ID: 1107987492

View in Genome Browser
Species Human (GRCh38)
Location 13:45787795-45787817
Sequence TGTGCTTTAGGGAGCTACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107987485_1107987492 23 Left 1107987485 13:45787749-45787771 CCAGTGCACGGTGGATATTAGCA 0: 1
1: 0
2: 0
3: 7
4: 25
Right 1107987492 13:45787795-45787817 TGTGCTTTAGGGAGCTACTGTGG 0: 1
1: 0
2: 0
3: 25
4: 160
1107987484_1107987492 24 Left 1107987484 13:45787748-45787770 CCCAGTGCACGGTGGATATTAGC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1107987492 13:45787795-45787817 TGTGCTTTAGGGAGCTACTGTGG 0: 1
1: 0
2: 0
3: 25
4: 160
1107987487_1107987492 -7 Left 1107987487 13:45787779-45787801 CCAAGAGACCCAGCTATGTGCTT 0: 1
1: 0
2: 1
3: 18
4: 175
Right 1107987492 13:45787795-45787817 TGTGCTTTAGGGAGCTACTGTGG 0: 1
1: 0
2: 0
3: 25
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107987492 Original CRISPR TGTGCTTTAGGGAGCTACTG TGG Intronic
900149134 1:1170670-1170692 TGTGCTGAAGGGAGCTACCGAGG + Intergenic
900441446 1:2657563-2657585 TGTGCTTGTGGGTGCTACTGCGG - Intronic
900444232 1:2671973-2671995 TGTGCTTGTGGGTGCTACTGCGG - Intronic
900445137 1:2676629-2676651 TGTGCTTGTGGGTGCTACTGCGG - Intronic
900445846 1:2680363-2680385 TGTGCTTGTGGGTGCTACTGCGG - Intronic
900579579 1:3402493-3402515 TGTGCCTCAGGCAGCCACTGTGG - Intronic
901503985 1:9672551-9672573 TGTGCACTTGGGAGCTACTCAGG - Intronic
904969829 1:34410813-34410835 TGTGCTTGATGGAGTTACTGGGG - Intergenic
905389776 1:37629003-37629025 TGGGATTCAGGGAGCTACAGTGG - Intronic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
906069739 1:43007914-43007936 TGGGCCTTAGGGTGCGACTGAGG - Intergenic
906580797 1:46934025-46934047 TGTGCATTAAGGAGGCACTGAGG - Exonic
906602927 1:47144869-47144891 TGTGCATTAAGGAGGCACTGAGG + Exonic
906838049 1:49105269-49105291 TGTGCTTGAGAGAGCTTCTTGGG - Intronic
907701989 1:56797605-56797627 TGTGCTTTGGGGAGCAGCTGTGG + Intronic
908119515 1:60972637-60972659 TATGCTTAGGGAAGCTACTGGGG - Intronic
908386849 1:63651148-63651170 CCTGCTTTAGGAAGCTCCTGTGG + Intronic
909512322 1:76468317-76468339 TGTGATTTAAGTAGCTACTTGGG + Intronic
911145690 1:94550379-94550401 TGTGTGTTAGGGAGCTGTTGGGG + Intergenic
912717230 1:111990875-111990897 TGGGCTTCAGGGAGGGACTGAGG - Intergenic
915527718 1:156486318-156486340 TGTGCTTTCTAGAGCTACAGTGG + Intronic
916720319 1:167480232-167480254 TTTGGTTTAGAGAGCTGCTGAGG + Intronic
919856806 1:201711693-201711715 TGTCTTTTAGGGAGGTACTGGGG + Intronic
923008440 1:230069928-230069950 TGGGCTTTAGGGATCGTCTGAGG + Intronic
1066055285 10:31674908-31674930 TGGGCTTTTGGGAGTTAATGGGG - Intergenic
1066528770 10:36313073-36313095 TGTGCCTTGGGCACCTACTGAGG - Intergenic
1068311605 10:55284172-55284194 TGTCCTTTAGATAGCTACTCAGG + Intronic
