ID: 1107988118

View in Genome Browser
Species Human (GRCh38)
Location 13:45793399-45793421
Sequence GGATGAACACAACTTAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1684
Summary {0: 1, 1: 0, 2: 6, 3: 182, 4: 1495}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107988118_1107988124 3 Left 1107988118 13:45793399-45793421 CCCAGATTAAGTTGTGTTCATCC 0: 1
1: 0
2: 6
3: 182
4: 1495
Right 1107988124 13:45793425-45793447 AGGGGTTCCTTATTCTAACTAGG 0: 1
1: 0
2: 0
3: 3
4: 93
1107988118_1107988125 8 Left 1107988118 13:45793399-45793421 CCCAGATTAAGTTGTGTTCATCC 0: 1
1: 0
2: 6
3: 182
4: 1495
Right 1107988125 13:45793430-45793452 TTCCTTATTCTAACTAGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107988118 Original CRISPR GGATGAACACAACTTAATCT GGG (reversed) Intronic
900007798 1:75376-75398 GGATGAAGCCCACTTGATCTTGG - Intergenic
900775268 1:4579195-4579217 GGATGAAGACGACTTGATTTTGG + Intergenic
901958313 1:12804284-12804306 GGATGAAGCCAACTTGATCTTGG + Intergenic
902133917 1:14288020-14288042 GGATGAAGCCAACTTGATCATGG + Intergenic
903344070 1:22673350-22673372 AAATGAACCCAACTTCATCTTGG + Intergenic
905437931 1:37971656-37971678 GGATGAAGCCAACTTGATCATGG - Intronic
905963191 1:42063024-42063046 GGATGAAGCCAACTTGATCATGG - Intergenic
906251960 1:44317686-44317708 GAATAAGCACAACTCAATCTGGG + Intronic
906558238 1:46732318-46732340 GGATGAAGCCAACTTGATCTTGG - Intergenic
906565269 1:46795940-46795962 GGATGAAGCCAACTTGATCATGG + Intronic
906586087 1:46979777-46979799 GAATGAAGCCAACTTCATCTTGG - Intergenic
906606541 1:47176418-47176440 GGATGATCACCATTTTATCTGGG - Intergenic
906736567 1:48135204-48135226 GGATGAAGTCAACTTGATCGTGG + Intergenic
906881754 1:49598942-49598964 GGATGAAGCCAACTTGATCGAGG + Intronic
906883486 1:49618770-49618792 GGATGAAGCCAACTTGATCATGG - Intronic
906890316 1:49705885-49705907 GGATGAAGCCAACTTGATCGTGG + Intronic
906939383 1:50242835-50242857 GGATGAAGCCAACTTGATCGTGG + Intergenic
907005302 1:50907221-50907243 GGATGAAGACAACTTGATCGTGG + Intronic
907232021 1:53008429-53008451 GGATGAAGCCAACTTGATCGTGG - Intronic
907532359 1:55113680-55113702 GGATGAAGCCAACTTGATCGTGG - Intronic
907624408 1:56014622-56014644 AGATGAAGACTACTTAATCATGG - Intergenic
907685971 1:56611811-56611833 GGATGAAGCCAACTTGATCTTGG - Intronic
908016261 1:59840031-59840053 GGATGAAACCAACTTGATCGTGG + Intronic
908086791 1:60643671-60643693 GGATGAAGCCCACTTAATCACGG - Intergenic
908595348 1:65683296-65683318 GGATGAAGCCAACTTGATCGTGG + Intergenic
908601073 1:65740552-65740574 GGATGAAGCCAACTTGATCATGG + Intergenic
908624291 1:66022648-66022670 GGATGAAACCAACTTGATTTTGG + Intronic
908813210 1:68005420-68005442 GGATGAAGCCAACTTGATCATGG + Intergenic
908821336 1:68089906-68089928 GGATGAAGCCAACTTCATCTTGG + Intergenic
908868666 1:68582297-68582319 GGATGAAACCAACTTGATCATGG - Intergenic
908879301 1:68712451-68712473 GGATGAAGCCAACTTGATCATGG - Intergenic
908937327 1:69391785-69391807 GGATGAAGCCAACTTGATCATGG + Intergenic
909051162 1:70770043-70770065 GGATGAAGCCCACTTAATCATGG + Intergenic
909081906 1:71122654-71122676 GGATGAAGCCAACTTGATCGTGG - Intergenic
909181312 1:72427350-72427372 GGATGAAGCCAACTTGATCATGG + Intergenic
909628540 1:77746679-77746701 GGATGAAGCCAACTTGATCGTGG - Intronic
909672751 1:78207229-78207251 GGATGAAGCCAACTTGATCATGG - Intergenic
909683012 1:78313818-78313840 GGATGAAGCCCACTTGATCTTGG - Intronic
909807576 1:79890902-79890924 GGATGAAGTCAACTTGATCTTGG + Intergenic
909811850 1:79940732-79940754 GGATGAAGCCCACTTGATCTTGG + Intergenic
909976760 1:82054621-82054643 GGATGAAGCCAACTTGATCGTGG + Intergenic
909992122 1:82236455-82236477 GGATGAAACCAACTTGATCATGG + Intergenic
910177558 1:84446865-84446887 GGATGAAGCCAACTTGATCATGG - Intergenic
910249884 1:85186137-85186159 GGATGAAGCCCACTTGATCTTGG + Intronic
910379490 1:86610799-86610821 GGATGAAGCCAACTTGATCGTGG + Intergenic
910466846 1:87509302-87509324 GGATGAACAAGAATTAATCAGGG + Intergenic
910531479 1:88241220-88241242 GGATGAAGCCAACTTGATCGTGG - Intergenic
910571929 1:88715114-88715136 GGATGAAGCCAAGTTGATCTTGG + Intronic
910605188 1:89075637-89075659 GGATGAAGCCAACTTAATCTTGG - Intergenic
910612299 1:89158011-89158033 GGATGAAGCCAACTTGATCGTGG - Intronic
910645422 1:89509023-89509045 GGATGAAGCCAACTTGATCGTGG - Intergenic
910717741 1:90250790-90250812 GGATGAAGCCAACTTGATATTGG - Intergenic
910805379 1:91185015-91185037 GGATGAAGCCAACTCAATCATGG + Intergenic
910822074 1:91361852-91361874 GGATGAAGCCAACTTGATCATGG - Intronic
910912883 1:92256554-92256576 GGATGAAGCCAACTTGATCATGG - Intronic
910929915 1:92433100-92433122 GGATGAAGCCAACTTGATCGTGG + Intergenic
910954410 1:92686197-92686219 GGATGAAGCCAACTTGATCATGG - Intronic
911009720 1:93267094-93267116 GGATGAAGCCAACTTAATTGTGG - Intronic
911021269 1:93390355-93390377 GGATGAAGCCAACTTGATCATGG + Intergenic
911079369 1:93913064-93913086 GGATGAAGCCAACTTGATCGTGG + Intergenic
911120313 1:94289833-94289855 GGATGAAGACAACTTGATTGTGG + Intergenic
911240199 1:95456939-95456961 GGATGAAGCCAACTTGATCATGG - Intergenic
911338938 1:96614112-96614134 GGATGAAGCCAACTTGATCTTGG + Intergenic
911464680 1:98236686-98236708 GGATGAAGCCAACTTAATCATGG - Intergenic
911516847 1:98877936-98877958 GGATGAAGCAAACTTGATCTTGG + Intergenic
911827555 1:102506516-102506538 GGATGAAGCCAACTTGATCATGG + Intergenic
912032251 1:105263459-105263481 GGATGAAGCCAACTTAATTGTGG + Intergenic
912076382 1:105881174-105881196 GGATGAAGCCAACTTGATCATGG + Intergenic
912226108 1:107736007-107736029 GGATGAAGCCAACTTGATCTTGG - Intronic
912264824 1:108146756-108146778 GGATGAAGCCAACTTGATCATGG + Intronic
912270684 1:108205758-108205780 GGATGAAGCCAACTTGATCATGG + Intergenic
912592308 1:110835895-110835917 GGATGAAGCCAACTTGATCATGG - Intergenic
912609277 1:111027092-111027114 GGATGAAGCCAACTTGATCATGG - Intergenic
912615251 1:111093628-111093650 GGATGAAGCCAACTTGATCGTGG - Intergenic
912636525 1:111299388-111299410 GGATGAAGCCAACTTGATCGTGG - Intronic
912878614 1:113387891-113387913 GAATGAATACAACTTATTCATGG + Intergenic
912885379 1:113466327-113466349 GGATGAATCCCACTTAATCATGG + Intronic
913102363 1:115580564-115580586 GGATGAAGAAAACTTGATCACGG + Intergenic
913222490 1:116670238-116670260 AGATGATCACAGCTTAAACTAGG + Intergenic
913410549 1:118546309-118546331 GGATGAAGCCAACTTGATCATGG - Intergenic
913455280 1:119024283-119024305 GGATGAAGCCCACTTGATCTTGG - Intergenic
