ID: 1107986853

View in Genome Browser
Species Human (GRCh38)
Location 13:45783538-45783560
Sequence GGGGCGTGGCCTCCCACTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107986843_1107986853 18 Left 1107986843 13:45783497-45783519 CCCGTCCGTAATCACCGAGTCCA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 1107986853 13:45783538-45783560 GGGGCGTGGCCTCCCACTTGAGG 0: 1
1: 0
2: 3
3: 6
4: 116
1107986842_1107986853 19 Left 1107986842 13:45783496-45783518 CCCCGTCCGTAATCACCGAGTCC 0: 1
1: 0
2: 0
3: 1
4: 22
Right 1107986853 13:45783538-45783560 GGGGCGTGGCCTCCCACTTGAGG 0: 1
1: 0
2: 3
3: 6
4: 116
1107986846_1107986853 4 Left 1107986846 13:45783511-45783533 CCGAGTCCACGCACTCAAGAACA 0: 1
1: 0
2: 2
3: 3
4: 96
Right 1107986853 13:45783538-45783560 GGGGCGTGGCCTCCCACTTGAGG 0: 1
1: 0
2: 3
3: 6
4: 116
1107986844_1107986853 17 Left 1107986844 13:45783498-45783520 CCGTCCGTAATCACCGAGTCCAC 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1107986853 13:45783538-45783560 GGGGCGTGGCCTCCCACTTGAGG 0: 1
1: 0
2: 3
3: 6
4: 116
1107986845_1107986853 13 Left 1107986845 13:45783502-45783524 CCGTAATCACCGAGTCCACGCAC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1107986853 13:45783538-45783560 GGGGCGTGGCCTCCCACTTGAGG 0: 1
1: 0
2: 3
3: 6
4: 116
1107986847_1107986853 -2 Left 1107986847 13:45783517-45783539 CCACGCACTCAAGAACAGACCGG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1107986853 13:45783538-45783560 GGGGCGTGGCCTCCCACTTGAGG 0: 1
1: 0
2: 3
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107986853 Original CRISPR GGGGCGTGGCCTCCCACTTG AGG Exonic
900177097 1:1295719-1295741 GGGGCATGGCCTCCCACCTGAGG + Exonic
900330337 1:2131078-2131100 GGGGCGTGGCCTCGCCTCTGTGG + Intronic
902046708 1:13530089-13530111 GGGGCTTGTTCTCCCACCTGGGG + Intergenic
904496614 1:30890897-30890919 TGAGCTGGGCCTCCCACTTGTGG - Intronic
904568829 1:31445421-31445443 GGGGCGGGTCCTCCCACTTTGGG - Intergenic
913963264 1:143354922-143354944 GGAGCGTGACCTCCCTCATGGGG - Intergenic
914057620 1:144180508-144180530 GGAGCGTGACCTCCCTCATGGGG - Intergenic
914121526 1:144785858-144785880 GGAGCGTGACCTCCCTCATGGGG + Intergenic
914490137 1:148146534-148146556 GGGCCGGGGCCGCCCCCTTGGGG + Intronic
915137409 1:153742819-153742841 GGGCCTGGGCCTCCCACATGGGG - Intronic
920194770 1:204219617-204219639 GAAGCCTGGCCTCCCACCTGGGG - Exonic
920669328 1:207991186-207991208 GGGGGGTGGGCTGCCACATGGGG + Intergenic
921390398 1:214608679-214608701 GGGCCGGGGCCGCCCCCTTGGGG - Intronic
922499050 1:226083541-226083563 GGGGCGTGGCCTGGGCCTTGGGG - Intergenic
