916737-9916759 AGCAGATACAAGAAAGGACAAGG + Intergenic
1021854815 7:24844063-24844085 AGAAGATGCCAGAAAGGGCTAGG - Intronic
1021906209 7:25336291-25336313 AACAGATGTTGGCAAGGCCATGG + Intergenic
1021922090 7:25495611-25495633 AGCAGTTGGCAGGCAGGCCACGG + Intergenic
1023343337 7:39246088-39246110 AGCAGGTGACAGAAAAGCCTTGG - Intronic
1023362773 7:39432777-39432799 AGCAGATGTCAGACCTGCCCTGG + Intronic
1023664502 7:42508498-42508520 AGGAGATAGCAGAAAGACCAAGG - Intergenic
1024137476 7:46425593-46425615 AGGAGAAGGCAGATAGGCCAGGG + Intergenic
1024597636 7:50953590-50953612 AGCAAATGGCAGAACAGCCACGG + Intergenic
1026182993 7:68058584-68058606 ACCAGATTTCAGAAAGGCATTGG + Intergenic
1027375380 7:77543059-77543081 CAGAGATGTCAGAAAAGCCAGGG + Intronic
1027396564 7:77761360-77761382 AGTAAATGTCACAAAGACCATGG - Intronic
1027848607 7:83419574-83419596 AACAGATGTCAGAGAGGCTGTGG - Intronic
1028481650 7:91313247-91313269 AGCAGCTGTCAGAAGGTCCTAGG + Intergenic
1029531260 7:101126829-101126851 GGCAGAGGGCAGAAAGGTCAAGG + Intergenic
1030003442 7:105091286-105091308 AGCAGATTGCAGAAAGGAAAAGG + Exonic
1031410855 7:121438748-121438770 AGGAGAGGTCAGAGAGGGCATGG - Intergenic
1032244387 7:130196656-130196678 AAGAGATACCAGAAAGGCCATGG + Intronic
1034446605 7:151116994-151117016 AGCAGGAGGGAGAAAGGCCAGGG - Intronic
1034511458 7:151538481-151538503 AGCAGATGTCAGCACGACCAGGG + Intergenic
1035368305 7:158362463-158362485 ATCAGACCTCAGAAAGGCAAAGG + Intronic
1035446451 7:158946537-158946559 AGCGGAGGACAGAAAGGCCCTGG + Intronic
1036637167 8:10559342-10559364 AGCAGGTGCCAGAGTGGCCAAGG + Intergenic
1036640953 8:10583420-10583442 AGCAGGTGTCAGACAGGGCCTGG - Intergenic
1037648397 8:20814787-20814809 AGCAGCTGTCAGAGAAGGCAGGG + Intergenic
1037662454 8:20939530-20939552 AGCAGGTGCCAGGCAGGCCAGGG + Intergenic
1037933040 8:22894979-22895001 ATCAGATTTCAGCATGGCCAAGG + Intronic
1038428469 8:27480878-27480900 ACCAGATGCCAGGAAGGCCAAGG + Intergenic
1041621480 8:59974983-59975005 AACAGATGTCAGAAAGTTTAGGG + Intergenic
1042606992 8:70555479-70555501 AGGACATGGCAGAAAGGACAAGG - Intergenic
1043361777 8:79480949-79480971 AACAGATGTTAGCAAGGTCATGG - Intergenic
1043523541 8:81072374-81072396 CCCAAATGTCAGCAAGGCCAGGG - Intronic
1043695046 8:83207580-83207602 AGCAGAGGACAGAAAGATCAAGG + Intergenic
1043957741 8:86381795-86381817 TGCAGAATGCAGAAAGGCCATGG - Intronic
1044032786 8:87259182-87259204 AGGACAAGTCAGAAAGTCCAAGG - Intronic
1044849905 8:96418075-96418097 TACAGATGTCAGCAAGGCCAGGG + Intergenic
1048497799 8:134949558-134949580 AGCAGAATTCATAAGGGCCACGG + Intergenic
1051488186 9:17631397-17631419 AACAGTTGTCAGAATGGCCAAGG - Intronic
1055194619 9:73573509-73573531 AGGAGATGGCTGAAATGCCAAGG + Intergenic
1055977011 9:81965462-81965484 GGAAGATGTCAGACAGGGCAGGG + Intergenic
1056181194 9:84084219-84084241 AGAAGATGTCAGAGAGAGCAGGG - Intergenic
1057442265 9:95091108-95091130 AGCAGCTGAAAGCAAGGCCAAGG + Intergenic
1057554771 9:96078994-96079016 AGCAGAACTCACAGAGGCCAAGG - Intergenic
1058290628 9:103236555-103236577 AGTAGAGGTCAGGAAGGGCAGGG - Intergenic
1061840279 9:133354766-133354788 AGCAGATGGCAGCAAGGTCAAGG + Intronic
1062647441 9:137556031-137556053 AGCAGAGGTGAGAAAGTCCAAGG + Intronic
1062703488 9:137920568-137920590 AGGAGCTGTCAGAATGGTCATGG + Intronic
1185673202 X:1827570-1827592 AACAGATGCCAGAAAAGGCAAGG + Intergenic
1187563661 X:20426932-20426954 AGCAGGTGTATGACAGGCCAGGG + Intergenic
1187992826 X:24894565-24894587 AGCAGATGCTAGAAAAGGCAAGG - Intronic
1188158869 X:26776192-26776214 AGAAGGTGTCTGAAATGCCATGG - Intergenic
1189067739 X:37828912-37828934 AGCAGAGGTCAGAAAGGAACGGG + Intronic
1189548213 X:42066028-42066050 AGCAGATGTAAGTAACTCCATGG - Intergenic
1190469837 X:50767575-50767597 AACAGCTGCCAGAAAGCCCATGG - Intronic
1190782102 X:53607562-53607584 AGCAGATGTGGGAAAGTCAATGG + Exonic
1192048422 X:67700653-67700675 AGCAGATGCCATATAGGCCTGGG + Intronic
1195726712 X:107925182-107925204 AGCAGAAGTCAGACAGAGCAGGG - Intronic
1196003027 X:110806752-110806774 AAAAGATGTCAGAAGGCCCATGG - Intergenic
1196376048 X:115033768-115033790 AACAGGTGTCAGAAAAGCCGAGG - Intergenic
1197040654 X:121931943-121931965 ATGAGATTTCAGAGAGGCCAGGG - Intergenic
1197675980 X:129330375-129330397 GGCAGTTTTCAGAAAGGCAAAGG + Intergenic
1198512190 X:137363541-137363563 AGCGGGTGTCAGAAAGCACAGGG - Intergenic
1199505271 X:148554379-148554401 GGCAGACATGAGAAAGGCCATGG + Intronic
1199968953 X:152844495-152844517 AGCAGAGGTCAATAAGGCCTTGG + Intronic
1200010187 X:153114665-153114687 TGCAGAGGTCAGAAGGGCCTGGG - Intergenic
1200029413 X:153285257-153285279 TGCAGAGGTCAGAAGGGCCTGGG + Intergenic
1200134937 X:153870265-153870287 AGCAGAAGGGAGAAAGGACAAGG + Intronic
1200353636 X:155525603-155525625 AGAAGAAGACAGAAAGGCGAGGG + Intronic