ID: 1107978320

View in Genome Browser
Species Human (GRCh38)
Location 13:45711601-45711623
Sequence CCAGCTCCTTCAGGTGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 321}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107978320_1107978324 -2 Left 1107978320 13:45711601-45711623 CCAGGAACACCTGAAGGAGCTGG 0: 1
1: 0
2: 0
3: 28
4: 321
Right 1107978324 13:45711622-45711644 GGTTAGAAATGCAGATTCCTGGG 0: 1
1: 19
2: 143
3: 705
4: 2017
1107978320_1107978323 -3 Left 1107978320 13:45711601-45711623 CCAGGAACACCTGAAGGAGCTGG 0: 1
1: 0
2: 0
3: 28
4: 321
Right 1107978323 13:45711621-45711643 TGGTTAGAAATGCAGATTCCTGG 0: 1
1: 21
2: 138
3: 574
4: 1456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107978320 Original CRISPR CCAGCTCCTTCAGGTGTTCC TGG (reversed) Intronic
900364780 1:2306660-2306682 CCACCTTCTCCAGGTGCTCCCGG - Exonic
900365555 1:2310689-2310711 CCAGCTCCCTGAGGAGCTCCTGG + Intergenic
903267565 1:22167111-22167133 CCACCTCCTGCAGGTGCTCTGGG - Intergenic
903515569 1:23908758-23908780 CCAGCTCCATCAGATTTTCCAGG + Intronic
905010152 1:34741804-34741826 CCAGGTCCTCCAGGTCCTCCAGG - Intronic
905010155 1:34741813-34741835 CCAGGTCCTCCAGGTCCTCCAGG - Intronic
905998088 1:42399501-42399523 CCAGCTTCTCCAGGTGTCGCAGG - Exonic
906047597 1:42843927-42843949 CCAGCTCCCTGATGTGCTCCTGG - Exonic
907480353 1:54741562-54741584 CCAGCTGATTCAGGTGTGCTAGG - Exonic
907522943 1:55037033-55037055 CCAGCTCCTTTGGGGGCTCCTGG + Intergenic
910317892 1:85908623-85908645 CCAGGTCCTCCTGGGGTTCCAGG - Exonic
912499537 1:110112912-110112934 CCAGCTGCTCCAGGTGCTCCAGG - Exonic
912933025 1:113981224-113981246 CCACCTCCACCAGGTCTTCCAGG - Exonic
913109507 1:115644800-115644822 CCAGCTGCTGGAGGTGTTTCAGG + Intronic
915565564 1:156710913-156710935 CCAGCTCTCTTAGGAGTTCCAGG + Intergenic
917451576 1:175151720-175151742 TCAGCTCCTTCAGCATTTCCTGG - Intergenic
918225121 1:182474263-182474285 TCAGCTTCTTCAGGTGGTCCCGG - Exonic
919068904 1:192728802-192728824 CCTCTTCCTTCAGGTGATCCTGG + Intergenic
922786985 1:228287710-228287732 CCAGGTCCTTCAGGGCCTCCTGG - Exonic
1064702645 10:18037687-18037709 CCAGGTCTTTCAGGTTGTCCTGG - Intronic
1065154349 10:22854131-22854153 CCATCTGCTTCAGGTGAACCTGG + Intergenic
1067652097 10:48163812-48163834 CCAGCTCCTCCACATGCTCCCGG + Intronic
1070388570 10:75949198-75949220 CCAGCTGCTTCTGGTATTCCAGG - Intronic
1072081564 10:92037724-92037746 TCATCTGCTTCAGGTGATCCTGG - Intergenic
1072145171 10:92629276-92629298 CCAGCTCCTTCAGATTTTTTTGG + Intronic
1073510381 10:104039103-104039125 CCAGGTGATCCAGGTGTTCCAGG - Exonic
1075485655 10:122820170-122820192 CCAGCTCCCTCAGGAGGCCCTGG + Intergenic
1077413241 11:2413180-2413202 CCAGGTCCTGCAGGTCCTCCAGG + Exonic
1078040017 11:7851634-7851656 CCAGCACCTTCTGCAGTTCCTGG + Intergenic
1078877111 11:15410103-15410125 TCAGCTCTTTCTGGTGTTCAAGG - Intergenic
1078987215 11:16607653-16607675 CCATCGCCTTCACTTGTTCCAGG - Intronic
1079249954 11:18780136-18780158 CAGGCTCTGTCAGGTGTTCCTGG + Intronic
1080233300 11:30042206-30042228 CCAGGTCCTTCAGACATTCCTGG - Intergenic
1080669946 11:34366692-34366714 CCAGGAATTTCAGGTGTTCCCGG + Intergenic
