ID: 1107987757

View in Genome Browser
Species Human (GRCh38)
Location 13:45790310-45790332
Sequence CTGTTTCAAACCAAGATCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107987757 Original CRISPR CTGTTTCAAACCAAGATCTA TGG Intronic
904574189 1:31492298-31492320 CTGCATCAGACCCAGATCTAAGG + Intergenic
905605648 1:39296926-39296948 CTGTCTCAAAAAAAAATCTAGGG - Intronic
908674129 1:66582857-66582879 CTCTGTTAAACAAAGATCTAAGG - Intronic
910866725 1:91795170-91795192 CTGTTTGAAAACAAGATTTTGGG - Intronic
912033523 1:105281355-105281377 TTGTTTAAAACCATGATTTAGGG - Intergenic
917121605 1:171649390-171649412 CTGTTTCAAGGCCAGATCTAGGG - Intronic
917433570 1:174996884-174996906 CAGTGTCAAACCAAGGACTAGGG + Intergenic
917644039 1:177012264-177012286 CTGATTTAAATCAAGATGTATGG + Intronic
918573818 1:186031444-186031466 CTGTTTAAAACCAACAACTAAGG - Intronic
1063510065 10:6636042-6636064 TTGTTTCAAATCAAGGTCTCTGG + Intergenic
1065539840 10:26752205-26752227 CTGTTTCAAGCCAAAATCAGGGG - Intronic
1065749544 10:28873500-28873522 CTGTTTGAAATCAAGATTTCTGG + Intronic
1068562486 10:58530963-58530985 CAGTTTAAAACCAAGAACCATGG + Intronic
1073073721 10:100810390-100810412 CTGTTTCCAGCCTAGATCTTTGG + Intronic
1073142923 10:101261021-101261043 GTGTTTGACACCAAGATATATGG - Intergenic
1075242903 10:120794095-120794117 TTGTTTCAAACTTAGATCTTGGG + Intergenic
1075375843 10:121977284-121977306 CTGGTTTAAACCATGATTTATGG - Intergenic
1076547418 10:131254602-131254624 CTGGTCCAAACCAAGATCTGTGG - Intronic
1078588913 11:12620782-12620804 ATTTTTAAAACCCAGATCTAAGG - Intergenic
1080621986 11:33994396-33994418 CTGTCTCAAAACAAGAACAAAGG - Intergenic
1085622063 11:78045106-78045128 CTGTCTCAAAAAAAGATCTCAGG - Intronic
1085694607 11:78693445-78693467 CTGTTTCAAATAAAAATCTTTGG + Intronic
1086426100 11:86683769-86683791 CTGTTTGGAACAAATATCTATGG + Intergenic
1090930713 11:131295798-131295820 CTGTTTCTAGCCAAGAGGTAGGG - Intergenic
1091064686 11:132498527-132498549 CTGTCTAAAACCAATGTCTAAGG + Intronic
1091900740 12:4142065-4142087 TTGATTCAAACCCAGAGCTAGGG - Intergenic
1093410995 12:18866792-18866814 GTATTTCAAACCAAGATTAAAGG + Intergenic
1093756351 12:22857153-22857175 CAGTTTCAAACAAAGAACAAAGG - Intergenic
1101193313 12:102357122-102357144 CTGATTAAAACCAGGATCAAAGG - Intergenic
1101933406 12:109034618-109034640 CTGTTTCTAACAGACATCTATGG - Intronic
1103868231 12:124071099-124071121 TTTTTTCAAACCAAGAACCAAGG + Intronic
1104096002 12:125558816-125558838 CTGTTTCTAGCCATGTTCTAAGG + Intronic
1106687614 13:32077647-32077669 CTGTCTCAAGCCAAGTTCTGAGG - Intronic
1107779862 13:43887402-43887424 CTGAATCAAACCCAGATATAGGG + Intronic
1107789060 13:43982415-43982437 CTGTTTCTAACTCAAATCTAGGG + Intergenic