1063575569 10:7259276-7259298 GTGGGGAGGCTTCCCACTTGTGG - Intronic
1063947964 10:11195806-11195828 TCCACGTGGCCTCCCACTTGAGG + Intronic
1067017603 10:42769749-42769771 GGGGCATGGCCTTCCACTGGGGG + Intergenic
1069770036 10:70892667-70892689 GGGCCTTGGCCTCCCAAGTGTGG + Intergenic
1072268722 10:93754970-93754992 AAGGTGTGGCCACCCACTTGTGG - Intergenic
1076184824 10:128438113-128438135 GGGGCGTGGCCACCCAGCGGTGG - Intergenic
1076855922 10:133115619-133115641 GGGTCCTGGCCTCCCTCCTGGGG - Intronic
1076886998 10:133267550-133267572 GGGGCGGGGCCTCTCATCTGGGG - Intronic
1076992499 11:282792-282814 GGGGTGTGGCCACTCACGTGAGG - Exonic
1081166110 11:39810632-39810654 GGGGCCTGGGGACCCACTTGAGG - Intergenic
1083492586 11:63023851-63023873 GCGGCGTGACCTCCAACCTGTGG - Intergenic
1083638794 11:64134352-64134374 TGGGCCTGGCCTCTCACTGGGGG - Intronic
1087626748 11:100604232-100604254 TGGGCGGGTCCTCCCACCTGAGG + Intergenic
1087785173 11:102346773-102346795 GGGGGGAGGCATCACACTTGGGG + Intergenic
1090264296 11:125344341-125344363 GGAGCGTGGCCTCCCCCTAATGG - Intronic
1092013670 12:5138758-5138780 GGGGCGGGGGGTCCTACTTGGGG + Intergenic
1092169329 12:6363494-6363516 GTAGCGTGGCCTCCAGCTTGCGG - Exonic
1092672758 12:10882431-10882453 GGGGGATGGCCTCCCTGTTGGGG + Exonic
1092676936 12:10930844-10930866 GGGGGATGGCCTCCCTGTTGGGG - Exonic
1096184251 12:49567938-49567960 GGGGCGGGGCCCCAAACTTGGGG + Intronic
1101479677 12:105084666-105084688 GGGGCGGGGCCTTCCAGCTGGGG - Intergenic
1103474664 12:121209930-121209952 GGGGAGTGGCCTCGCCCTTGAGG - Intronic
1103909986 12:124346770-124346792 GAGGCGTGCCCTCCCGCTTTAGG + Exonic
1104424030 12:128659925-128659947 GGGGCTGGACCTCTCACTTGGGG + Intronic
1105751110 13:23421866-23421888 GGGGCCTGGACATCCACTTGAGG + Intronic
1107986853 13:45783538-45783560 GGGGCGTGGCCTCCCACTTGAGG + Exonic
1112379095 13:98871853-98871875 GGGGCATGGCATCCCGCATGTGG - Intronic
1118006382 14:61567856-61567878 GGGTCATGTTCTCCCACTTGGGG - Intronic
1118780287 14:69003426-69003448 GAGCCTTGGCCTCCGACTTGTGG - Intergenic
1127931536 15:63600431-63600453 GGGTCGGGGCTTCCCACTAGGGG + Intronic
1127983683 15:64052015-64052037 TGGGCTGGTCCTCCCACTTGGGG + Intronic
1129450736 15:75649762-75649784 GGGGATTGGCCTTCCACTGGGGG - Exonic
1130530969 15:84748103-84748125 GGGCCGAGGCCGCCCACTAGAGG - Intergenic
1131056770 15:89379462-89379484 GGGCCGTGGCCGCCCTCCTGGGG + Intergenic
1132756197 16:1486653-1486675 GGTGCCTGGCCTCCCACTCCCGG + Intronic
1139476893 16:67207322-67207344 GGGGCCTGGCCTCCCACCCAGGG + Exonic
1140503755 16:75456820-75456842 GTGGCCTGGCCTCCCAGCTGAGG + Intronic