1081410757 11:42755545-42755567 GCATCTCCTTCAGGTGATCTTGG + Intergenic
1081655477 11:44854311-44854333 TCAGTTCCTCCCGGTGTTCCAGG - Intronic
1083683168 11:64360574-64360596 CCACCTTGTGCAGGTGTTCCAGG - Exonic
1084428379 11:69097833-69097855 CCAGCAGCCTCAGGTGTTCTTGG + Intergenic
1084936183 11:72587936-72587958 CCACCTCCTGCAGGAGCTCCAGG + Intronic
1085524322 11:77155412-77155434 CCAGCTCCTTCAGCTCTTTATGG + Intronic
1085642416 11:78200718-78200740 CCAGCTCCGCCAGCTGCTCCAGG - Exonic
1086256454 11:84882422-84882444 CCTTCTCCTACAGGTGTTCAGGG + Intronic
1087130477 11:94665517-94665539 CCATAACCTGCAGGTGTTCCAGG - Intergenic
1087990252 11:104740406-104740428 CCACCGTTTTCAGGTGTTCCTGG + Intergenic
1088841236 11:113629281-113629303 CCAGCCTCTTCAGGGGTTCTTGG - Intergenic
1088859870 11:113789718-113789740 CCAGCTTCTACAGGTGGTGCTGG - Intergenic
1090234245 11:125134806-125134828 CCACCTTCATCAGCTGTTCCTGG + Intergenic
1091593195 12:1857586-1857608 CCACCTCTTCCAGGGGTTCCTGG + Intronic
1091639100 12:2221041-2221063 CTAGCTCCTTCTTGTCTTCCAGG - Intronic
1091683067 12:2540658-2540680 CCACCTCCTGCACGTATTCCAGG - Intronic
1092100787 12:5882265-5882287 CCACCTCCTTCTAGTGTACCTGG - Intronic
1093522114 12:20063208-20063230 CCATCTCCTTCAGCTATTCACGG + Intergenic
1095957577 12:47815524-47815546 ACAGGTGCTTCAGGTGATCCTGG - Intronic
1097502032 12:60415817-60415839 CCATCTCCTCCAGGAGTTCAGGG - Intergenic
1098162364 12:67657714-67657736 CCTGCTTCCGCAGGTGTTCCAGG - Exonic
1100497708 12:95141407-95141429 CCAGTTCCTTCAAGAGATCCCGG + Exonic
1101800049 12:108013827-108013849 CTTCCTCCTTCAGGTCTTCCAGG + Intergenic
1102542822 12:113634870-113634892 CAAGCTCCCTCTGGAGTTCCAGG + Intergenic
1102614493 12:114141517-114141539 CCAGCCCCTTCCAGTGTTCCAGG + Intergenic
1103820055 12:123690520-123690542 CCTTCTCCCTCAGGTGTCCCTGG + Exonic
1104529005 12:129551145-129551167 CCAGCTCCTCCAAGACTTCCTGG + Intronic
1104929100 12:132328984-132329006 CCACCTCCTCCAGGTGGTCCAGG + Intronic
1104987453 12:132604847-132604869 CCAGCTCGCTCACCTGTTCCTGG + Intronic
1107085062 13:36418325-36418347 CCATCTCCCTGAGGTGTTCTGGG - Intergenic
1107152641 13:37129674-37129696 CCAGTTCCTTCTGTGGTTCCAGG - Intergenic
1107959504 13:45545669-45545691 CCAGCTCCAGCAAGTGTTACTGG - Intronic
1107978320 13:45711601-45711623 CCAGCTCCTTCAGGTGTTCCTGG - Intronic
1108038852 13:46320857-46320879 CTACCTCCTTCAGTTCTTCCAGG + Intergenic
1108461599 13:50672779-50672801 TCAGCACTTTCAGGAGTTCCAGG + Intronic
1108692160 13:52869254-52869276 CCAGAGCCTGCAGGTGTTCTGGG - Intergenic
1110648238 13:77914708-77914730 CCAGCTCCTTGAGGAAGTCCAGG + Intronic
1110866217 13:80398951-80398973 CCCGCGCTTCCAGGTGTTCCCGG - Intergenic
1111859608 13:93685280-93685302 TCAGCTCTTTCAGGTGCTCTTGG - Intronic
1112569977 13:100585407-100585429 CCAGCTCTTTCAGGCTTTGCAGG - Intronic
1113359259 13:109613784-109613806 ACAGCTGATGCAGGTGTTCCAGG - Intergenic
1113417169 13:110137316-110137338 TCAGTTCCTTAACGTGTTCCAGG + Intergenic
1114483604 14:23049720-23049742 CCAGCTGATTCAGGTCATCCGGG - Exonic
1114537522 14:23432404-23432426 CCAGCCCCATCAGGTGTCCCAGG - Intronic
1114670369 14:24407865-24407887 ACAGGCCCTTCAGGTATTCCTGG - Exonic
