ID: 1107981928

View in Genome Browser
Species Human (GRCh38)
Location 13:45742297-45742319
Sequence TAGGAGCCTGAATTTTGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107981927_1107981928 -8 Left 1107981927 13:45742282-45742304 CCTGGAGATGTGGCTTAGGAGCC No data
Right 1107981928 13:45742297-45742319 TAGGAGCCTGAATTTTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107981928 Original CRISPR TAGGAGCCTGAATTTTGACA AGG Intergenic
No off target data available for this crispr