913526023 1:119693764-119693786 GGATGAAGCCAACTTGATCATGG + Intronic
913712530 1:121499977-121499999 GGATGAAGCCAACTTGATCTTGG - Intergenic
913987602 1:143579602-143579624 GGATGAAGCCAACTTGATCATGG + Intergenic
914208012 1:145551690-145551712 GGATGAAGCCAACTTGATCATGG + Intergenic
914369844 1:147014286-147014308 GGATGAAGCCAACTTGATCATGG - Intergenic
914683121 1:149954388-149954410 GGATGAAGCCAACTTGATCTTGG + Intronic
915181725 1:154067243-154067265 GGATGAAGCCAACTTGATCTTGG - Intronic
915639468 1:157212437-157212459 GGATGAAGCCAACTTGATCGTGG + Intergenic
915651877 1:157319083-157319105 GGATGAAGCCAACTTGATCATGG - Intergenic
915753522 1:158235658-158235680 GGATGAAGCCCACTTGATCTCGG - Intergenic
915852961 1:159347555-159347577 GGATGAAGCCAACTTGATCGTGG - Intergenic
915946159 1:160153164-160153186 GGATGATCACAAATTAACCTTGG + Exonic
916379927 1:164198274-164198296 GGATGAAGCCAACTTGATCATGG - Intergenic
916460358 1:165017711-165017733 GGATGAAGCCCACTTGATCTTGG + Intergenic
916534627 1:165691870-165691892 GGATGAAGCCAACTTGATCATGG - Intronic
916595843 1:166242312-166242334 GGATGAAGCCCACTTGATCTTGG + Intergenic
917111449 1:171552804-171552826 GGATGAAGCCAAGTTGATCTTGG + Intronic
917158393 1:172029209-172029231 GGATGAAGCCAACTTAATTGTGG - Intronic
917182828 1:172318037-172318059 GGATGAAGACCACTTGATCATGG - Intronic
917192751 1:172435395-172435417 GGATGAAGCCAACTTGATCGTGG - Intronic
917207569 1:172593616-172593638 GGATGAAGCCAACTTGATCGTGG + Intronic
917298037 1:173542659-173542681 GGATGAAGACACCTTGATCTTGG - Intronic
917308474 1:173652438-173652460 GGATGAAGGCAACTTGATCATGG + Intronic
917313283 1:173699472-173699494 GGTTGAAGCCAACTTGATCTTGG - Intergenic
917463991 1:175258438-175258460 GGATGAAGCCAACTTGATCATGG + Intergenic
917903590 1:179567907-179567929 GGATGAAGCCAACTTGATCGTGG + Intronic
917915593 1:179698108-179698130 GGATGAAGCCAACTTGATCTTGG - Intergenic
917984665 1:180303906-180303928 GGATGAAGCCCACTTAATCATGG - Intronic
918079972 1:181199396-181199418 GGATGAAGCCAACTTGATCATGG - Intergenic
918088690 1:181268208-181268230 GGATGAAGCCAACTTGATCATGG + Intergenic
918156578 1:181852880-181852902 GGATGAAGACGACTTGATCATGG - Intergenic
918324813 1:183399712-183399734 GGATGAAGCCAACTTGATCATGG - Intronic
918814422 1:189164619-189164641 GGATGAAGCCAACTTGATCGTGG + Intergenic
918975124 1:191474188-191474210 GGATGAAGCCAACTTCATCAGGG - Intergenic
919292226 1:195647030-195647052 GGATGAAGCCAACTTGATCGGGG + Intergenic
919374970 1:196783144-196783166 GGATGAAGACCACTTGATCATGG + Intronic
919489860 1:198193609-198193631 GGATGAAGCCAACTTGATCATGG - Intronic
919602250 1:199636644-199636666 GGATGAAGCCAACTTGATCATGG - Intergenic
920085815 1:203415768-203415790 GGATGAAGCCAACTTGATCGTGG - Intergenic
920781417 1:208995224-208995246 GGATGAAGCCAACTTGATCGTGG - Intergenic
920818474 1:209357741-209357763 GGATGAAGCCAACTTGATCGTGG + Intergenic
920992821 1:210956244-210956266 GGATGAAGCCAACTTGATCATGG + Intronic
921796684 1:219352773-219352795 GGATGAACAGAGCCTAAGCTGGG - Intergenic
922047017 1:221955530-221955552 GGATGAAGCCAACTTGATCGTGG - Intergenic
922092297 1:222408150-222408172 GGATGAAGCCAACTTGATCATGG - Intergenic
922379680 1:225010436-225010458 GGATGAACCTGACTTAATCTTGG + Intronic
922405885 1:225312785-225312807 GGATGAAGCCAACTTGATCGTGG + Intronic
923444119 1:234051981-234052003 GGATGAAGCCAACTTGATCGTGG + Intronic
924952801 1:248900393-248900415 GGATGAAGACAACTTGATCATGG - Intergenic
1063294941 10:4795918-4795940 GGATGAAGCCAACTTGATCATGG + Intronic
1063329023 10:5137399-5137421 GGATGAAGCTAACTTGATCTTGG - Intergenic
1064370142 10:14744687-14744709 GGATGAAGCCAACTTGATCATGG + Intronic
1064513801 10:16124383-16124405 GGAGGAACACAAGTTGAGCTTGG - Intergenic
1065055698 10:21839901-21839923 GGATGAAGCCCACTTAATCATGG - Intronic
1065154866 10:22859067-22859089 GGATGAAGCCAACTTGATCATGG - Intergenic
1065308061 10:24387204-24387226 GGATGAAGCCAACTTGATTTTGG - Intronic
1065427782 10:25623326-25623348 GGATGAAGCCAACTTGATCATGG - Intergenic
1065529140 10:26651323-26651345 TCATGAAAACAACTAAATCTTGG + Intergenic
1065770069 10:29069839-29069861 GGATGGACACAATTTAGGCTGGG + Intergenic
1066051476 10:31640150-31640172 GGATGAAGCCAACTTGATCATGG + Intergenic
1066055852 10:31679275-31679297 CGATGCACACACCTTACTCTCGG + Intergenic
1066146351 10:32562451-32562473 GGATGAAGCCAACTTGATCATGG - Intronic
1066149000 10:32594891-32594913 GGATGAAGCCAACTTGATCGTGG + Intronic
1066163333 10:32758399-32758421 GGATGAAGCCAACTTGATCATGG - Intronic
1066257294 10:33692656-33692678 GGATGAAGCCAACTTGATCACGG + Intergenic
1066537044 10:36403220-36403242 GGATGAAGCCCACTTAATCATGG - Intergenic
1066583789 10:36909803-36909825 GGATGAAGCCCACTTAATCATGG + Intergenic
1066608037 10:37203285-37203307 GGATGAAGCCAACTTGATCATGG - Intronic
1066613334 10:37273352-37273374 GGATGAAGCCAACTTGATCGTGG + Intronic
1066655559 10:37696620-37696642 GGATGAAGCCAACTTGATCGTGG - Intergenic
1067193692 10:44094706-44094728 GGATGAAGCCACCTTGATCTTGG - Intergenic
1067331761 10:45328978-45329000 GGATGAAGCCAACTTGATCATGG + Intergenic
1068490684 10:57719887-57719909 GGATGAAGCCAACTTGATCATGG - Intergenic
1068508510 10:57934089-57934111 GGATGAAGTCAACTTGATCATGG + Intergenic
1068516666 10:58033684-58033706 GGATGAAGCCAACTTGATCATGG + Intergenic
1068552279 10:58420117-58420139 GGATGAAGCCAACTTGATCGTGG + Intergenic
1068561811 10:58523353-58523375 GGATGAAGCCAACTTGATCGTGG - Intronic
1068575915 10:58684216-58684238 GGATGAAGCCAACTTGATCATGG + Intronic
1068580995 10:58739423-58739445 GGATGAAGCCAACTTGATCATGG + Intronic
1068609212 10:59040188-59040210 GGATGAAGCCAACTTGATCGTGG + Intergenic
1068641267 10:59410669-59410691 GGATGAAGCCAACTTGATCGTGG + Intergenic
1068664672 10:59660803-59660825 GGATGAAGCCAACTTGATCGTGG - Intronic
1068951972 10:62786434-62786456 GGATGAAGCCAACTTGATCGTGG - Intergenic
1069011626 10:63380383-63380405 GGTGGAATACCACTTAATCTGGG - Exonic
1069139582 10:64806777-64806799 GGATGAAGCCAACTTGATCTTGG + Intergenic
1069188667 10:65460650-65460672 GGATGAAGCCAACTTTATCTTGG + Intergenic
1069193995 10:65526014-65526036 GGATGAAGCCAACTTGATCATGG - Intergenic
1069263439 10:66429552-66429574 GGATGAAGCCAACTTGATCGTGG - Intronic
1069340899 10:67407218-67407240 GGATGAAGACTACTTAATCATGG - Intronic
1069355583 10:67581400-67581422 GGATGAAGCCAACTTCATCACGG + Intronic