1115393834 14:32884117-32884139 TCAGCTGCTTCAGGTGATCCTGG - Intergenic
1115522144 14:34243637-34243659 CCAGCTCCTTCAGGTTTTATTGG + Intronic
1118878988 14:69810303-69810325 CCAGCTCCTCCTGCTGTCCCTGG + Intergenic
1119078660 14:71671290-71671312 CCAGATCTTTCAGGTATTCCTGG - Exonic
1119294536 14:73522366-73522388 CCAGCTGTTTCAGGAGCTCCAGG + Exonic
1120160437 14:81139721-81139743 TCAGTTCCTTCAGGTGCTCCAGG - Exonic
1121226001 14:92322669-92322691 CCAGCTCCTTCAGGGCTCTCGGG - Intronic
1124666295 15:31595766-31595788 CAGCCTCCTTCAGGTGTGCCAGG + Intronic
1125671567 15:41477209-41477231 CCAGCTCATTCAGTTGATCTTGG - Exonic
1125723776 15:41857641-41857663 CCAGCTCCTCCAGTCGCTCCTGG + Exonic
1126411235 15:48375208-48375230 TCAGCTACTCCAGGTGTTTCTGG + Intergenic
1126419237 15:48454212-48454234 CCAGCTGATGCAGGTGCTCCTGG + Intronic
1127531696 15:59849964-59849986 CCAGCACCTTCAGCTGTTTTGGG + Intergenic
1128704321 15:69827693-69827715 CCACCTCCTCCAGGAGCTCCTGG - Intergenic
1129263934 15:74383870-74383892 CCGGCTCCTCCAGGTGGTGCAGG - Intergenic
1129426738 15:75468936-75468958 CAAGCTCCTCCAGCTGTGCCAGG + Exonic
1131048340 15:89330267-89330289 TCACCTCCCTCAGGTATTCCTGG - Exonic
1131066329 15:89436908-89436930 CCAGGTCCTTCTGGTGTCCTCGG + Intergenic
1131182651 15:90250946-90250968 CCAGCTCCTCCAGATGTTGAAGG - Intronic
1132382121 15:101373242-101373264 CCAGCTCCTGCAGGAGTTAATGG + Intronic
1132583132 16:694367-694389 CCAGCTCCTGCAGCTGCACCAGG + Exonic
1132612047 16:822080-822102 TCAGCTTCCCCAGGTGTTCCAGG + Intergenic
1132648481 16:1009932-1009954 CCAGCCCCTCCTGGTGTCCCTGG - Intergenic
1134094524 16:11410935-11410957 CCAGCTTCTACAAGTGTGCCAGG + Intronic
1136394629 16:29986393-29986415 CCAGCTCCGTCTGGTGCTGCAGG - Exonic
1136492880 16:30622083-30622105 CCTGCGCTTCCAGGTGTTCCTGG + Intronic
1139503460 16:67387178-67387200 CTAGCACCATCAGGTGTTCATGG - Intergenic
1141359386 16:83381319-83381341 CCTGCCCCTTCATGTCTTCCTGG + Intronic
1141710789 16:85697891-85697913 CCAGCTCCTTCTCAAGTTCCCGG - Intronic
1142736761 17:1905851-1905873 CCCCCTCATTCAGATGTTCCTGG - Intergenic
1143950984 17:10631959-10631981 GCTGCTCCTTCAGGTCCTCCTGG + Exonic
1145753895 17:27376037-27376059 TCATCTACTTCAGGTGATCCTGG - Intergenic
1146343337 17:32040886-32040908 CCAGCTTCTGCAGGTGGTGCTGG - Intronic
1146783084 17:35693706-35693728 TCAACTCCTTCAGGGGTTCCTGG - Intronic
1148783408 17:50133954-50133976 CCAGCTCCTTCAGGGGATGGGGG + Exonic
1148892303 17:50817116-50817138 CCAGCTCCTTGGGGTGTGGCTGG + Intergenic
1148929991 17:51120431-51120453 CCAGCTCCACCTGGTGCTCCTGG + Exonic
1148977277 17:51540449-51540471 TCATCTCCTTCTGGGGTTCCAGG - Intergenic
1150645508 17:66975266-66975288 CCAGCCCCTTCCTGTGTCCCTGG - Intronic
1150782608 17:68135124-68135146 CCAGCTTCTGCAGGTGGTGCTGG + Intergenic
1151202527 17:72479075-72479097 CCTGATCCTTCAGGTTTTCCTGG - Intergenic
1151674425 17:75590211-75590233 CCAGGTCCTCCATGTCTTCCAGG - Intergenic
1152398579 17:80050135-80050157 GCAGCTTCTGCAGGTGTACCAGG - Exonic
1153787231 18:8545792-8545814 CCTGCTCCTTGAGCTGCTCCTGG - Intergenic
1156012767 18:32513260-32513282 CCTGCACCTCCAGGTATTCCTGG + Intergenic
1157043635 18:44068828-44068850 CCATCTCCTCCAGGTCCTCCAGG + Intergenic