1107987757 13:45790310-45790332 CTGTTTCAAACCAAGATCTATGG + Intronic
1108236429 13:48412119-48412141 CTGTTTTATACCAACATGTACGG - Exonic
1111261042 13:85740698-85740720 TTGTTTTAAACTAAAATCTAAGG + Intergenic
1116483634 14:45420324-45420346 TTTTTTCAAAACAGGATCTATGG - Intergenic
1117877186 14:60265313-60265335 CTGCTTGAAACCAATACCTAGGG - Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118906009 14:70023730-70023752 CTGTGTCAAGCCATGATGTATGG - Intronic
1121398852 14:93653833-93653855 CTGTTCCAAAGCACGATCAAAGG + Exonic
1124235071 15:27983351-27983373 TTGTTTCCAACCAAGAGCTGAGG - Exonic
1129570592 15:76680091-76680113 ATCTTTCAAACCAAGATCAAAGG + Intronic
1131379733 15:91953976-91953998 CTATTTAAAAACAAGATCTGTGG - Intronic
1132566508 16:625914-625936 CGGTTTCCAACCAAGATCCGGGG - Exonic
1132828192 16:1915199-1915221 CTCTTGCAAACCAGGAACTAAGG + Intronic
1132895334 16:2226416-2226438 CAGTCACAAACCAAGCTCTAAGG - Intronic
1136043537 16:27598873-27598895 CTGTTTCTACCCAGGATCTGTGG - Intronic
1138235838 16:55381730-55381752 CTATTCCAAACCAAGAACTCTGG - Intergenic
1141658120 16:85426933-85426955 AGGATTCAAACCAAGGTCTATGG - Intergenic
1145770958 17:27492751-27492773 CTATTCCAAGCCAACATCTATGG - Intronic
1146383103 17:32345895-32345917 GTATTACAAACCAAGATCTCTGG + Intronic
1146814842 17:35934318-35934340 CTGTTTCAAAGCAATAATTATGG + Intergenic
1147235368 17:39053392-39053414 CTGTTTCAAAGCAATAAATACGG - Intergenic
1150753648 17:67889987-67890009 CTGTTTAAAACAAAAATCTGTGG + Intronic
1150753826 17:67892046-67892068 CTGTTTAAAACAAAAATCTGTGG + Intronic
1155500807 18:26485067-26485089 AAGTTTCAAACCCAGGTCTATGG - Intronic
1157519157 18:48333617-48333639 CTATTTCAAAAGATGATCTATGG - Intronic
1160039591 18:75333611-75333633 CTGTTCCAAACCCAGCTCAAAGG + Intergenic
1161219510 19:3111887-3111909 AAGTGGCAAACCAAGATCTAAGG - Intronic
1168470461 19:56636567-56636589 CTGTTTCAAAACAACATTCATGG + Intergenic
926179742 2:10631273-10631295 CTGATTCAAACCCAAATCTTAGG + Intronic
928471885 2:31582903-31582925 CTATTTCAAACCCAGCTCAATGG + Intergenic
929636530 2:43528059-43528081 CTGTTTAGAACCCAGGTCTAGGG + Intronic
931743713 2:65273229-65273251 CTTTTTCAAACCCATATTTAAGG - Intergenic
933535487 2:83567832-83567854 CTCTTTCAAAAAAAGATATAGGG - Intergenic
935804440 2:106732035-106732057 CCTTTAAAAACCAAGATCTAAGG + Intergenic
937005818 2:118512730-118512752 CAGTTTCAAACTATGATCTCTGG - Intergenic
941003601 2:160225397-160225419 CTCTTTCACACCAAGCTCCATGG + Intronic
942212464 2:173685285-173685307 CTGTATCAAACCCAGCTCTGTGG + Intergenic
942257923 2:174124886-174124908 GGGTTTCAAATCAGGATCTAAGG - Intronic
942508599 2:176671328-176671350 CAGTTCCAAACCAAAATCAAAGG + Intergenic
942711184 2:178838049-178838071 ATCTTTCAAACCATGATCTGGGG + Intronic