1141989663 16:87602715-87602737 GGGCCGCGGCCCCCCACCTGCGG - Intronic
1142375043 16:89702173-89702195 GGGGCGGGGCCATCCCCTTGAGG + Intergenic
1143181713 17:4987691-4987713 GGGGCGGGGCCTCCCAATTAAGG + Intergenic
1144576808 17:16434803-16434825 GGGGCGTGGCCCCCCAAATTGGG - Intronic
1146625282 17:34430691-34430713 GAGGCGAGGCCTTCCTCTTGGGG + Intergenic
1146929512 17:36767706-36767728 GGGGGGTGGCCTCAGCCTTGGGG + Intergenic
1150833044 17:68540942-68540964 GGGGATTGACCTCCCACCTGAGG + Exonic
1152608371 17:81304012-81304034 GGGGCGTGGAGTCCCCCTGGGGG - Intergenic
1152789677 17:82272650-82272672 GGGGCTTGCCCTCCCGCTGGGGG - Intronic
1152838657 17:82552000-82552022 GGGCCCTGGGCTCCCCCTTGTGG + Intronic
1153805176 18:8704927-8704949 GGGGCGGCGCCGGCCACTTGGGG - Intergenic
1155154123 18:23144060-23144082 GGGGCAAGGCCTCCCACAAGAGG + Intronic
1155161064 18:23196395-23196417 GGGGCTGGCCCTCCCACTTGAGG + Intronic
1160628784 18:80231087-80231109 GGGGCATCCCCTCCCACCTGGGG - Intronic
1160831458 19:1106575-1106597 CGGGCGGGGCCACACACTTGTGG - Exonic
1160995767 19:1881405-1881427 GGGCCGGGGCCGCCCCCTTGGGG - Exonic
1161888820 19:7019096-7019118 GGGGTGTGGCCCCGCAGTTGGGG - Intergenic
1164672063 19:30077868-30077890 GGGGCAAGGCCTCCCATCTGGGG + Intergenic
1166862621 19:45818816-45818838 GGGGCATGGCCACCCACTCGGGG - Intronic
1166881836 19:45934736-45934758 GGGGCGTGGCCTCCCTCAAATGG - Exonic
1167494871 19:49811768-49811790 GGGGCTGGGACTCCCACTTCTGG + Intronic
1167587556 19:50383562-50383584 GGGGCTGGGCCTCCAAGTTGAGG + Intergenic
1202697103 1_KI270712v1_random:133181-133203 GGAGCGTGACCTCCCTCATGGGG - Intergenic
925399062 2:3558626-3558648 GGGGCGTGGCCCCCGAACTGCGG - Intergenic
926418132 2:12670906-12670928 GGTGCGTGGCCTGCCTGTTGAGG - Intergenic
931666500 2:64612998-64613020 AGGGCGTGGGGTCCCACCTGGGG - Intergenic
932756863 2:74415298-74415320 GGGGTGTCCCCTCCCAGTTGAGG + Exonic
935706749 2:105863973-105863995 GGGGGGTGGGGTCTCACTTGAGG + Intronic
936936731 2:117846333-117846355 GGGGTGTGGCCTCCTTGTTGAGG + Intergenic
943366705 2:186973461-186973483 GGGCAGTGCCCTCCCTCTTGGGG + Intergenic
1169622204 20:7520048-7520070 GGGACTTGGCCACCTACTTGGGG + Intergenic
1171177204 20:23061442-23061464 AGGGAGTGGCTTCCCACTGGGGG + Intergenic
1173519122 20:43686246-43686268 GGGGCCTGGCCTGGCTCTTGTGG + Intronic
1180940712 22:19658207-19658229 GGGGCGTGGGCATCCACCTGGGG + Intergenic
1181121540 22:20670813-20670835 GGGCCGGGGCCGCCCCCTTGGGG - Intergenic
1181606828 22:23985193-23985215 CGGGCGTGGCCTCTCTCTTATGG - Intergenic
1182278113 22:29203007-29203029 CGGGCGGGGCCTCCCCCCTGGGG - Intergenic
