ID: 1107981882

View in Genome Browser
Species Human (GRCh38)
Location 13:45741840-45741862
Sequence ATGTTTCTCTTCAATAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107981882_1107981883 -10 Left 1107981882 13:45741840-45741862 CCTTCATTATTGAAGAGAAACAT No data
Right 1107981883 13:45741853-45741875 AGAGAAACATGCCTCAGTGCTGG No data
1107981882_1107981884 -9 Left 1107981882 13:45741840-45741862 CCTTCATTATTGAAGAGAAACAT No data
Right 1107981884 13:45741854-45741876 GAGAAACATGCCTCAGTGCTGGG No data
1107981882_1107981888 23 Left 1107981882 13:45741840-45741862 CCTTCATTATTGAAGAGAAACAT No data
Right 1107981888 13:45741886-45741908 CCATTGCGTTTTTCAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107981882 Original CRISPR ATGTTTCTCTTCAATAATGA AGG (reversed) Intergenic
No off target data available for this crispr