1069360445 10:67635469-67635491 GGATGAAGACAACTCGATCATGG - Intronic
1070007502 10:72439200-72439222 GGATGAAGCCAACTTGATCGTGG - Intronic
1070937086 10:80307823-80307845 GGATGAAGCCAACTTGATCTTGG - Intergenic
1071000063 10:80821457-80821479 GGATGAAGCCAACTTTATCATGG - Intergenic
1071028246 10:81140866-81140888 GGATGAAGCCAACTTGATCACGG - Intergenic
1071035123 10:81235646-81235668 GGATGAAGCCAACTTGATCATGG + Intergenic
1071076882 10:81765540-81765562 GGATGAAGGCAACTTGATCGTGG + Intergenic
1071210806 10:83339714-83339736 GGATGAAGCCAACTTGATCATGG + Intergenic
1071244091 10:83743558-83743580 GGATGAAGCCAACTTGATCATGG + Intergenic
1071373292 10:84975743-84975765 GGATGAAGCCCACTTAATCATGG - Intergenic
1071421191 10:85501388-85501410 GGATGAAACCAACTTGATCATGG + Intergenic
1071698139 10:87900165-87900187 GGATGAAGCCAACTTGATCTTGG + Intronic
1071838919 10:89448406-89448428 GGATGAAGCCAACTTGATCTTGG - Intronic
1071844668 10:89509393-89509415 GGATGAAGCCAACTTAATCATGG - Intronic
1071852417 10:89587288-89587310 GGATAAACACAGCTGACTCTTGG - Intronic
1071927254 10:90424433-90424455 GGATGAAGCCAACTTGATCATGG + Intergenic
1072025280 10:91449198-91449220 GGATGAAGCCAACTTGATCGTGG - Intronic
1072091575 10:92133815-92133837 GGATGAAGCCAACTTGATCATGG - Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072366467 10:94715523-94715545 GGATGAAGCCAACTTGATCATGG + Intronic
1072373510 10:94790686-94790708 GGATGAAGCCAACTTGATCGTGG + Intronic
1072373513 10:94790710-94790732 GGATGAAGCCAACTTGATCGTGG + Intronic
1072375363 10:94810224-94810246 GGATGAAGCCAACTTGATCGTGG + Intronic
1072389244 10:94966033-94966055 GGATGAAGCCAACTTGATCGTGG + Intronic
1072757893 10:98032497-98032519 GGATCATTAAAACTTAATCTAGG + Intergenic
1072778913 10:98229922-98229944 GGATGAAGCCAACTTGATCATGG + Intronic
1072876538 10:99178919-99178941 GGATGAAGCCAACTTGATCGTGG - Intronic
1072928873 10:99642907-99642929 GGATGAAGCCAACTTGATCATGG + Intergenic
1073022579 10:100458241-100458263 GGATGAAGCCAACTTGATCGTGG - Intergenic
1073620458 10:105042008-105042030 CAATTAACAAAACTTAATCTTGG - Intronic
1074000839 10:109371045-109371067 GGATGAAGCCAACTTGATCGTGG - Intergenic
1074017619 10:109550090-109550112 GGATGAAGGCAACTTGATCTTGG - Intergenic
1074662130 10:115672377-115672399 GAAAGAACACAACTTATTTTAGG + Intronic
1074668150 10:115755510-115755532 GGATGAAGCCAACTTGATCATGG + Intronic
1075858377 10:125651296-125651318 GGATGAAGCCAACTTGATCATGG - Intronic
1077655273 11:4013065-4013087 GGATGAAGCCAACTTGATCATGG + Intronic
1077713993 11:4563121-4563143 GGATGAAGCCAACTTGATCGTGG - Intergenic
1078119640 11:8493747-8493769 GGATGAAGCCAACTTGATCGTGG - Intronic
1078394390 11:10967036-10967058 GGATGAAGCCAACTTGATCGTGG - Intergenic
1078750896 11:14162760-14162782 GAACAAACACAACTTACTCTTGG + Intronic
1078780330 11:14432723-14432745 GGATGAAGCCAACTTGATCGTGG - Intergenic
1078796476 11:14597086-14597108 GGATGAAGCCAACTTGATCATGG + Intronic
1079462175 11:20691625-20691647 GGATGAAGCCAACTTGATCATGG + Intronic
1079675218 11:23218404-23218426 GGATGAAGCCAACTTGATCGTGG - Intergenic
1080031788 11:27669059-27669081 GGATGAAGCCAACTTGATCATGG - Intronic
1080079651 11:28201232-28201254 GGATGAAGCCAACTTGATCATGG + Intronic
1080200711 11:29666445-29666467 GGATGAAGCCAACTTGATCTTGG - Intergenic
1080366258 11:31577594-31577616 GGATGAAGACAACTTGATCGTGG - Intronic
1080374782 11:31695499-31695521 GGATGAAGACAACTTGATCGTGG + Intronic
1080489147 11:32744249-32744271 GGATGAAGACAACTTGATCATGG + Intronic
1080710399 11:34741579-34741601 GGATGAAGCCAACTTGATCATGG - Intergenic
1080732842 11:34978381-34978403 GGATGAAAACCATTTATTCTAGG + Intronic
1080784006 11:35458258-35458280 GAATGAACACACATTCATCTGGG - Intronic
1081124833 11:39310026-39310048 GGATGAAACCAACTTGATCGTGG + Intergenic
1081126540 11:39330059-39330081 GGATGAAGACCACTTGATCATGG - Intergenic
1081151106 11:39633730-39633752 GGATGAAGCCGACTTGATCTTGG + Intergenic
1081241092 11:40707551-40707573 GGATGAAGCCAACTTGACCTTGG + Intronic
1081370123 11:42290288-42290310 GGATGAATACAACTTGATTGTGG - Intergenic
1081405385 11:42691798-42691820 GGATGAAGCCAACTTGATCATGG - Intergenic
1082147397 11:48686799-48686821 GGATGAAGACCACTTGATCAGGG - Intergenic
1082196258 11:49310086-49310108 GGATTAAGCCAACTTGATCTTGG + Intergenic
1082269328 11:50152640-50152662 GGATGAAGCCAACTTGATCATGG - Intergenic
1082674334 11:56077307-56077329 GGATGAACCCAACTTGATCATGG + Intergenic
1082860555 11:57851642-57851664 GGATGAAGCCAATTTCATCTTGG - Intergenic
1082938845 11:58682367-58682389 GGATGAAGCCAACTTGATCGCGG - Intronic
1082945436 11:58753631-58753653 GGATGAAGCCAACTTGATCATGG - Intergenic
1083345639 11:61989093-61989115 GGATGAAGCCAACTTGATCATGG - Intergenic
1083368695 11:62160577-62160599 GGATGAAGCCAACTTGATCATGG - Intergenic
1083509635 11:63196405-63196427 GGATGAAGTCAACTTGATCGTGG - Intronic
1083533982 11:63452126-63452148 GGATGAAGCCAACTTGATCATGG + Intergenic
1084361570 11:68671764-68671786 GGATGAAGCCAACTTGATCGTGG + Intergenic
1085135378 11:74082626-74082648 GGATGAAGCCAACTTGATCGTGG + Intronic
1085536201 11:77220546-77220568 GGATGAAGCCAACTTGATCTTGG + Intronic
1086243926 11:84728431-84728453 GGATGAAACCAACTTGATCGTGG + Intronic
1086266587 11:85006065-85006087 GGATGAAGCCAACTTGATCTTGG + Intronic
1086391251 11:86366163-86366185 GGATGAAGCCAACTTGATCATGG - Intergenic
1086532017 11:87797640-87797662 GGATGAAGCCCACTTGATCTTGG - Intergenic
1086612535 11:88774786-88774808 GGATGAAGCCAACTTGATCGTGG + Intronic
1086659570 11:89398116-89398138 GGATTAAGCCAACTTGATCTCGG - Intronic
1086721933 11:90131386-90131408 GGATGACCACAACATCATGTGGG + Intergenic
1086811718 11:91318631-91318653 GGATGAAGCCAACTTGATCGTGG + Intergenic
1087084840 11:94206780-94206802 GGATGAATTCCACTTAATCATGG - Intergenic
1087089317 11:94251831-94251853 GGATGAAGCCAACTTAATTGTGG - Intergenic
1087103116 11:94384135-94384157 GGATGAAGCCAACTTGATCACGG - Intronic
1087243757 11:95810000-95810022 AGATGAAGCCAACTTGATCTTGG - Intronic
1087311460 11:96548813-96548835 GGATGAAGCCAACTTGATCATGG - Intergenic
1087316669 11:96611457-96611479 GGATGAAGCCAACTTGATCGTGG + Intergenic
1087398639 11:97635311-97635333 GGATGAAGCCAACTTGATCGTGG + Intergenic
1087442375 11:98202709-98202731 GGATGAATGCAACTTTATCGTGG - Intergenic
1087485185 11:98751635-98751657 GGATGAAGCCAACTTGATCGTGG - Intergenic