944510112 2:200456178-200456200 CTGATGCAAACCAAGATCAGGGG - Intronic
944900942 2:204215417-204215439 CTGATTCAAATCAAGTGCTATGG - Intergenic
1170510652 20:17072952-17072974 GTGTTTCAGACCCAGATCTCTGG - Intergenic
1174219346 20:48940633-48940655 CTGTTGCACATCAAGAACTAGGG - Intronic
1175384629 20:58586418-58586440 CTGTAACAAACCAAGTTCCATGG - Intergenic
1176235045 20:64050009-64050031 CTTTTTCACACCAAGTTCTGGGG + Intronic
1178315208 21:31561130-31561152 CTGTTACAAGCCACCATCTAGGG + Intergenic
1179513001 21:41886591-41886613 CTGTTGAATACCAAGGTCTAGGG - Exonic
1185263128 22:49881970-49881992 CTGTAGCAAAGCAAGATGTATGG - Intronic
951474803 3:23093456-23093478 CTGTTTTAAAACAAGATCTGGGG - Intergenic
952113946 3:30157525-30157547 CTTTTTCAAACCAAGAGCCATGG + Intergenic
953457579 3:43055094-43055116 CTGTTTCAAACCCGGACCCATGG - Intronic
955068737 3:55554759-55554781 TTGTTTTAAACCAAGAGTTAGGG + Intronic
958522400 3:95206173-95206195 GCGTTGAAAACCAAGATCTAAGG + Intergenic
959437842 3:106338898-106338920 CTGTCTCACAGCAAGAGCTATGG - Intergenic
959526893 3:107387652-107387674 TTGTTTTAAACCAAGAGATAAGG - Intergenic
964107417 3:153054341-153054363 CTGTTTCTACCCAAGATTTCTGG - Intergenic
965122633 3:164581893-164581915 CTGTTTGTAACCAATATCTTTGG - Intergenic
966738920 3:183213774-183213796 CTGATTCAAAAGAAGATCCATGG - Intronic
972741911 4:41894840-41894862 CAGTTTCAAAGCATGATCTGGGG + Intergenic
977768552 4:100829841-100829863 GTGTTTTAAACCCAGATCTACGG + Intronic
980485495 4:133451450-133451472 CTGTTTAAATCCAACCTCTACGG - Intergenic
984123510 4:175776145-175776167 CTTTTTCAAAAAGAGATCTATGG + Intronic
984486500 4:180376888-180376910 CTGTCTCAAAACAAGATAAAAGG + Intergenic
988409210 5:30864595-30864617 CTTTTTCAAACCAGAATCTTAGG - Intergenic
989374362 5:40745179-40745201 GTTTTTAAAACCAGGATCTAAGG - Intronic
991187844 5:63831425-63831447 ATGTCTGAAACCAAGATCTGTGG + Intergenic
991941778 5:71860375-71860397 CTGTCTCAAAAAAAAATCTAGGG - Intergenic
992530888 5:77650832-77650854 CTGTTTAAAGCCAAGGTCCAGGG - Intergenic
992621218 5:78595125-78595147 CTGCTTCAAACCAGGAACTAAGG + Intronic
993175032 5:84472665-84472687 CTTTTTCAACCCAAGATATGAGG + Intergenic
995150324 5:108836309-108836331 ATGTTTCAAACAGAGATTTATGG + Intronic
999994197 5:157076441-157076463 CTGTTTCAAATAAGGCTCTAAGG - Intergenic
1001264303 5:170261581-170261603 CTGTTTTAAAGCAAGAGCAAGGG - Intronic
1004835376 6:19525605-19525627 CTGCTTCAGACCAATATTTATGG + Intergenic
1005397801 6:25401639-25401661 GTGTTTCAAAGCAAGATTAATGG + Intronic
1008533264 6:52484708-52484730 CTCTTTAAAACCTTGATCTAGGG + Intronic
1010233116 6:73553045-73553067 GTGTTTCAAAGCATGGTCTATGG + Intergenic
1012487750 6:99741061-99741083 CTGTTACAAATAAAAATCTAGGG + Intergenic
