ID: 1107978756

View in Genome Browser
Species Human (GRCh38)
Location 13:45714381-45714403
Sequence AAACTCGGCGTCCCGGTGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107978756_1107978761 -6 Left 1107978756 13:45714381-45714403 CCTTGCACCGGGACGCCGAGTTT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1107978761 13:45714398-45714420 GAGTTTGGGACACCGAACACTGG 0: 1
1: 0
2: 0
3: 2
4: 89
1107978756_1107978762 -5 Left 1107978756 13:45714381-45714403 CCTTGCACCGGGACGCCGAGTTT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1107978762 13:45714399-45714421 AGTTTGGGACACCGAACACTGGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107978756 Original CRISPR AAACTCGGCGTCCCGGTGCA AGG (reversed) Exonic
900221964 1:1513795-1513817 AATCTCGGCGACCCGCTGCCAGG - Intronic
1067387891 10:45834383-45834405 AAAGTCGGCTTCGCGGGGCACGG + Intronic
1068771243 10:60824289-60824311 AAACTCTACCTCCCGGTTCAAGG + Intergenic
1070601568 10:77869855-77869877 AAACTGGGCTTCCCGGTGCTGGG - Intronic
1074954989 10:118380065-118380087 AACCTCTGCCTCCCGGTTCAAGG + Intergenic
1075109819 10:119569830-119569852 AAGCTCCGCCTCCCGGTTCAAGG + Intergenic
1090834921 11:130447390-130447412 CACCTCGGCCTCCCGGTGCGGGG - Intergenic
1096533949 12:52258841-52258863 AAGCTCGGAGTCCCGGCGGAGGG - Intronic
1103541497 12:121669438-121669460 AAAGTCGGAGTCCCTGTGGAAGG - Exonic
1105890759 13:24680853-24680875 AAACGCCCCGTCCCGGGGCAAGG + Intronic
1107978756 13:45714381-45714403 AAACTCGGCGTCCCGGTGCAAGG - Exonic
1109901690 13:68780994-68781016 AACCTCCGCCTCCCGGTTCAAGG - Intergenic
1118293768 14:64549996-64550018 AAACTCGGGCACCCGGTACATGG - Exonic
1123063592 14:105605432-105605454 AAACTTGGGGTCCCGTTGCCTGG + Intergenic
1138508576 16:57493618-57493640 AAACTCTGCCTCCGGGTTCAAGG + Intergenic
1139585306 16:67899087-67899109 AAGCTAGGGGTCCCGGGGCAGGG - Intronic
1150789215 17:68186978-68187000 AACCTCCGCCTCCCGGTTCAAGG - Intergenic
1158859898 18:61581977-61581999 AAACCCAGCCTCCCGGTGCCCGG + Intergenic
1162982952 19:14250469-14250491 AACCTCCGCCTCCCGGTTCAAGG - Intergenic
934757206 2:96832566-96832588 AGGCCCGGCGTCCCGGTGGAAGG + Exonic
939229812 2:139410673-139410695 GGACTGGGCGCCCCGGTGCAGGG - Intergenic
940486615 2:154303838-154303860 AAACTCTGCCTCCCGGTTCAAGG + Intronic
947760694 2:232601788-232601810 AACCTCTGCCTCCCGGTTCAAGG + Intergenic
1172733515 20:37108797-37108819 AAACTGGGCTTCCAGGTGCCTGG + Intronic
1177735707 21:25086096-25086118 AAGCTCCGCCTCCCGGTTCAAGG - Intergenic
1182087000 22:27568194-27568216 AACCTCTGCCTCCCGGTTCAAGG - Intergenic
951871418 3:27366891-27366913 AACCTCCGCCTCCCGGTTCAAGG + Intronic
952940731 3:38442496-38442518 AAACTGGGAGTCACAGTGCAGGG + Intergenic
953622712 3:44546978-44547000 AAACTGGGCGTCAGAGTGCAGGG + Intergenic
995514001 5:112936536-112936558 AAACTATGGGTCCTGGTGCAGGG + Intergenic
1000719186 5:164684396-164684418 AAACTCCACCTCCTGGTGCAAGG - Intergenic
1011083694 6:83515895-83515917 AACCTCTGCCTCCCGGTTCAGGG + Intronic
1012466547 6:99522235-99522257 AAGCTCAGCCTCCCGGTGCTAGG - Intergenic
1015837455 6:137435926-137435948 AAACTCTGCCTCCGGGTTCAAGG - Intergenic
1020414221 7:7927712-7927734 AAGCAAGGCGTCCAGGTGCAAGG + Intronic
1028518034 7:91699143-91699165 AATCTGGGCGTCCAGATGCATGG + Intronic
1035759325 8:2057734-2057756 AAACTCTGCTTCACCGTGCAAGG + Exonic
1043257253 8:78151523-78151545 AAACTGGGCGTCAGAGTGCAGGG - Intergenic
1044375629 8:91466996-91467018 AAACTCTGCCTCCTGGTTCAAGG + Intergenic
1044449654 8:92319607-92319629 AAACTCGAGGTCCTGGTGCGTGG + Intergenic
1049584525 8:143426768-143426790 GAACTGGGCTTCCTGGTGCACGG - Intronic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic
1189385975 X:40537248-40537270 ACACTCGGGGTCCAGGTGCAGGG - Intergenic
1189450503 X:41124360-41124382 AACCTCTGCCTCCCGGTTCAAGG - Intronic
1190298969 X:49044919-49044941 AACCTCTGCTTCCCGGTTCAAGG - Intergenic
1200988378 Y:9326538-9326560 AGACTCGGTGTCACTGTGCACGG + Intergenic
1201487759 Y:14510273-14510295 AAACTGGGAGTCACAGTGCAGGG - Intergenic
1202115413 Y:21466407-21466429 AGACTCGGGTTCGCGGTGCATGG - Intergenic
1202119632 Y:21509654-21509676 AGACTCGGTGTCACTGTGCACGG - Intergenic
1202122085 Y:21533195-21533217 AGACTCGGTGTCACTGTGCACGG - Intronic
1202156922 Y:21896188-21896210 AGACTCGGTGTCACTGTGCACGG + Intronic
1202159368 Y:21919729-21919751 AGACTCGGTGTCACTGTGCACGG + Intergenic
1202185816 Y:22184644-22184666 AGACTCGGTGTCACTGTGCACGG + Intergenic
1202205544 Y:22401752-22401774 AGACTCGGTGTCACTGTGCACGG - Intronic