1157288133 18:46391355-46391377 ACAGCTCTTTCAGGTTGTCCTGG + Intronic
1157456470 18:47834221-47834243 TCAGCTCCTTCTGGTGTGCCTGG + Exonic
1157733515 18:50025429-50025451 CCACCTCCTTGAGGAGTTCCGGG - Intronic
1158118012 18:54018290-54018312 CCAGCTCCTGGATGTTTTCCTGG + Intergenic
1159774065 18:72584008-72584030 CCAGGTCCTTCAGGCCCTCCAGG - Intronic
1161117110 19:2503818-2503840 CTAGCTCCGTCAGGTGTTGACGG + Intergenic
1161198844 19:3003027-3003049 CCAGCACCATCAGGGGTTGCGGG + Intronic
1161454634 19:4363860-4363882 CCAGTTTCTTCAGGTGGTGCTGG + Exonic
1161493759 19:4576470-4576492 CCAGCTCCTTCTCATCTTCCAGG + Intergenic
1161686611 19:5705854-5705876 CGAGCTCCTTCAGGCGCTCCCGG + Exonic
1161801038 19:6416851-6416873 CCAGGTCCTCCAGGGGGTCCAGG - Exonic
1161984919 19:7647756-7647778 CCAGTGCCTTCAGGTCATCCAGG - Exonic
1162341171 19:10092230-10092252 CCTCCTCCTTCAGGTCCTCCAGG - Exonic
1162737317 19:12753809-12753831 CCAACCCCTTCAGAAGTTCCTGG + Intronic
1164013948 19:21235331-21235353 CCTGCGCTTCCAGGTGTTCCTGG - Intronic
1165327999 19:35125324-35125346 CCAGCTCCTGCAGTGGCTCCAGG + Exonic
1165895195 19:39137068-39137090 GTGGCTGCTTCAGGTGTTCCTGG + Intronic
1166785596 19:45364882-45364904 CCAGGGCCTTCAGGTCATCCAGG + Exonic
1167261665 19:48462426-48462448 CCAGCTGCTGCAGGTGCGCCCGG + Exonic
1167379196 19:49128853-49128875 CCAGGCACTCCAGGTGTTCCAGG - Exonic
1167446217 19:49539115-49539137 CCAGGTCCTCCAGGGTTTCCTGG - Exonic
1167613619 19:50519010-50519032 CCAGCTCCTCCAGGCGCACCAGG + Exonic
1168140265 19:54381209-54381231 CCTTCTCCTTCAGGTCTTCTTGG + Intergenic
1168316384 19:55486530-55486552 CCTCCTCCTGCCGGTGTTCCTGG + Exonic
925369353 2:3333060-3333082 CCAGATCCTTCAGCTGTGCACGG + Intronic
925650369 2:6082988-6083010 CCAGTGCCATCAGGTGTTGCTGG - Intergenic
927530484 2:23793765-23793787 CTAGCACTTTCAGGTGTTACTGG - Intronic
927711091 2:25326776-25326798 CCAGCTCCTGCAGGAGTGCCAGG + Intronic
928097300 2:28412509-28412531 CCAGCACCTTCAAGCGCTCCAGG + Exonic
932620164 2:73260446-73260468 CCAGTCCCTTCAGGCCTTCCCGG + Exonic
933177729 2:79194714-79194736 CCATCTCCTTCAGCTGTCACTGG + Intronic
934989531 2:98911615-98911637 CCAGCTCCTTCAGGTGGGCTTGG - Intronic
935341235 2:102061517-102061539 CCAGCTCCTCCTGGAGATCCCGG - Intergenic
935796304 2:106644655-106644677 TCACCTCCTTCAGGTGTCCTGGG - Intergenic
936924175 2:117720046-117720068 CAATCTCCTACAGGTGTTCACGG - Intergenic
937216059 2:120314318-120314340 CCAGCTCCGTCCGGAGCTCCTGG - Intergenic
937319959 2:120955249-120955271 CCCTCTCCTTAAGGTGCTCCTGG - Exonic
938499157 2:131821528-131821550 CCAGCTCCCTCAGGAGGACCTGG - Intergenic
939106688 2:137956668-137956690 CCTGCTCCTACAGGTGGTACAGG + Intergenic
940755027 2:157672255-157672277 TCATCTGCTTCAGGTGATCCTGG + Intergenic
941209828 2:162624156-162624178 TCACCTGCTTCAGGTGATCCTGG - Intronic
941444381 2:165582535-165582557 CCAGCTCCTTCAGTTTCTTCCGG - Intronic
941975835 2:171404352-171404374 TCAGCTGCTTCAGGTAATCCTGG + Intronic
942035704 2:172008830-172008852 TCATCTGCTTCAGGTGATCCTGG + Intronic
942687187 2:178545657-178545679 CCAACTTCTTCAGGTATGCCGGG + Exonic
942689498 2:178570497-178570519 ACAGGTCCTTCAGGTGGCCCTGG + Exonic