1068748960 10:60569336-60569358 TGTACCTGAGGCAGCTACTGGGG - Intronic
1069009847 10:63360224-63360246 TGTGACTTAGCGGGCTACTGGGG - Intronic
1069323324 10:67200712-67200734 TGGGCTTTAGGGAGTTAATGAGG - Intronic
1073166408 10:101456976-101456998 TGTGGTTTAGGCATCCACTGGGG - Intronic
1073816369 10:107212403-107212425 TGTGCTTAAGTGTGTTACTGTGG + Intergenic
1073866257 10:107807822-107807844 TGAGATTTAGGGAGCAACAGAGG + Intergenic
1075185083 10:120248648-120248670 TGTGCTTTCTGGAGTTACTTAGG + Intergenic
1080187139 11:29503470-29503492 TGTATTTTAGGCACCTACTGAGG + Intergenic
1080784719 11:35464057-35464079 TTTGATTTTGAGAGCTACTGTGG - Intronic
1081605650 11:44525757-44525779 TGTGATATAGGGAGCTAGTTCGG + Intergenic
1081773530 11:45663820-45663842 GGGTCTTTAGGGAGCTGCTGGGG - Intronic
1083351601 11:62033391-62033413 TCGGCAATAGGGAGCTACTGTGG - Intergenic
1084482789 11:69431550-69431572 TGTGCTTTAGGGAGGAAAAGAGG - Intergenic
1086671007 11:89547861-89547883 AGTGCTCTAGGGAAATACTGGGG - Intergenic
1087298027 11:96399968-96399990 AGTGCTTAATGGAGCTACGGGGG + Intronic
1090412873 11:126521044-126521066 GGTGCCTTAGGCAGCTAATGAGG - Intronic
1090912746 11:131135675-131135697 TGTGCTTTAGCCAGCTCATGTGG - Intergenic
1092202579 12:6595418-6595440 TCTTCTTTAGGGAGTTAATGAGG - Exonic
1092936341 12:13367492-13367514 TGGGCATTGGCGAGCTACTGGGG - Intergenic
1092956099 12:13551660-13551682 TGTGCATTAGGGAGGTACATAGG + Exonic
1095279643 12:40335104-40335126 TGTGCTGTAGGGTTCTAGTGAGG - Exonic
1097065242 12:56315883-56315905 TGTAGTTTCGGGAGCCACTGGGG - Exonic
1098699242 12:73603320-73603342 TGTGCTTTGTGTACCTACTGTGG - Intergenic
1099936517 12:89132512-89132534 TATGCTATAGGGAGGTAGTGTGG + Intergenic
1102209242 12:111112594-111112616 TGTGCTTTGGGGACCTAATGGGG + Intronic
1103015780 12:117493560-117493582 AGTGCTTCAGGGACCTATTGGGG - Intronic
1103385496 12:120529101-120529123 TGTGCTCTATGGAGCTATTGCGG - Exonic
1104313833 12:127679063-127679085 TGTGCCTTAGGGAGCCCGTGGGG + Intergenic
1104462477 12:128966736-128966758 TTTGCTTTAGGGAGCTTATGAGG + Intronic
1105002807 12:132702311-132702333 TGTGCATGAAGGAGCTGCTGTGG + Intronic
1106620141 13:31364813-31364835 TGTGGTTTAGGCAGCTGCAGTGG - Intergenic
1107987492 13:45787795-45787817 TGTGCTTTAGGGAGCTACTGTGG + Intronic
1108322918 13:49304429-49304451 TGAGATTTAGGGAGCAGCTGAGG - Intergenic
1108802932 13:54121512-54121534 TGCGCTTTAGGGTGATACTTTGG - Intergenic
1108871907 13:54998399-54998421 TGTGCTTTAGAGAGAAAGTGAGG - Intergenic
1109858674 13:68169417-68169439 TGTGCCTTAATGAGATACTGGGG + Intergenic
1110070547 13:71171615-71171637 TATGTTTTAGAGAACTACTGAGG + Intergenic
1113031338 13:105997160-105997182 TGTGCTTTAGCGAGGTCCTGGGG - Intergenic
1113050269 13:106203594-106203616 TGTGCTTTTGGGGGCCACTGAGG - Intergenic
1113585691 13:111462767-111462789 TGTGCTCCTGGGAGCTACTGAGG + Intergenic