1087579799 11:100037309-100037331 GGATGAAGCCCACTTGATCTTGG + Intronic
1087653693 11:100898182-100898204 GGATGAAGCCAACTTGATCGTGG + Intronic
1087719184 11:101642688-101642710 GGATGAAGCCAACTTGATCTTGG - Intronic
1087742037 11:101898985-101899007 GGATGAAGCCAACTTGATCATGG + Intronic
1087753793 11:102033759-102033781 GGATGAAGCCAACTTGATCTTGG + Intergenic
1087881615 11:103422489-103422511 GGATGAAGCCAACTTGATCACGG - Intronic
1088038071 11:105342423-105342445 GGATGAAGCCAACTTGATCGTGG + Intergenic
1088066208 11:105723039-105723061 GGAAGAACACAACTGGACCTTGG + Intronic
1088390941 11:109314396-109314418 GGATGAAGCCAACTTGATCATGG - Intergenic
1088445732 11:109925684-109925706 GGATGAATCCAACTTGATCAGGG - Intergenic
1089193194 11:116670512-116670534 GGATGAAGCCAACTTGATCTTGG - Intergenic
1089248627 11:117141091-117141113 GGATGAACCCAACTTGATTGTGG - Intergenic
1089765668 11:120762779-120762801 GGATGAAGCCAACTTGATCATGG + Intronic
1090215968 11:124964982-124965004 GGATGAAGCCAACTTGATCTTGG + Intronic
1090322621 11:125861117-125861139 GGATGAAGCCAACTTGATCATGG - Intergenic
1090346485 11:126075810-126075832 GGATGGACAAAACTTAAACTTGG + Intergenic
1090723327 11:129497285-129497307 GGATGAACCCAACTTGATCATGG - Intergenic
1091711992 12:2748518-2748540 GGATGAAGCCAACTTGATCCTGG + Intergenic
1091811353 12:3400808-3400830 GGATGAAACCAACTTGATCCTGG - Intronic
1091940858 12:4480186-4480208 GGATGAACACAACTGAGTGTGGG - Intergenic
1092316280 12:7417753-7417775 GGATGAAGACGACTTGATCTTGG + Intronic
1092326032 12:7532289-7532311 GGATGAAGCCAACTTGATCGTGG - Intergenic
1092562342 12:9629610-9629632 GGATGAAGCCAACTTGATCATGG + Intergenic
1092604780 12:10106661-10106683 GGATGAAGCCAACTTAATCGTGG - Intronic
1092691229 12:11112453-11112475 GGTTGAAGACGACTTGATCTTGG - Intronic
1093275491 12:17120149-17120171 GGATGAAGCCAACTTGATCGTGG - Intergenic
1093366701 12:18309910-18309932 GAATAAACACAACTGACTCTAGG - Intronic
1093599675 12:21006480-21006502 GGATGAAGCCAACTTGATCGTGG - Intergenic
1093627285 12:21364197-21364219 GGATGAAGCCAACTTGATCATGG - Intronic
1093802699 12:23392776-23392798 GGATGAAGCCAACTTGATCTTGG - Intergenic
1094093151 12:26673344-26673366 GGATGAAGCCCACTTAATCATGG - Intronic
1094139683 12:27168169-27168191 GGATGAAGGCAACTTGATCGTGG + Intergenic
1094166456 12:27448539-27448561 AGAAGAACAAAACTTAAACTGGG + Intergenic
1094262915 12:28521914-28521936 GGATGAAGCCAACTTGATCATGG + Intronic
1094344905 12:29456924-29456946 GGATGAACACAAATGTATTTAGG + Intronic
1094482007 12:30891385-30891407 GGATGAAGCCAACTTGATCATGG + Intergenic
1094758237 12:33496721-33496743 GGATGAAGCCAACTTGATCGTGG - Intergenic
1094760289 12:33524520-33524542 GGATGAAGCCAACTTGATCGTGG - Intergenic
1094788572 12:33881533-33881555 GGATAAAGCCAACTTAATCGTGG - Intergenic
1095488882 12:42712079-42712101 GGATGAAGCCAACTTGATCATGG - Intergenic
1095813646 12:46397994-46398016 GGATGAAGCCAACTTGATCGTGG - Intergenic
1095845594 12:46740774-46740796 GGATGAAGACAACTTGATCTTGG - Intergenic
1095913604 12:47454143-47454165 GGATGAAGCCAACTTGATCATGG + Intergenic
1096029566 12:48400590-48400612 GGATGAAGCCAACTTGATCGTGG + Intergenic
1096044331 12:48549219-48549241 GGATGAAGCCAACTTGATCGTGG + Intergenic
1096051309 12:48611318-48611340 GGATGAAGCCAACTTGATCATGG + Intergenic
1096957593 12:55542469-55542491 GGATGAAGCCAACTTGATCGTGG + Intergenic
1096963244 12:55601856-55601878 GGATGAAGACTACTTGATCATGG - Intergenic
1097150182 12:56972087-56972109 GGATGAAACCAACTTGATCATGG - Intergenic
1097293026 12:57935607-57935629 GGATGAATACAATATAATTTTGG - Intergenic
1097418843 12:59348719-59348741 GGATGAAGCCAACTTGATCATGG + Intergenic
1097499406 12:60383308-60383330 GGATGAAGCCAACTTGATCATGG + Intergenic
1097598201 12:61660666-61660688 GGATGAAGCCAACTTGATCGTGG + Intergenic
1097642682 12:62201579-62201601 GGATGAAGACAACTTGATCATGG + Intronic
1097656249 12:62366891-62366913 GGATGAAGCCGACTTAATCATGG + Intronic
1098047322 12:66413748-66413770 GGATGAAGCCAACTTGATCGTGG - Intronic
1098054415 12:66489275-66489297 GGATGAAGCCAACTTGATCATGG - Intronic
1098120194 12:67228436-67228458 GGATGAAGCCAACTTGATCGTGG + Intergenic
1098426746 12:70372892-70372914 GGATGAACAGAGTTTCATCTTGG + Intronic
1098583000 12:72123175-72123197 GAATGAACTGAATTTAATCTCGG + Intronic
1098667667 12:73184024-73184046 GGATGAAGCCAACTTGATCATGG + Intergenic
1098694980 12:73540984-73541006 GGATGAAGCCAACTTGATCGTGG - Intergenic
1098764610 12:74470086-74470108 GGATGAAGCCAACTTGATCGTGG - Intergenic
1098839648 12:75463461-75463483 GGATGAAGTCAACTTGATCATGG + Intergenic
1098852827 12:75617846-75617868 GGATGAAGCCAACTTGATCGTGG - Intergenic
1098927085 12:76362332-76362354 GGATGAAACCGACTTGATCTTGG - Intronic
1099319814 12:81131968-81131990 GGATGAAGCCAACTTGATCATGG + Intronic
1099409944 12:82312823-82312845 GGATGAAGCCAACTTGATCGTGG + Intronic
1099486826 12:83239231-83239253 GGATGAAGCCAACTTGATCACGG + Intergenic
1099550703 12:84040109-84040131 GGATGAAGCCAACTTGATCATGG + Intergenic
1099667417 12:85650017-85650039 GGATGAAGTCTACTTAATCATGG + Intergenic
1099730298 12:86491445-86491467 GGATGAAGCCCACTTGATCTTGG - Intronic
1099740708 12:86630552-86630574 GGATGAAACCAACTTGATCTTGG - Intronic
1099744624 12:86686676-86686698 GGATGAAGTCAACTTGATCATGG + Intronic
1099779461 12:87175227-87175249 GGATGAAACCAACTTGATCATGG - Intergenic
1099839412 12:87946985-87947007 GTATGAAGCCAACTTGATCTGGG - Intergenic
1099881800 12:88476038-88476060 GGATGAAGCCAACTTGATCATGG - Intergenic
1099965865 12:89444405-89444427 GGATGAAGCCAACTTGATCGTGG - Intronic
1100381691 12:94068056-94068078 GGATGAAGCCAACTTGATCATGG - Intergenic
1100389152 12:94132277-94132299 GGATGAAGCCAACTTGATCGTGG + Intergenic
1100766292 12:97869348-97869370 GGATGAAGCCAACTTGATCGTGG - Intergenic
1100896618 12:99189493-99189515 GGATGAAGCCAACTTGATCGTGG - Intronic
1101075524 12:101125734-101125756 GGATGAAGCCAACTTGATCATGG + Intronic
1101088800 12:101263442-101263464 GGATGAAGCCAACTTGATCATGG + Intergenic
1101182895 12:102239049-102239071 GGATGAAGCCAACTTGATCTTGG - Intergenic
1101378953 12:104196296-104196318 GGATGAATACCACTTAATCATGG + Intergenic
1101487599 12:105181301-105181323 GGATGAAGCCAACTTGATCATGG + Intronic
1101596203 12:106167239-106167261 GGATGAAGCCAACTTGATCATGG - Intergenic
1102323845 12:111961474-111961496 GGATGAAGCCAACTTGATCATGG - Intronic
1102440025 12:112955661-112955683 GGATGAAGCCAACTTGATCAGGG + Intronic