943183982 2:184581582-184581604 CCAGCTCCTTCAGCTCTATCAGG - Intergenic
946735933 2:222754516-222754538 CCAGCTCCTGCAATTGTCCCTGG + Intergenic
947164814 2:227251146-227251168 CCAGGCCCTCCAGGTTTTCCTGG + Exonic
947170178 2:227303044-227303066 CCAGGTACTCCAGGTCTTCCAGG + Exonic
947170392 2:227305026-227305048 CCAGCTGGTCCAGGAGTTCCTGG - Exonic
948343043 2:237270497-237270519 CCAGCTCCTGCAGCCATTCCAGG + Intergenic
948437077 2:237961109-237961131 CCGGCTTCATCTGGTGTTCCTGG - Intergenic
948906417 2:240981775-240981797 CCAGCTCCTTCTGGGGTGGCCGG - Intronic
948909131 2:240994248-240994270 CCAGCTCCATGAGGTGGTTCTGG - Intergenic
1169390465 20:5186427-5186449 CCAGTCCCTTCAGGTTTTCCCGG + Intronic
1169496641 20:6122445-6122467 CAAGCACCTTCAGATATTCCAGG - Intronic
1170571741 20:17636594-17636616 GCACCTCCTTCACGTGCTCCCGG + Exonic
1170582829 20:17711792-17711814 CCAGCTGCTACAAGTGTTGCAGG - Intronic
1171403426 20:24893586-24893608 CCAGCTGCTTCAGGTGCTGGTGG - Intergenic
1172036961 20:32017972-32017994 GCAGCTCCTTCAGCTGCTGCAGG - Exonic
1172692869 20:36802709-36802731 CCATCTCCTTCAGGTATAGCTGG - Intronic
1172845697 20:37928791-37928813 CCAGCTCCTGCAGCAGTACCTGG - Intronic
1173154101 20:40593429-40593451 CCAGCTCATTCAGAAGCTCCTGG + Intergenic
1173809906 20:45949332-45949354 CCCGTTCCTTCAGGAGTCCCAGG - Exonic
1175710782 20:61219014-61219036 CCAGCTCCTTCATGTGTTTATGG - Intergenic
1176004239 20:62851014-62851036 CCAGCACCTTCAGCAGTGCCTGG + Intronic
1176221920 20:63973799-63973821 CCAGCTCCCTCAGGGCCTCCTGG - Intronic
1176421177 21:6517063-6517085 CCAGTTCATGCAGGTGTTACAGG + Intergenic
1179696667 21:43125380-43125402 CCAGTTCATGCAGGTGTTACAGG + Intergenic
1179708184 21:43194457-43194479 CCCACTCCTTCAGGTGGCCCAGG - Intergenic
1179902261 21:44400359-44400381 TCATCTCCTTCAGGTGCTGCAGG + Exonic
1179922387 21:44514139-44514161 CCAGCCCCTTCAGGCTGTCCTGG + Intronic
1180918181 22:19504258-19504280 CCATCTCCTTGAGGAGTTCTGGG + Intronic
1181116335 22:20634514-20634536 CCAGGTCCTGCAGGTGTTCAGGG + Intergenic
1181439384 22:22927907-22927929 CCAGGTCCTGCAGGTGTTCAGGG + Intergenic
1181601881 22:23957714-23957736 CCAGACCCTTCAGGGGATCCTGG + Exonic
1181606628 22:23983593-23983615 CCAGACCCTTCAGGGGATCCTGG - Exonic
1181855391 22:25777732-25777754 CCATCCCCACCAGGTGTTCCAGG - Exonic
1181877037 22:25947777-25947799 TCAGCTCATTCAGGTCATCCTGG - Exonic
1182228030 22:28815195-28815217 CAAGCTCCTTCCTGTGTGCCAGG - Intergenic
1183315488 22:37134858-37134880 CCAGCTCTTTGAGCTGTACCTGG + Intronic
1183416991 22:37688317-37688339 CCAGCATCTTCAAGTATTCCTGG - Exonic
1183688170 22:39374023-39374045 CCAGGTCCTAAAGGTCTTCCTGG - Intronic
1183735599 22:39643244-39643266 CCAGCTCATTCCTGTTTTCCTGG + Intronic
1183822908 22:40361293-40361315 CCATCTCCTTGAGGTTTGCCAGG - Exonic
1184940114 22:47758315-47758337 TCATCTGCTTCAGGTGATCCTGG + Intergenic
950027310 3:9829062-9829084 CCATCTCCTGCAGGTGGGCCTGG - Exonic
951428890 3:22583242-22583264 TCAGCTTCCTCAGGTGCTCCTGG - Intergenic
954077836 3:48194268-48194290 CCAGCTCCTGCAGGAAGTCCAGG - Intergenic
954145761 3:48633526-48633548 CCAGCTCCTCCAAATGCTCCTGG + Exonic
954660243 3:52223208-52223230 CCAGCTCCTTCAGGGCGACCAGG + Exonic