1013999748 6:116351277-116351299 CTGTCTCATACCAAGATCTCAGG + Intronic
1014435394 6:121415312-121415334 CTGTTGAAAACCAAGATAAAGGG + Intergenic
1014983418 6:127973544-127973566 CTGTTTAAAAATAACATCTATGG + Intronic
1015309178 6:131746657-131746679 CTGTATCAAATTAAGATTTAAGG + Intronic
1019079217 6:169418180-169418202 CTGTTGCAAACAAAGATCACTGG - Intergenic
1019462834 7:1170171-1170193 CTGTTTCAAACTAAAATTTGTGG - Intergenic
1022069766 7:26901347-26901369 TTGTTTCAAGCCATCATCTATGG + Intronic
1027456629 7:78400151-78400173 CTGTTTCCAAACAAGCTCGATGG - Intronic
1028286593 7:89010769-89010791 GTGTTTCAAACCAGAATCTAAGG + Intronic
1031086534 7:117307123-117307145 CTGTTTAAAAAAAAGAGCTATGG + Intronic
1031662220 7:124439472-124439494 CTGTTTCAAACTTTCATCTATGG - Intergenic
1033482201 7:141753594-141753616 CTGTTTCCAACCATAATATAAGG + Intronic
1040009626 8:42650516-42650538 CTGGTTCAAACCATGTTCTGTGG - Intergenic
1041674642 8:60525853-60525875 TTGTTTCAAAACAGGATTTAAGG + Intronic
1043269325 8:78310081-78310103 CTGTTTTAAAGCAAGAACAATGG - Intergenic
1045452043 8:102336762-102336784 CTATTTTAAACCAAGAAGTATGG + Intronic
1045870198 8:106917941-106917963 CTGTCTCAAACACAGCTCTAGGG + Intergenic
1047399819 8:124536646-124536668 CTGTCTTAAACCAAAATCTAAGG + Intronic
1047580882 8:126214017-126214039 CTGTTTCAGACCAAAACCTCAGG - Intergenic
1049354616 8:142181582-142181604 CTGTTTCGAACCATGAGCTTTGG + Intergenic
1051190858 9:14510458-14510480 TTGTTTTAAACCAAAATCTTGGG + Intergenic
1053168057 9:35858575-35858597 CAGTGTCAACCCAAGAGCTATGG - Intergenic
1055292982 9:74803151-74803173 CTCTTTCATACCAGGAGCTATGG + Intronic
1056452548 9:86730075-86730097 CTGTTGTAAACCTAGAACTAAGG - Intergenic
1058062809 9:100515842-100515864 CTTTTTCAAACCAAATTCGAGGG + Intronic
1059002576 9:110365505-110365527 CTATTTTAAAACAAAATCTAGGG + Exonic
1059023512 9:110600736-110600758 CTGTTTCAGACACAGATCTGTGG - Intergenic
1186341062 X:8646629-8646651 CTGTTTCAAAAGAAGATTTCTGG + Intronic
1191743153 X:64457139-64457161 CTGACTAAAACCAAGATTTAAGG - Intergenic
1192787549 X:74349917-74349939 CACTTTCAAACCAAGAACAATGG + Intergenic
1193241202 X:79171663-79171685 CTGTTTCTCTCCAAGATCTTGGG - Exonic
1194995128 X:100583636-100583658 GTCTTTCAAACCAAAATCTGAGG - Intergenic
1195303994 X:103561174-103561196 CTATTACAAACCAGTATCTATGG + Intergenic
1195696299 X:107670019-107670041 CTGTTACAAACCAAGCACTGTGG - Intergenic
1195727986 X:107936837-107936859 CCTTTTCAAACCATAATCTAGGG - Intergenic
1195934886 X:110115502-110115524 CTGGTCCAAACCAAATTCTAGGG + Intronic
1199200613 X:145084438-145084460 GTGTTTCAATCCCAGATCTTTGG + Intergenic
1200739333 Y:6836180-6836202 ATGTTTCAAACCAAGAGATTGGG - Intergenic
1201315616 Y:12642648-12642670 CAGTTTTAAACCAAGAGATAGGG - Intergenic