1102628885 12:114259240-114259262 GGATGAACACAGCTTGGTCAAGG + Intergenic
1102642045 12:114375423-114375445 GGATGAACTCAACTCAATAGTGG + Intronic
1103032223 12:117625544-117625566 GGATGAAGCCGACTTAATCGTGG + Intronic
1103203284 12:119107151-119107173 GGATGAAGCCAACTTGATCATGG + Intronic
1104086625 12:125480909-125480931 GGATGAAGCCCACTTGATCTTGG - Intronic
1104175032 12:126323008-126323030 GGATGAAGCCAACTTGATCTTGG + Intergenic
1105201708 13:18185976-18185998 GGATGAAGCCAACTTGATCTTGG - Intergenic
1105665396 13:22550346-22550368 GGATGAAAGAAAATTAATCTGGG - Intergenic
1105735011 13:23258888-23258910 GGATGAAACCAACTAGATCTTGG + Intronic
1105905803 13:24808986-24809008 GGATGAAGCCCACTTAATCATGG + Intronic
1105926063 13:25009617-25009639 GGATGAAGCCAACTTGATCATGG + Intergenic
1106163853 13:27224560-27224582 GGATGTAAAGAAATTAATCTAGG - Intergenic
1106387883 13:29305937-29305959 GGATGAAGCCAACTTGATCATGG - Intronic
1106608487 13:31254325-31254347 GGATGAAGCCAACTTGATCGTGG - Intronic
1106645991 13:31634760-31634782 GGATGAAGCCAACTTGATCGTGG + Intergenic
1106737645 13:32604416-32604438 GGATGAAGCCAACTTGATCATGG + Intronic
1106889877 13:34233543-34233565 GGATGAAGTCAACTTGATCGTGG + Intergenic
1106967208 13:35085383-35085405 GGATGAAGCCAACTTGATCGTGG - Intronic
1106990741 13:35416577-35416599 GGATGAAGCCAACTTGATCGTGG + Intronic
1107169170 13:37319076-37319098 GAATAAACACTACTTAATCATGG - Intergenic
1107370683 13:39743903-39743925 GGATGAAGCCAATTTGATCTTGG - Intronic
1107380368 13:39850610-39850632 GGATGAAGCCAACTTGATCATGG + Intergenic
1107487150 13:40839519-40839541 GGATGAAGCCAACTTGATCTTGG - Intergenic
1107519241 13:41162872-41162894 GCATGAAGACAATTAAATCTCGG - Intergenic
1107567430 13:41619811-41619833 GGATGAAGCCAACTTGATCTTGG + Intronic
1107592306 13:41921086-41921108 GGATGAAACCAACTTGATCATGG - Intronic
1107592909 13:41926955-41926977 GGATGATCACAGATTAATGTAGG - Intronic
1107642956 13:42462993-42463015 GGATGAAGCCAACTTGATCATGG - Intergenic
1107647189 13:42506747-42506769 GGATGAAGCCAACTTGATCGTGG + Intergenic
1107673713 13:42773310-42773332 GGATGAAGCCAACTTGATCGTGG + Intergenic
1107988118 13:45793399-45793421 GGATGAACACAACTTAATCTGGG - Intronic
1108173623 13:47769832-47769854 GGATGAATCCAACTTGATCATGG + Intergenic
1108265235 13:48700319-48700341 GGATGAAGCCAACTTGATCGTGG - Intronic
1108308215 13:49159959-49159981 GGATGAAGCCAACTTGATCATGG + Intronic
1108309694 13:49176039-49176061 GGATGAAGCCAACTTGATCATGG + Intronic
1108471416 13:50770613-50770635 GGATGAAGCCAACTTGATCGTGG + Intronic
1108501630 13:51075168-51075190 GGATGAAGCCAACTTGATCGTGG + Intergenic
1108765140 13:53619534-53619556 GGATGAAGCCCACTTGATCTTGG + Intergenic
1108810933 13:54222682-54222704 GGATGAAGCCAACTTGATCGTGG - Intergenic
1108815304 13:54283667-54283689 GGATGAAGCCAACTTGATCATGG + Intergenic
1108849967 13:54716399-54716421 GGATGAAGCCTACTTGATCTTGG + Intergenic
1108865838 13:54921522-54921544 GGATGAAGCCAACTTGATCATGG - Intergenic
1108882233 13:55134242-55134264 GGATGAAACCAACTTGATCATGG + Intergenic
1108959040 13:56199440-56199462 GTATGTACACAATTTAATCCTGG + Intergenic
1108976878 13:56455759-56455781 GGATGAAGCCAACTTGATCGTGG + Intergenic
1108989111 13:56632570-56632592 GGATGAAGCCATCTTGATCTTGG - Intergenic
1109020452 13:57084143-57084165 GGATGAAGCCCACTTGATCTTGG + Intergenic
1109087993 13:58000772-58000794 GGATGAAGCCGACTTAATCGTGG + Intergenic
1109170993 13:59096851-59096873 GGTTGTATACAACTTAATCAAGG + Intergenic
1109615763 13:64831819-64831841 GGATGAAGCCAACTTGATCGTGG - Intergenic
1109669774 13:65588973-65588995 GGATGAAGCCAACTTGATCATGG - Intergenic
1109713958 13:66196095-66196117 GGATGAATCCCACTTGATCTAGG + Intergenic
1109938782 13:69331033-69331055 GGAATAATACAACATAATCTTGG + Intergenic
1110390081 13:74963237-74963259 GGATGAAGCCGACTTAATCGTGG - Intergenic
1110606612 13:77440164-77440186 GGATGAAGCCAACTTGATCTTGG + Intergenic
1110728891 13:78857251-78857273 AGATGAAGCCAACTTAATCATGG + Intergenic
1110768119 13:79303710-79303732 GGATGAAGCCAACTTGATCATGG - Intergenic
1110818879 13:79890885-79890907 GGATGAAGCCAACTTGATCGTGG - Intergenic
1110824245 13:79954124-79954146 GGATGAAGCCAACTTGATCGTGG - Intergenic
1110876850 13:80520629-80520651 GGATGAAACCAACTTGATCTTGG - Intergenic
1110878472 13:80540272-80540294 GAATGAAGACAACTTGATCACGG + Intergenic
1110983858 13:81938893-81938915 GGATGAAGCCAACTTAATTGTGG + Intergenic
1111092544 13:83465614-83465636 GGATGAAGCCAACTTGATCGTGG - Intergenic
1111374835 13:87365075-87365097 GGATGAAGCCAACTTGATCGTGG + Intergenic
1112102550 13:96205626-96205648 GGATGAAGCCAACTTGATCGTGG - Intronic
1112152281 13:96776991-96777013 GGATGAAGCCAACTTAATCGTGG - Intronic
1112232562 13:97604059-97604081 GGATGAAGCCAGCTTGATCTTGG - Intergenic
1112363166 13:98735138-98735160 GGATGAAGCCAACTTGATCATGG - Intronic
1112962643 13:105145587-105145609 TAATGAACACAGCTTGATCTAGG + Intergenic
1113131318 13:107040400-107040422 GGATGAAGCCAACTTGATCGTGG + Intergenic
1114004276 14:18295170-18295192 GGATGAAGCCAACTTGATCATGG + Intergenic
1114432563 14:22674388-22674410 GGATGAAGCCAACTTGATCATGG + Intergenic
1114677134 14:24449905-24449927 GGATGAAGCCAACTTGATCGTGG + Intergenic
1114688785 14:24560904-24560926 GGATGAAGCCAACTTGATCATGG - Intergenic
1114710377 14:24771658-24771680 GGATGAACCCAACTTGATCATGG - Intergenic
1114971352 14:28033355-28033377 GGATGAAGCCAACTTGATCGTGG + Intergenic
1115281115 14:31664576-31664598 GGATGAAGCCAACTTGATCGTGG + Intronic
1115294326 14:31808958-31808980 GGATGAATCCAACTTGATCATGG + Intronic
1115340621 14:32290099-32290121 GGATGAAGACTACTTGATCATGG + Intergenic
1115362626 14:32520990-32521012 GGATGAAGCCAACTTGATCTTGG - Intronic
1115456602 14:33611395-33611417 GGATGACAACATCTGAATCTTGG + Intronic
1115461236 14:33663407-33663429 GGATGAAGCCAACTTGATCTTGG + Intronic
1115717407 14:36121525-36121547 GGATGAAGCCAACTTGATCATGG + Intergenic
1115723512 14:36188333-36188355 GGATGAAGCCAACTTGATCATGG - Intergenic
1115728986 14:36247586-36247608 GGATGAAGCCAACTTGATCATGG - Intergenic
1115743819 14:36415493-36415515 GGATGAAGCCAACTTGATCATGG - Intergenic
1115832708 14:37360161-37360183 GGATGAAGCCGACTTGATCTTGG + Intronic
1116009074 14:39329810-39329832 GGATGAAGCCAACTTGATCGTGG + Intronic
1116074084 14:40087917-40087939 GGATGAAGCCAACTTGATCATGG + Intergenic