1113963075 13:114136150-114136172 TGGGTTTTAGGGACCGACTGGGG - Intergenic
1114466765 14:22928788-22928810 TGTGTTTTAGGGAGAAATTGAGG - Intronic
1117966528 14:61212094-61212116 TCTGCTTTAGGGCACTGCTGTGG + Intronic
1119563510 14:75609370-75609392 TGTTATTTAGGGAGTTACTCAGG - Intronic
1122034219 14:98935794-98935816 TGGTCTTTAAGGAGCTACTGAGG + Intergenic
1123914622 15:25010626-25010648 TGAGTTTTGGTGAGCTACTGTGG + Intergenic
1126990087 15:54364468-54364490 TTAGATGTAGGGAGCTACTGGGG + Intronic
1127899451 15:63330178-63330200 TGTGGCTTGGGGAGGTACTGAGG + Intronic
1129817380 15:78566387-78566409 TGTGCTCTAAGGAGCTAGTGAGG - Intronic
1131024793 15:89131111-89131133 TGTGCTTTAGGAAGATAATTTGG - Intronic
1133387523 16:5381941-5381963 TGTGCTTGTGGGAGCTTTTGTGG + Intergenic
1135695552 16:24583091-24583113 TGTGCTCTAGTAAGTTACTGCGG + Intergenic
1136011582 16:27367108-27367130 TGGGCTTTGGGAAGCTACAGAGG + Intergenic
1136582061 16:31158716-31158738 TGTGCACTTGGGAGCTACTTGGG + Intergenic
1136990453 16:35148451-35148473 TGTGCCTGAGGGAGCTCCAGGGG - Intergenic
1139558950 16:67729686-67729708 TGTGCATGTGGGAACTACTGGGG + Exonic
1139638178 16:68271687-68271709 TGTGCTCTTGGGAGCTGCTAGGG + Intronic
1144166832 17:12620368-12620390 TTTGCTTTTGTGAGCTTCTGTGG - Intergenic
1144457373 17:15430219-15430241 TGTGCTTTGGGAAGCTGCAGGGG + Intergenic
1144839953 17:18179812-18179834 GGTGCTTTGGGGAGCTTGTGCGG + Intergenic
1145403871 17:22569428-22569450 AGTGCTTTAGGGGGATATTGGGG - Intergenic
1148024809 17:44579448-44579470 TGACCTTGAGGGACCTACTGAGG - Intergenic
1151556841 17:74850952-74850974 TGGGCTTTAGGAAGATGCTGTGG - Intronic
1153775692 18:8451365-8451387 TTTGGTTTCGGGAGCTACAGTGG + Intergenic
928348657 2:30524855-30524877 TGTGATTCAGGCATCTACTGGGG + Intronic
932289097 2:70560145-70560167 TCTGCTTTGTGGAGCTACTCAGG + Intergenic
933874810 2:86608967-86608989 TGTTCTTAAGGGAGCTACTCTGG + Intronic
935457163 2:103283222-103283244 TGTGCTTTAGAGAAATATTGGGG - Intergenic
935635274 2:105244987-105245009 TGTGCTGTTGGGCACTACTGAGG - Intergenic
939791988 2:146588981-146589003 TGTGCTTTAAGATGCTGCTGAGG - Intergenic
942195913 2:173519898-173519920 TGGGCTCTAGGCCGCTACTGTGG - Intergenic
942692465 2:178600742-178600764 TGTACCTTAGGAAGCTACTATGG - Intronic
945777252 2:214121374-214121396 TGTTCCTTAGAAAGCTACTGTGG + Intronic
947375768 2:229493550-229493572 TGTGCTGTAGGGAGAAGCTGAGG + Intronic
1169159273 20:3362631-3362653 GGTGCTATAGGCAGCTAATGAGG - Intronic
1169551772 20:6708446-6708468 TGTACTTTGGGGAGATTCTGGGG - Intergenic
1170274445 20:14568494-14568516 TGTGGTTTAGGGAGCAAGTGAGG + Intronic
1173375350 20:42477882-42477904 TGTACTTTAGAGAGCCACTTTGG + Intronic
1174034315 20:47658380-47658402 TGTTCTTTAGGGGACAACTGTGG - Exonic
