ID: 1107980093

View in Genome Browser
Species Human (GRCh38)
Location 13:45727078-45727100
Sequence CTGCTTCCACACATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107980090_1107980093 3 Left 1107980090 13:45727052-45727074 CCTGCTTCACAGATGGCACCTTC No data
Right 1107980093 13:45727078-45727100 CTGCTTCCACACATGGAGAAAGG No data
1107980089_1107980093 4 Left 1107980089 13:45727051-45727073 CCCTGCTTCACAGATGGCACCTT No data
Right 1107980093 13:45727078-45727100 CTGCTTCCACACATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107980093 Original CRISPR CTGCTTCCACACATGGAGAA AGG Intergenic
No off target data available for this crispr