1116112859 14:40609004-40609026 GGATGAAGCCAACTTGATCGTGG + Intergenic
1116177769 14:41494897-41494919 GGATGAAGCCAACATGATCTTGG - Intergenic
1116273021 14:42796603-42796625 GGATGAAGCCAACTTGATCGTGG + Intergenic
1116552887 14:46265052-46265074 GGATGAAGCCAACTTGATCGTGG - Intergenic
1116744224 14:48796266-48796288 GGATGAAGCCAACTTGATCATGG - Intergenic
1117170394 14:53088470-53088492 GGATGAAGCCAACTTGATCTTGG - Intronic
1117238334 14:53801977-53801999 GGATGAAGCCAACTTGATCATGG - Intergenic
1117446764 14:55810886-55810908 GGATGAAGCCAACTTGATCATGG + Intergenic
1117489514 14:56232409-56232431 GGATGAAGCCAACTTGATCATGG - Intronic
1117511702 14:56458205-56458227 GGATGAAGCCAACTTGATCATGG - Intergenic
1117641386 14:57803104-57803126 GGATGAAGACAACTTGATCATGG - Intronic
1117718906 14:58608856-58608878 GCATGAACACAGATTGATCTGGG - Intergenic
1117857286 14:60048933-60048955 GGATGAAGCCAACTTGATCATGG - Intronic
1117932047 14:60853887-60853909 GGATGAAGCCAACTTGATCATGG + Intronic
1118143295 14:63108694-63108716 GGATGAAGCCAACTTGATCATGG + Intergenic
1118531037 14:66705465-66705487 GGATGAAGCCAACTTAATAATGG - Intronic
1118829628 14:69418306-69418328 GGATGAAGTCAACTTGGTCTTGG + Intronic
1119016902 14:71066950-71066972 GGATGAAGCCAACTTGATCATGG + Intronic
1120675401 14:87415886-87415908 GGATGAAGCCCACTTAATCATGG + Intergenic
1120725110 14:87930126-87930148 GGATGAAGCCAACTTGATCGTGG - Intronic
1120742593 14:88124546-88124568 GGATGAAGCCAACTTGATCGTGG + Intergenic
1120773593 14:88408949-88408971 GGATGAAGCCAACTTGATCGTGG + Intronic
1120799525 14:88673186-88673208 GGATGAAGACAGCTTGATCGTGG - Intronic
1121143249 14:91560387-91560409 GGATGAAGCCAACTTGATCGTGG - Intergenic
1121143639 14:91564458-91564480 GGATGAAGCCAACTTGATCGTGG + Intergenic
1121213672 14:92229777-92229799 GGATGAAGCCAACTTGATCGTGG + Intergenic
1121581778 14:95037293-95037315 GGCTGAACACCAGTTAATCTGGG + Intergenic
1123576273 15:21672834-21672856 GGATGAAGCCAACTTGATCATGG + Intergenic
1123612896 15:22115302-22115324 GGATGAAGCCAACTTGATCATGG + Intergenic
1123822708 15:24046982-24047004 GGATGAAGCCCACTTTATCTTGG - Intergenic
1123949727 15:25259405-25259427 GGATGAAGCCAACTTGATCGTGG - Intergenic
1124791045 15:32727294-32727316 GGATGAAGCCAACTTGATCATGG - Intronic
1125098311 15:35880034-35880056 GGATGAAGCCAACTTGATCATGG - Intergenic
1125216307 15:37279516-37279538 GGATGAAGCCAACTTGATCATGG + Intergenic
1125331248 15:38584508-38584530 GGATGAAGCCAACTTCATCATGG - Intergenic
1125362854 15:38882332-38882354 GGATGAGCTCAACTTGATCATGG + Intergenic
1125779165 15:42248624-42248646 GGATGAAGCCAACTTGATCTTGG + Intronic
1125837707 15:42767912-42767934 GGATGAAGCCAACTTAATCGTGG - Intronic
1126071589 15:44869926-44869948 GGATGAAGCCAACTTGATCATGG - Intergenic
1126278112 15:46908850-46908872 GGATGAAGCCAACTTGATCATGG + Intergenic
1126307747 15:47279868-47279890 GGATGAAGACCACTTGATCATGG + Intronic
1126476672 15:49072355-49072377 GGATGAAGCCAACTTGATCTTGG - Intergenic
1126505806 15:49403120-49403142 GGATGAAACCAACTTGATCATGG + Intronic
1126554430 15:49969922-49969944 GGATGAAGCCAACTTGATCGTGG - Intronic
1126853854 15:52818381-52818403 GGATGAAGCCAACTTGATCTTGG + Intergenic
1126864236 15:52920229-52920251 GGATAAAGACAACATAACCTGGG + Intergenic
1126951802 15:53889894-53889916 GGATGAAGCCAACTTGATCGTGG + Intergenic
1127038587 15:54947865-54947887 GGATGAAGCCAACTTGATCTTGG - Intergenic
1127075917 15:55325399-55325421 GGTAGAGCACAATTTAATCTTGG - Intronic
1127168065 15:56268666-56268688 GGATGAAGCCAACTTGATCTCGG + Intronic
1127207624 15:56736803-56736825 GGATGAACACAAAGTAATTGTGG - Intronic
1127358914 15:58227868-58227890 GGAGGAACCCGACTTAATTTAGG + Intronic
1127491429 15:59468050-59468072 GGATGAAGCCAACTTGATCTTGG + Intronic
1127580375 15:60333504-60333526 GGTTGAAGCCAACTTAATCGTGG - Intergenic
1127844717 15:62859335-62859357 GGATGAAGCCAACTTGATCGTGG - Intergenic
1128696931 15:69772857-69772879 GGATGAAGCCAACTTGATCGTGG - Intergenic
1129369804 15:75084219-75084241 GGATGAAGCCAACTTGATCGTGG + Intronic
1130200549 15:81822354-81822376 GGATGAAGCCAACTTGATCGTGG - Intergenic
1130432692 15:83864413-83864435 GGATGAAGCCAACTTGATCATGG - Intronic
1130678089 15:85972143-85972165 GGATGAAGCCAACTTAATCGTGG + Intergenic
1131414249 15:92238915-92238937 GGATGAAACCAACTTGATCATGG - Intergenic
1131478095 15:92758412-92758434 GGATGAAGCCAACTTGATCATGG - Intronic
1131579596 15:93629456-93629478 GGATGAAGCCCACTTAATCATGG + Intergenic
1132417225 15:101630112-101630134 GGATGAAGCCCACTTGATCTTGG - Intronic
1132445758 15:101916734-101916756 GGATGAAGCCCACTTGATCTTGG + Intergenic
1202985141 15_KI270727v1_random:407079-407101 GGATGAAGCCAACTTGATCATGG + Intergenic
1134650002 16:15900913-15900935 GGAAGAAAAGAACTAAATCTTGG - Intergenic
1135375456 16:21943330-21943352 GGATGAAGCCAACTTGATCATGG + Intergenic
1135496258 16:22954105-22954127 AGATGAACACAACCTCATGTTGG + Intergenic
1135896598 16:26410854-26410876 GGATGAAACCAACTTGATCGTGG + Intergenic
1135897659 16:26423037-26423059 GGATGAACCCAACCTGATCGTGG - Intergenic
1136659513 16:31744465-31744487 GGATGAATCCAACTTGATCGTGG + Intronic
1136855434 16:33652500-33652522 GGATGAAGCCAACTTGATCGTGG - Intergenic
1137064663 16:35827647-35827669 GGATGAACCCTACTTGATCATGG + Intergenic
1137233245 16:46588971-46588993 GGATGAAGCCAACTTGATCATGG - Intronic
1137370480 16:47900914-47900936 GGATGAAGCCAACTTGATCGTGG - Intergenic
1137681208 16:50347060-50347082 GGATGAAGCCAACTTGATCGTGG - Intronic
1138151991 16:54666821-54666843 GGATGAAGCCAACTTGATCGTGG - Intergenic
1138875101 16:60939705-60939727 GGATGAAGCCAACTTGATCATGG - Intergenic
1140669050 16:77256661-77256683 GGATGAAGCCAACTTGATCATGG + Intronic
1140695485 16:77528764-77528786 GGATGAAGCCAACTTGATCATGG - Intergenic
1141119714 16:81343417-81343439 GGATGAAGCCAACTTGATCGTGG - Intronic
1203117020 16_KI270728v1_random:1500981-1501003 GGATGAAGCCAACTTGATCGTGG - Intergenic
1142911927 17:3101322-3101344 GGATGAAGCCAACTTAATCGTGG - Intergenic
1142936660 17:3339615-3339637 GGATGAAGCCAACTTGATCTTGG + Intergenic
1144012834 17:11166252-11166274 GGATGAAACCAACTTGATCATGG - Intergenic
1144155902 17:12502118-12502140 GGATGAAAACCACTTTATCATGG - Intergenic
1144414274 17:15031637-15031659 GGATGAACAAGACCTAATTTAGG + Intergenic
1144511785 17:15883167-15883189 GTATAAACTAAACTTAATCTTGG + Intergenic
1145726477 17:27130819-27130841 GGATGAAGCCCACTTAATCATGG + Intergenic