1178370796 21:32025931-32025953 TGTGGTTTAGGGATCCACTGGGG + Intronic
1179037459 21:37771099-37771121 TGTGTTTTAAGGAGATAGTGTGG + Intronic
1179169871 21:38964424-38964446 TGTGATTTGGGGAGCTGCTGTGG + Intergenic
1180069773 21:45430506-45430528 TGTGCCCAAGGGAGCTGCTGAGG + Intronic
1182609051 22:31531391-31531413 TGGCCTTTAGCTAGCTACTGTGG + Intronic
1182804275 22:33057637-33057659 TGGCCTTTGGGGAGCTTCTGGGG - Intronic
1183114220 22:35677382-35677404 TTTGCTGTAGGGAACTACTGTGG - Intergenic
1184695182 22:46135029-46135051 AGTGCAGTAGGGAGCTACTTGGG + Intergenic
951787635 3:26440045-26440067 ACTGCTTTAAGGAGCTCCTGAGG - Intergenic
952181583 3:30921902-30921924 TGTGCTTTAGGGACCTCAAGGGG + Intergenic
952712319 3:36443874-36443896 AGGGCTTTAGGGATCTACAGGGG - Intronic
955541222 3:59978621-59978643 GGGGCTTTGGGGAGCTGCTGAGG + Intronic
956885237 3:73552563-73552585 TGTTCTTTTGAAAGCTACTGTGG - Intronic
957007204 3:74963580-74963602 TGTGCTTTAGGGAGCTGGATGGG - Intergenic
960147341 3:114217384-114217406 TGAGCTTTTGGCAGGTACTGAGG + Intergenic
963342513 3:144054208-144054230 TGTGATTTAGGGAGTTAGTTGGG + Intergenic
964566608 3:158062162-158062184 TTTGAATTAGGGTGCTACTGGGG - Intergenic
966806378 3:183810900-183810922 TGTGCTTAAGGGGGCTCCTTGGG + Exonic
969198249 4:5580504-5580526 TGTGTTTTAGGGCTGTACTGAGG + Intronic
969648454 4:8448066-8448088 TGCTCTTTAACGAGCTACTGAGG + Intronic
970857556 4:20666585-20666607 TGTGCATTAGTGAGCAAGTGTGG - Intergenic
972496146 4:39636714-39636736 TGGGCTTTAGGCATCCACTGGGG - Intronic
976659747 4:87527600-87527622 TGTGCCATGAGGAGCTACTGGGG + Intronic
978616285 4:110600007-110600029 TGTGCTTTAGTGAGTTAATGGGG - Intergenic
979979713 4:127239396-127239418 TGTGCTGTAGGGAGGCACAGTGG - Intergenic
980223520 4:129950654-129950676 TGTGCTTTTGGGGTATACTGGGG - Intergenic
981396160 4:144252409-144252431 TGTGGTTCAGAGAGCTTCTGGGG + Intergenic
981879887 4:149596811-149596833 AGTGCTTTAGGGCACTACTAAGG - Intergenic
982761252 4:159286517-159286539 AGTGCAATAGAGAGCTACTGAGG - Intronic
984500983 4:180558264-180558286 TTTGCTTTGGGGAGCTAAGGGGG + Intergenic
984996482 4:185436047-185436069 TGTGGCTTAGGAAGCTACTATGG + Exonic
985470306 5:38112-38134 TGGGCTTTTGGGGGCTCCTGTGG - Intergenic
985792208 5:1935372-1935394 TATGCTGGAGGGAGCTGCTGTGG + Intergenic
987967659 5:24896532-24896554 TGTGCCTTCAGGACCTACTGGGG - Intergenic
989631327 5:43485124-43485146 TAGGCTTTATGGAGCTATTGAGG + Intergenic
994158270 5:96527236-96527258 TGTGTTTTAGGGGGCCAATGAGG + Intronic
997579985 5:135011100-135011122 TGGGCACTAGGGAGCTACAGTGG + Intronic
998226907 5:140334268-140334290 TGTGCTTTAGGAATCGGCTGGGG - Exonic
999732581 5:154485799-154485821 TGAGTTTTAGGAAGCTAATGTGG - Intergenic
1006880521 6:37335154-37335176 TGTACTTTAGGCTGATACTGTGG - Intergenic
