ID: 1107982010

View in Genome Browser
Species Human (GRCh38)
Location 13:45742957-45742979
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107982006_1107982010 8 Left 1107982006 13:45742926-45742948 CCTTACATTTTTATAAGTCTCTG No data
Right 1107982010 13:45742957-45742979 CTCTAACTACAGATGACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107982010 Original CRISPR CTCTAACTACAGATGACTCT TGG Intergenic
No off target data available for this crispr