1145738675 17:27252993-27253015 GGATGAAGCCAACTTGATCTTGG - Intergenic
1146103926 17:30013143-30013165 GGATGAAGCCAACTTGATCTTGG + Intronic
1146237433 17:31180394-31180416 GGATGAAGCCAACTTGATCATGG - Intronic
1146416938 17:32643264-32643286 GGATGAAGACAACTTGATCATGG + Intronic
1146462928 17:33061503-33061525 GGATGAAGACAACTTGATCATGG + Intronic
1147704096 17:42414194-42414216 GAATGAAAACAGATTAATCTGGG - Intronic
1148952923 17:51330254-51330276 GGATGAAGCCAACTTGATCATGG - Intergenic
1149063972 17:52458399-52458421 GGATGAAGCCAACTTGATCTTGG - Intergenic
1149377546 17:56060772-56060794 GGATGAAGCCAACTTGATCGTGG + Intergenic
1149901617 17:60485047-60485069 GGATGAAGCCAACTTGATCTTGG + Intronic
1149931726 17:60763537-60763559 GGATGAAGCCAACTTGATCTTGG + Intronic
1151083387 17:71354288-71354310 GGATGAAGCCTACTTAATCATGG + Intergenic
1151108420 17:71646578-71646600 GGATGAAGCCAACTTGATCATGG - Intergenic
1153090674 18:1338999-1339021 GGATGAAGCCAACTTGATCATGG - Intergenic
1153114928 18:1643524-1643546 GGATGAAGCCAACTTGATCATGG + Intergenic
1153402185 18:4693143-4693165 GTATGAAACCCACTTAATCTTGG - Intergenic
1153664509 18:7356852-7356874 GGATCAATGCAACTAAATCTAGG - Intergenic
1153827222 18:8886407-8886429 GGATGAAGCCAACTTGATCATGG + Intergenic
1153974416 18:10255000-10255022 GGATGAAGCCAACTTGATCGTGG + Intergenic
1154101191 18:11475777-11475799 GGATGAAGCCAACTTGATCGTGG + Intergenic
1154184379 18:12169473-12169495 GGATGAAGCCAACTTGATCTTGG + Intergenic
1154288241 18:13080979-13081001 GGATGAAGCCAACTTGATCATGG + Intronic
1154320966 18:13351913-13351935 GGATGAAGCCAACTTGATCATGG - Intronic
1154405581 18:14087038-14087060 GGATGAATTCTACTTGATCTTGG - Intronic
1154459213 18:14562901-14562923 GGATGAAGCCAACTTGATCATGG + Intergenic
1154956307 18:21259155-21259177 GGTTAAACAAACCTTAATCTAGG - Intronic
1155409449 18:25526358-25526380 GGATGAAGCCAACTTGATCGTGG + Intergenic
1155476544 18:26240926-26240948 GGATGAAGCCAACTTGATCATGG + Intronic
1155658878 18:28224307-28224329 GGATGAAGTCAACTTGATCATGG + Intergenic
1156434780 18:37115314-37115336 GGATGAAGCCAACTTGATCATGG - Intronic
1156443435 18:37215489-37215511 GGATGAAGCCAACTTGATCGTGG + Intronic
1156516828 18:37687280-37687302 GGATGAAGATGACTTTATCTGGG + Intergenic
1156799256 18:41088928-41088950 GGATGAAGCCAACTTGATCATGG - Intergenic
1156979000 18:43262902-43262924 GGATGAAGCCAACTTGATCATGG + Intergenic
1157045017 18:44091975-44091997 GGATGAAATCTACTTAGTCTTGG + Intergenic
1157123093 18:44930277-44930299 GGATGAAGCCAACTTGATCGTGG + Intronic
1157695393 18:49718725-49718747 GGATGAAGCCCACTTAATCATGG - Intergenic
1157764856 18:50288178-50288200 GAATGAATACAACTTGATCCAGG - Intronic
1157945714 18:51978180-51978202 AGATGAACACAACCTCAACTAGG + Intergenic
1158226345 18:55205465-55205487 GGATGAACAGAAAGAAATCTGGG - Intergenic
1158692562 18:59673783-59673805 GGATGAAGCCAACTTGATCGTGG + Intronic
1159174969 18:64820772-64820794 GGATGAAGACAACTTGGTCATGG + Intergenic
1159569276 18:70093643-70093665 GGATGAAGCCAACTTGATCATGG + Intronic
1159581673 18:70240250-70240272 GGATGAAGTCAACTTGATCACGG - Intergenic
1159811211 18:73020188-73020210 GGATGAAGCCAACTTGATCGTGG - Intergenic
1159979037 18:74753695-74753717 GGATGAAGCCAACTTGATCGTGG + Intronic
1160296341 18:77640911-77640933 GGATGAAGCCCACTTGATCTTGG - Intergenic
1160312894 18:77812485-77812507 GAATGGACACAAATGAATCTTGG + Intergenic
1160639551 19:116970-116992 GGATGAAGCCCACTTGATCTTGG - Intergenic
1162628833 19:11909468-11909490 GGATGAAGCCAACTTGATCGTGG - Intronic
1163858230 19:19723423-19723445 GGATGAAGCCAACTTGATCATGG + Intronic
1163976251 19:20855844-20855866 GGATGAAGCCAACTTGATCATGG - Intronic
1164113073 19:22188162-22188184 GGATGAAGCCAACTTGATCTTGG - Intronic
1164152031 19:22562697-22562719 GGATGAAGCCAACTTGATCGTGG + Intergenic
1164197350 19:22981678-22981700 GGATGAAGCCAACTTGATCGTGG - Intronic
1164395134 19:27856462-27856484 GGATGAAATCAACTTCATCTTGG - Intergenic
1164497888 19:28785194-28785216 GGTTTTACACTACTTAATCTTGG + Intergenic
1164555977 19:29251968-29251990 GGATGAAGCCAACTTGATCGTGG + Intergenic
1164688983 19:30193618-30193640 GGATGAAGCCAACTTGATCATGG - Intergenic
1165126637 19:33602623-33602645 GGATGATCACAGCTTAACGTGGG + Intergenic
1165265406 19:34658939-34658961 GGATGAAGCCAACTTGATCATGG - Intronic
1165270941 19:34707095-34707117 GGATGAAGCCAACTTGATCATGG - Intergenic
1165677625 19:37741480-37741502 GGATGAAGCCAACTTGATCACGG - Intronic
1165967429 19:39594639-39594661 GGATGAAGCCCACTTGATCTTGG + Intergenic
1165971516 19:39635286-39635308 GGATGAAGCCAACTTGATCTTGG + Intergenic
1166172299 19:41037887-41037909 GGATGAAGCCAAATTGATCTTGG - Intergenic
1166616368 19:44251551-44251573 GGATGAAGCCAACTTGATCATGG - Intronic
1167400888 19:49268179-49268201 GGATGAATCCCACTTAATCATGG + Intergenic
1167834323 19:52054756-52054778 GGATGACACCAACTTGATCTTGG - Intronic
924968088 2:97040-97062 GGATGAAGCCAACTTGATCATGG - Intergenic
925053708 2:838388-838410 GGATGAAGCCAACTTGATCGTGG - Intergenic
925117462 2:1392345-1392367 GGATGAAGCCAACCTAATCATGG + Intronic
925566530 2:5260436-5260458 GGATGAAGCCAACTTGATCGTGG - Intergenic
925672839 2:6329826-6329848 GGATGAAACCAACTTGATCTTGG + Intergenic
925855934 2:8129594-8129616 GGATGAAGCCCACTTAATCATGG - Intergenic
926650948 2:15344812-15344834 GGATGAAGCCAACTTGATCGTGG - Intronic
927046109 2:19280260-19280282 GGATGAAGCCAACTTGATCGGGG + Intergenic
927117595 2:19920380-19920402 GGATGAAGCCAACTTGATCATGG - Intronic
927221561 2:20715180-20715202 GGATGAAGCCAACTTGATCGTGG - Intronic
927417754 2:22896583-22896605 GGATAAACATAATTTAAGCTAGG - Intergenic
927557753 2:24047994-24048016 GGATGCAGACAACCTCATCTGGG + Intronic
927564431 2:24098932-24098954 GGATGAAGCCAACTTGATCATGG - Intronic
928269457 2:29843130-29843152 CCATGAACACAACCTAATATTGG - Intronic
928354510 2:30597982-30598004 GGATGAAGCCAACTTGATCATGG + Intronic
928475842 2:31626697-31626719 GGATGAAGCCAACTTGATCGTGG + Intergenic
928754595 2:34509040-34509062 GGATGAAGCCAACTTGATCATGG - Intergenic
928900394 2:36311634-36311656 GGATGAAGATGACTTGATCTTGG - Intergenic
929062554 2:37938236-37938258 GGATGAAGGCAACTTGATCATGG + Intronic
929838375 2:45429444-45429466 AGATGAAGCCAACTTGATCTCGG - Intronic
929958022 2:46474388-46474410 GGATGAAGCCAACTTGATCGTGG + Intronic
930143496 2:47977503-47977525 GGATGAAGCCAACTTGATCGTGG - Intergenic