959348382 3:105228808-105228830 CCACTTCCTTCATGTATTCCTGG + Intergenic
960210034 3:114952742-114952764 CCATTTCCTTCAGGTTTTCATGG - Intronic
961059673 3:123817785-123817807 CCAGATCCTTAGGGTGGTCCTGG + Intronic
961442860 3:126963024-126963046 CCAGCTTCTTCAGCATTTCCGGG + Intergenic
961453309 3:127012319-127012341 CCAGGCCCTTCAGATGTGCCTGG + Intronic
961555118 3:127691873-127691895 CCAGCTCCCACAAGGGTTCCAGG - Exonic
961577417 3:127849258-127849280 CCAGCTCCTTCAGCCATCCCAGG + Intergenic
961682411 3:128608068-128608090 CCAGGGCCTGCAGGTGCTCCAGG + Intergenic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
964483398 3:157163579-157163601 CCTGCTTCTCCAGGTGCTCCCGG + Intergenic
964570224 3:158102767-158102789 CCAGCTCATTGAGTTGTTCCAGG + Exonic
965943238 3:174210356-174210378 CCAGCACCTTCAGGTATATCTGG + Intronic
967097806 3:186192121-186192143 CCAGCTACTTCAGGAGTCCAAGG - Intronic
968595226 4:1478915-1478937 CCCGCTCCTGCAGATGCTCCTGG - Intergenic
968913755 4:3488252-3488274 CCAGGCCCTTCTTGTGTTCCTGG + Intronic
969164894 4:5299056-5299078 CCAGCCCCTTCTGGGCTTCCTGG + Intronic
969393605 4:6907056-6907078 CCTGCTCTTTCAGGGCTTCCAGG - Intergenic
970600739 4:17639320-17639342 GCATCTCCTTCCGGTGTTCCTGG + Exonic
972844737 4:42974150-42974172 CCATCTCCTTGAGGAGTTCTGGG + Intronic
974991429 4:69095227-69095249 CCAGCTCCTCAAGGAGTTCTGGG + Intronic
975104547 4:70553210-70553232 CCTGCACTTCCAGGTGTTCCTGG + Intergenic
975275188 4:72489553-72489575 ACATCTGCTTCAGGTGATCCTGG - Intronic
978042993 4:104092671-104092693 CCACCTCCTACAGGTGTTTTTGG + Intergenic
979735370 4:124076162-124076184 CCAGCTCCTTTTTGTGTTTCTGG - Intergenic
981122888 4:141073098-141073120 CCAGCTACATCAGGTGAGCCAGG + Intronic
982066956 4:151662661-151662683 CCAGCTCCTTCAGGAACTCTGGG - Exonic
983620152 4:169752837-169752859 CAAGCTCTTTCATGTGTTGCAGG - Intronic
984704680 4:182839285-182839307 CCAGCACCCTGAGCTGTTCCCGG - Intergenic
984908863 4:184653221-184653243 CCCCCTCCTTCAGCTGCTCCTGG + Intronic
985285520 4:188332946-188332968 CAAGCTCCTTCTCCTGTTCCAGG - Intergenic
985651171 5:1108455-1108477 CCAGCTGCTGCAGGGGCTCCCGG + Intronic
987456283 5:18151044-18151066 CCAGCTCCATAAGTTGCTCCAGG + Intergenic
987709609 5:21491424-21491446 CCAGCACCTTCAGCTGGCCCTGG - Intergenic
988750004 5:34182742-34182764 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
990212080 5:53491642-53491664 CCAGATCTTTCTGGTGTTCTTGG - Intergenic
991738264 5:69645944-69645966 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
991759929 5:69910478-69910500 CCAGCACCTTCAGCTGGCCCTGG - Intergenic
991787402 5:70207620-70207642 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
991789840 5:70225670-70225692 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
991814588 5:70500778-70500800 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
991817724 5:70522063-70522085 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
991839159 5:70785541-70785563 CCAGCACCTTCAGCTGGCCCTGG - Intergenic
991879848 5:71208005-71208027 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
991882288 5:71226029-71226051 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