1008824867 6:55681996-55682018 TCTGCTTTATAGAGCTATTGTGG - Intergenic
1010941965 6:81929920-81929942 TGTGCATGATGGAGCTATTGGGG + Intergenic
1015282943 6:131453402-131453424 TGTACAATAGGGAACTACTGGGG + Intergenic
1015750215 6:136550957-136550979 TGCGCTTTAGGAAGCCACTGCGG + Intergenic
1017030002 6:150212620-150212642 TGTGATTTAAGGAGCCACAGTGG + Intronic
1017444251 6:154493062-154493084 AGTGTTTTGGGGAGCTATTGGGG - Intronic
1018964956 6:168477785-168477807 TGACTTTTAGGGATCTACTGGGG + Intronic
1019172668 6:170142782-170142804 TGAGTTTTAGGGAGATCCTGGGG - Intergenic
1022892945 7:34719681-34719703 TGTGATTTAGGGACATACTCTGG - Intronic
1024669832 7:51584461-51584483 AGGGCTTTAGGAAGCTCCTGTGG - Intergenic
1025529052 7:61853800-61853822 TGGACTTTAGGGAGCTCATGGGG - Intergenic
1028542584 7:91959551-91959573 TGTGCTTTGGGAAGCTAAAGTGG - Intronic
1030071080 7:105698043-105698065 TGAGCTTTTGGGAGATACAGAGG + Intronic
1030541569 7:110836754-110836776 TGTGCTTTAGGTGGCTGATGTGG + Intronic
1033600979 7:142888284-142888306 GGTGCTTTCAGGAGCTTCTGGGG - Intergenic
1035184805 7:157118121-157118143 TGTTCTTTGAAGAGCTACTGAGG + Intergenic
1035839876 8:2799860-2799882 TGAGCTTTAGGGAACATCTGGGG - Intergenic
1036526102 8:9536124-9536146 TGAGTTTTAGGGAGGTACAGTGG + Intergenic
1038264965 8:26031920-26031942 TGCGTTTTAGGGAGCTATTGGGG - Intronic
1038429964 8:27492259-27492281 TGTGCTTTGGGAAGCTAAGGTGG + Intronic
1040656772 8:49519452-49519474 TGTGCTTTAGGGACAGACTCTGG + Intergenic
1043343859 8:79275980-79276002 TGTGCTTAAGGGTGCTTATGTGG + Intergenic
1043411108 8:79996582-79996604 TGGGCTTTTGGGAGGTACTTAGG - Intronic
1046810446 8:118527294-118527316 TGTGCTGTGGGAAGCTCCTGTGG - Intronic
1048110252 8:131460438-131460460 TTTGTGTTATGGAGCTACTGTGG + Intergenic
1048306213 8:133286594-133286616 TCTGCTTTTGGGAGCTGGTGGGG + Intronic
1050923994 9:11240754-11240776 TGTGCTTAAGGATGCTTCTGGGG + Intergenic
1056120544 9:83483512-83483534 TGTGCTTAAATGAGCTATTGTGG + Intronic
1057852727 9:98577740-98577762 TGCCCTTTAGAGACCTACTGTGG + Intronic
1061074425 9:128332546-128332568 CAGGCCTTAGGGAGCTACTGAGG - Intronic
1062085728 9:134647115-134647137 TGTGCTTCTGGGAGCTAAAGAGG - Intronic
1186321570 X:8432258-8432280 TGTGCTCCAGGCAGCTTCTGGGG + Intergenic
1186395594 X:9205771-9205793 TGGGCCTTTGGGAGCTGCTGAGG - Intergenic
1187086475 X:16047911-16047933 TATGCTCTAGGGGGCTTCTGAGG + Intergenic
1188230240 X:27653472-27653494 TTTGTTTTAGGAAGCTACTTGGG - Intronic
1191145823 X:57164189-57164211 AGTGTTTTAGGGACATACTGTGG + Intergenic
1192627741 X:72747699-72747721 TGTGCTTAAGGGTGCTTTTGTGG - Intergenic
1192653967 X:72973110-72973132 TGTGCTTAAGGGTGCTTTTGTGG + Intergenic
1195208712 X:102629630-102629652 TGTTCTTTAGGGAATTACTTGGG - Intergenic
1200754789 Y:6980539-6980561 TCCACTTTGGGGAGCTACTGAGG - Intronic