1182546754 22:31081167-31081189 GGGGCGGGGCCTTCCTCTCGGGG + Intronic
1185268517 22:49917931-49917953 GGGGCCGGACCTCCCACCTGGGG - Intronic
1185335058 22:50267697-50267719 GGGGCGCGGCCTGGCACTGGGGG - Intronic
952948172 3:38495299-38495321 AGGGGGTAGCCTCCCATTTGAGG + Intergenic
954575161 3:51671734-51671756 GGGCCGCCGCCTCCCACTTTCGG - Exonic
955325064 3:58003632-58003654 GGGGCGGTGGCTCACACTTGTGG + Intergenic
958979926 3:100709279-100709301 GGGGCGTGACCACGCACTTCCGG - Intergenic
959074424 3:101735326-101735348 GAAGAGTGGGCTCCCACTTGGGG + Intronic
961318596 3:126057161-126057183 AGGGCGTGGCTTCCTGCTTGGGG - Intronic
961858157 3:129893360-129893382 CGGGCCTGGCCTCCCGCTCGCGG - Intronic
962535703 3:136327263-136327285 GGGTCATGGCCTCCAACATGAGG - Intronic
968580107 4:1385801-1385823 GGGGCCTGGGCTCCCAGTGGCGG - Intronic
969032489 4:4226144-4226166 GGAGCGTGGCCTCCATCATGGGG + Intronic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
997531113 5:134581762-134581784 GGGGGGTGGCCTTTCATTTGGGG + Exonic
1001514711 5:172347240-172347262 GGGGAGTGGCCACTGACTTGAGG - Intronic
1002967243 6:1978535-1978557 GGGGCGGGTCCTCCCAGCTGGGG + Intronic
1006152155 6:31995378-31995400 GAGGCGTGGCCTCCCTCTTGAGG + Exonic
1006158457 6:32028116-32028138 GAGGCGTGGCCTCCCTCTTGAGG + Exonic
1007633048 6:43283410-43283432 GGGGCTTGGGCTCAGACTTGAGG - Exonic
1010812282 6:80314535-80314557 AGGGTGGGTCCTCCCACTTGGGG - Intronic
1011370718 6:86634011-86634033 TGGGTGTGGCCTCCCATCTGAGG - Intergenic
1015923995 6:138291850-138291872 GGGGCGAGCCCTCACACTCGGGG - Exonic
1019281122 7:200777-200799 GGGGCCTTGCCTGTCACTTGAGG + Intronic
1019644949 7:2124131-2124153 GTGGCGTGGCCTCTGACCTGTGG - Intronic
1022529741 7:31059566-31059588 GGGGCTTGGCCTGTCCCTTGAGG + Intronic
1030255656 7:107506731-107506753 GGGGCGTGGCCTGAAACCTGTGG - Intronic
1035634880 8:1137133-1137155 GCAGCGTGGCCTCCTCCTTGTGG + Intergenic
1035642421 8:1194185-1194207 AAGGCGTGGCCTCCCACAGGCGG - Intergenic
1040516725 8:48141864-48141886 GCGGCTTGGCCTCCCACTGAGGG - Intergenic
1049016064 8:139921022-139921044 GCAGGGTGGCCTCCCAGTTGTGG - Intronic
1049607587 8:143536835-143536857 GGGGCTTGGCAGGCCACTTGGGG - Intronic
1049608301 8:143540109-143540131 GGTGGGCTGCCTCCCACTTGGGG - Intronic
1049774249 8:144397281-144397303 GGCGCGTGGCCTCCTCCCTGCGG + Exonic
1062393409 9:136342910-136342932 GGGGCGTGGCCTTGCTGTTGTGG + Intronic
1062685794 9:137812512-137812534 GGGCTGTGCCCTCCCACATGTGG + Intronic
1200055312 X:153457010-153457032 GGGGTGTGACACCCCACTTGGGG - Intronic
1201967619 Y:19755051-19755073 GGGGAGGGGCCTCCCAACTGGGG - Intergenic