992396787 5:76375853-76375875 CTGGCCCCTTCAGGTGTTCAAGG + Intergenic
994421733 5:99532732-99532754 CCAGCACCTTCAGCTGGCCCTGG - Intergenic
994461110 5:100067829-100067851 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
994485259 5:100381273-100381295 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
997229822 5:132234221-132234243 CCAGCTGCTGCAGTGGTTCCAGG - Intronic
1001989085 5:176101051-176101073 CATGCTCCTCCAGGTCTTCCAGG - Exonic
1001989704 5:176106063-176106085 CATGCTCCTCCAGGTCTTCCAGG - Exonic
1001990014 5:176108609-176108631 CATGCTCCTCCAGGTCTTCCAGG - Exonic
1002226856 5:177729529-177729551 CATGCTCCTCCAGGTCTTCCAGG + Exonic
1002227166 5:177732074-177732096 CATGCTCCTCCAGGTCTTCCAGG + Exonic
1002227785 5:177737086-177737108 CATGCTCCTCCAGGTCTTCCAGG + Exonic
1003251501 6:4432628-4432650 TCACCTCCTTCAGTTCTTCCTGG + Intergenic
1003672525 6:8172732-8172754 CTAGCTGCTTCAGGTCTTCAGGG + Intergenic
1003831756 6:10019453-10019475 CCATCTGCTTCAAGTCTTCCTGG + Intronic
1003968493 6:11276644-11276666 CCAGCTCTTTCTGGAGGTCCTGG + Intronic
1005548068 6:26889072-26889094 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
1005602271 6:27439488-27439510 TCATCTGCTTCAGGTGATCCTGG - Intergenic
1006610893 6:35293762-35293784 CCAGGGCCTGCAGGTCTTCCGGG - Exonic
1006823123 6:36914360-36914382 GCATCACCTTCAGGTGTTTCTGG - Exonic
1007131278 6:39476508-39476530 CCAGCTCCTTCTGATGGTGCAGG - Intronic
1007653178 6:43435738-43435760 CCACCTCACTCAGGTGTTCACGG + Exonic
1007786949 6:44286080-44286102 CCAGCTCCTCCAGGTGGCTCAGG + Exonic
1008514680 6:52307638-52307660 AGAGATCCTTCAGGTGTCCCGGG - Intergenic
1009018828 6:57930166-57930188 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
1009468257 6:64000529-64000551 CCAACTTCTCCAGGTCTTCCAGG - Intronic
1009931354 6:70180327-70180349 CCAGGGCCTCCAGGAGTTCCAGG + Exonic
1011527607 6:88282145-88282167 CCAGTTTCTGCAGGTTTTCCAGG - Intergenic
1011706152 6:90003344-90003366 CCAGCTCCCTCACCTGCTCCAGG + Intronic
1011718834 6:90134503-90134525 CCAGCTCTACCAGGTGCTCCAGG - Intronic
1013433442 6:110077275-110077297 TCACCTGCTTCAGGTGATCCTGG + Intergenic
1014385615 6:120798259-120798281 CCAGCTCCTTTTTGTGTTTCTGG + Intergenic
1015359710 6:132325184-132325206 CCAGCTTCTTCAGATATTCAGGG + Intronic
1015810806 6:137160399-137160421 CAATCTCCTTCAGGTGTCCAAGG - Intronic
1017744438 6:157434357-157434379 CCAGCTCCTAAGGGTGTTCTCGG - Intronic
1018221554 6:161585732-161585754 CCACCTACTTCATGTGTTTCAGG - Intronic
1018417958 6:163617679-163617701 CTAGCGGCTCCAGGTGTTCCTGG - Intergenic
1018442091 6:163822747-163822769 CCAGGTCCTTCAGATGCTCCAGG + Intergenic
1019716488 7:2541726-2541748 GCAGCTCCTCCAGGTGAGCCAGG + Exonic
1022026849 7:26456064-26456086 GTTGCCCCTTCAGGTGTTCCTGG + Intergenic
1022686079 7:32597838-32597860 CCATCTGCTTCAGGTGATCCTGG + Intergenic
1023265670 7:38403425-38403447 CCAGCTCCTCCAGGTGCACTCGG + Intronic
1023618121 7:42041608-42041630 CCTGCTACTTCAGTTGTTCTGGG - Intronic
1029338210 7:99919913-99919935 ACAGATCCTTCAAGTCTTCCTGG - Intergenic
1029437018 7:100569159-100569181 TCAGAGCCTTCAGGTGGTCCCGG + Intergenic
