ID: 1107968697

View in Genome Browser
Species Human (GRCh38)
Location 13:45620992-45621014
Sequence CAGGGACACCAATCAAACGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107968690_1107968697 7 Left 1107968690 13:45620962-45620984 CCAACTTGGTTCCAATCTCCCCA No data
Right 1107968697 13:45620992-45621014 CAGGGACACCAATCAAACGTAGG No data
1107968688_1107968697 22 Left 1107968688 13:45620947-45620969 CCTAAGGTGTGTTTTCCAACTTG No data
Right 1107968697 13:45620992-45621014 CAGGGACACCAATCAAACGTAGG No data
1107968691_1107968697 -4 Left 1107968691 13:45620973-45620995 CCAATCTCCCCATCGTTTTCAGG No data
Right 1107968697 13:45620992-45621014 CAGGGACACCAATCAAACGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107968697 Original CRISPR CAGGGACACCAATCAAACGT AGG Intergenic
No off target data available for this crispr