1032252525 7:130270475-130270497 CCAGATGCTGCAGGTGTGCCAGG - Intronic
1034207987 7:149334678-149334700 CTAGGTCCTTCTGGTGTTTCAGG - Intergenic
1034291577 7:149936687-149936709 CCAGGACCTCCAGGTGTTTCTGG - Intergenic
1034369705 7:150584256-150584278 CCTGCGCTTCCAGGTGTTCCTGG - Intergenic
1034387583 7:150753293-150753315 GCAGCTTTTTCAGGTGTTTCAGG + Intergenic
1035122387 7:156579313-156579335 CCGCCTCCTCCAGGTCTTCCTGG - Intergenic
1036037047 8:5031061-5031083 CCCTCTCCTTCAGGTCTTCCTGG + Intergenic
1036104951 8:5829041-5829063 TCAGGTCCTACAGGTTTTCCCGG + Intergenic
1037336901 8:17801063-17801085 GCAGCTCCTTCAAGCGCTCCGGG + Intergenic
1037843318 8:22261143-22261165 TCATCTGCTTCAGGTGATCCTGG + Intergenic
1038524707 8:28262986-28263008 CCCTTTCCTTCAGGTCTTCCTGG - Intergenic
1038634141 8:29271880-29271902 TAAGGACCTTCAGGTGTTCCTGG + Intergenic
1039955327 8:42202858-42202880 CTAACTCCTTCGTGTGTTCCCGG - Intronic
1044013502 8:87023651-87023673 CCAGCTCTTCCTTGTGTTCCTGG + Intronic
1044856377 8:96480255-96480277 CCAGCTGCATCTGGTATTCCAGG + Intergenic
1045100695 8:98840926-98840948 CAAGCTCATTCAGGTGTTTTTGG + Intronic
1045186915 8:99847605-99847627 CCAGCCCCTCCAGCTCTTCCTGG - Intronic
1045245409 8:100437903-100437925 CCAGGTCCTTAAGGTCTTACTGG - Intergenic
1046673742 8:117086174-117086196 CAAGCTCTTTCATGTCTTCCAGG + Intronic
1047919554 8:129620053-129620075 CAAGCACCTTCTAGTGTTCCAGG - Intergenic
1053560586 9:39189877-39189899 CAAGCTCCTTCAGGCCTTGCTGG + Intronic
1053577084 9:39364093-39364115 CCAGCTCCTCCTGCTGATCCTGG - Intergenic
1053824688 9:42010121-42010143 CAAGCTCCTTCAGGCCTTGCTGG + Intronic
1053841590 9:42192018-42192040 CCAGCTCCTCCTGCTGATCCTGG - Intergenic
1054098655 9:60922783-60922805 CCAGCTCCTCCTGCTGATCCTGG - Intergenic
1054120055 9:61198412-61198434 CCAGCTCCTCCTGCTGATCCTGG - Intergenic
1054136533 9:61429078-61429100 CAAGCTCCTTCAGGCCTTGCTGG - Intergenic
1054587701 9:66984150-66984172 CCAGCTCCTCCTGCTGATCCTGG + Intergenic
1054605883 9:67177242-67177264 CAAGCTCCTTCAGGCCTTGCTGG - Intergenic
1056571870 9:87824218-87824240 GCAGGTCATTCAGGTGTTCATGG - Intergenic
1059901246 9:118928613-118928635 ACAACTCCTTCAGCTATTCCTGG + Intergenic
1059971357 9:119672065-119672087 CCAGCTTCTTCATGTGCTTCTGG + Intergenic
1060174161 9:121485300-121485322 CCAGCTCCTCACGGTTTTCCTGG - Intergenic
1060216883 9:121743783-121743805 CCAGCTCATTCAGGTCTCCCTGG - Intronic
1060723130 9:125991192-125991214 CCAGCGCCTGGAGGAGTTCCTGG + Intergenic
1061116367 9:128615628-128615650 TCAGGTCCTTCAGGCGATCCTGG - Exonic
1061133302 9:128720199-128720221 CCAGCTCCTCCAGAAGTGCCCGG + Exonic
1062491266 9:136806226-136806248 CTAGCTCCATCAGGTGCCCCGGG + Exonic
1186426205 X:9465570-9465592 CCTGCACCTACAGGAGTTCCAGG - Intronic
1189302935 X:39965884-39965906 CCAGCACCTTCAAATGTCCCCGG - Intergenic
1195679243 X:107531414-107531436 CCATCTCCTTCAAGTCCTCCTGG + Intronic
1195975937 X:110526826-110526848 CCATCTCCTCCAGGTTTTCTAGG - Intergenic
1196628273 X:117904181-117904203 GCATCTCCTTTAGCTGTTCCAGG + Intronic
1197789623 X:130241059-130241081 CCAGCTCCTTCATCTGTAACAGG - Intronic
1198266403 X:135013138-135013160 CCAGCTACTGCAGCTGTTACAGG - Intergenic