930175666 2:48299030-48299052 GGATGAAGCCAACTTGATCGTGG + Intergenic
930424004 2:51190557-51190579 GGATGAAGCCAACTTGATCGTGG + Intergenic
930863212 2:56096343-56096365 GGATGAAGCCAACTTGATCATGG - Intergenic
930961993 2:57273192-57273214 GGATGAAGCCAACTTGATCATGG + Intergenic
931112371 2:59125187-59125209 GGTTGAAGCCAACTTGATCTTGG + Intergenic
931306934 2:61038405-61038427 GGATGAAGCCAACTTGATCATGG - Intronic
931546244 2:63391191-63391213 GGATGAAGCCAACTTGATCGTGG - Intronic
932523088 2:72434245-72434267 GGATGAACCCAACTTGATCATGG + Intronic
932830747 2:74987253-74987275 GGATGAAGCCAACTTGATCGTGG - Intergenic
932868380 2:75371227-75371249 GGATGAAGCCAACTTGATCGTGG + Intergenic
933268947 2:80212559-80212581 GGATGAAGCCAACTTGATCGTGG + Intronic
933305820 2:80597048-80597070 GGATGAACTCAACTTGATCATGG + Intronic
933366381 2:81359307-81359329 GGATGAAGCCAACTTGATCGTGG + Intergenic
933606070 2:84385300-84385322 GGATGAATCCAACTTGATCATGG + Intergenic
933880762 2:86667496-86667518 GGATGAAGCCAACTTGATCGTGG - Intronic
934162134 2:89259680-89259702 GGATGAAGCCAACTTCATCGTGG - Intergenic
934205147 2:89922678-89922700 GGATGAAGCCAACTTCATCGTGG + Intergenic
934214356 2:90016309-90016331 GGATGAAGCCAACTTGATCATGG - Intergenic
934872154 2:97876500-97876522 GGATAAAGACAACTTGATCGTGG - Intronic
934873897 2:97895212-97895234 GGATGAAGCCAACTTGATCGTGG + Intronic
935438220 2:103060010-103060032 GGATGAAGCCAACTTGATCATGG - Intergenic
935961823 2:108433148-108433170 GGATGAAGCCAACTTGATCGTGG - Intergenic
936142977 2:109956749-109956771 GGGTGAAGCCAACTTGATCTTGG - Intergenic
936172412 2:110187816-110187838 GGATGAAGCCAACTTGATCATGG - Intronic
936179665 2:110254715-110254737 GGGTGAAGCCAACTTGATCTTGG - Intergenic
936201711 2:110414718-110414740 GGGTGAAGCCAACTTGATCTTGG + Intronic
936447932 2:112611043-112611065 GGATGAAGCCAACTTGATCATGG + Intergenic
936673869 2:114691406-114691428 GGATGAAGCCAACTTGATCATGG + Intronic
936769194 2:115891436-115891458 GGATGAAGCCAACTTGATCACGG + Intergenic
936775004 2:115962370-115962392 GGATGAAGCCAACTTGATCATGG + Intergenic
936798312 2:116234583-116234605 GGATGAAGCCAACTTGATCATGG - Intergenic
936803761 2:116299987-116300009 GGATGAATCCCACTTAATCATGG - Intergenic
936825132 2:116572780-116572802 GGATGAAGCCAACTTGATCACGG - Intergenic
936999610 2:118453641-118453663 GGATGAAGCCAACTTGATCGTGG + Intergenic
937075224 2:119099499-119099521 GGATGAAGCCAACTTGATCATGG - Intergenic
937165222 2:119807875-119807897 GGATGAAGCCGACTTGATCTTGG - Intronic
937189650 2:120082448-120082470 GGATGAAGCCCACTTGATCTTGG + Intronic
937456748 2:122048542-122048564 GGATGAAGCCAACTTGATCATGG + Intergenic
937467116 2:122143277-122143299 GGATGAAGCCAACTTGATCATGG + Intergenic
937498067 2:122446182-122446204 GGATAAACACCACTTGATCATGG + Intergenic
937605861 2:123800893-123800915 GGATGAAGCCAACTTGATCATGG + Intergenic
937679677 2:124630373-124630395 GGATGAAACCAACTTGATCGTGG - Intronic
938221502 2:129572630-129572652 GGATGAAGCCAACTTGATCGTGG - Intergenic
938799588 2:134748854-134748876 GGATGAAGCCAACTTGATCGTGG + Intergenic
938975410 2:136472476-136472498 GGATGAAGCCAACTTGATCGTGG - Intergenic
939270385 2:139931508-139931530 GGATGAAGCCAACTTGATCATGG - Intergenic
939731163 2:145786166-145786188 GGATGAAACCAACTTGGTCTTGG - Intergenic
939790376 2:146566281-146566303 GGTTTAAAACAACTTACTCTAGG + Intergenic
939876345 2:147582786-147582808 GGATGAACCCAACTTGATCATGG + Intergenic
939912729 2:148003412-148003434 GGATGAAGCCAACTTGATCATGG - Intronic
939975131 2:148708644-148708666 GGATGAAGCCAACTTGATATTGG - Intronic
940014560 2:149090018-149090040 GGATGGAGACAACCTATTCTGGG + Intronic
940222427 2:151366373-151366395 GAAGGAACACAACTCAATGTCGG - Intronic
940257545 2:151747129-151747151 GGATGAAGCCAACTTGATCGTGG - Intergenic
940463602 2:153999657-153999679 GGATGAATCCCACTTAATCGTGG + Intronic
940469331 2:154074737-154074759 GGATAAAGCCAACTTAATCAAGG - Intronic
940472574 2:154117156-154117178 AGGTGAACCAAACTTAATCTCGG - Intronic
940720421 2:157276162-157276184 GGATGAAACCAACTTGATCATGG + Intronic
940891346 2:159038692-159038714 GGATGAAGCCCACTTGATCTTGG + Intronic
940996154 2:160152248-160152270 GGATGAAGCCAACTTGATCATGG - Intronic
941076758 2:161014090-161014112 GGATGAAGCCAACTTGATCGTGG - Intergenic
941100519 2:161289978-161290000 GGATGAAGCCAACTTGATCATGG - Intergenic
941478399 2:165975635-165975657 GGATGAAGCCAACTTGATCGTGG - Intergenic
941564988 2:167095655-167095677 GGATGAAGCCAACTTAATCATGG + Intronic
941571296 2:167173955-167173977 GGATGAAGCCAACTTGATCATGG + Intronic
941767137 2:169310542-169310564 GGATGAAACCAACTTGATCATGG + Intronic
941981631 2:171464654-171464676 CAATGAACACAACTAGATCTGGG - Intronic
942065457 2:172267046-172267068 GGATGAAGCCAACTTGATCATGG + Intergenic
942392204 2:175507263-175507285 GGATGAAGCCAACTTGATCGTGG - Intergenic
943131265 2:183855870-183855892 GTATGAACCCAACTTGATCATGG - Intergenic
943140364 2:183974823-183974845 GGATGAAGCCAACTTAATCGTGG + Intergenic
943178038 2:184503418-184503440 GGATGAAGCCAACTTGATCGTGG - Intergenic
943196369 2:184756032-184756054 GTATGAACACAAGTAAATATTGG + Intronic
943234046 2:185294731-185294753 GGATGAAGCCAACTTGATCGTGG - Intergenic
943277282 2:185883372-185883394 GGATGAAGTCAACTGAATCATGG - Intergenic
943306405 2:186267919-186267941 GGATGAAGCCAACTTGATCGTGG - Intergenic
943375136 2:187067227-187067249 GGATGAAGCCTACTTAATCATGG + Intergenic
943410138 2:187536384-187536406 GGATGAAGCCAACTTAATGGTGG - Intronic
943496169 2:188623407-188623429 TAATGCACACAACTTAAGCTTGG - Intergenic
943558537 2:189433982-189434004 GGATGAAGCCAACTTGATCATGG - Intergenic
943628628 2:190225920-190225942 GGATGAAGCCAACTTGATCATGG - Intronic
943660707 2:190556127-190556149 GGATGAAGCCAACTTGATCATGG - Intergenic
943711134 2:191096419-191096441 GGATGAAGCCAACTTGATCGTGG - Intronic
943837187 2:192528294-192528316 GGATGAAGCCAACTTGATCATGG - Intergenic
943866209 2:192927509-192927531 GGATGAAGCCAACTTGATCGTGG + Intergenic
944002188 2:194852883-194852905 GGATGAAGCCAACTTGATCATGG + Intergenic
944008378 2:194940275-194940297 GGATGAAGCCAACTTGATCGTGG - Intergenic
944033550 2:195266061-195266083 GGATGAAGCCCACTTCATCTTGG + Intergenic
944167561 2:196739241-196739263 GGATGAAGCCAACTTGATCGTGG + Intronic
944292393 2:198022034-198022056 GGATGAAGCCAACTTGATCATGG - Intronic
944385444 2:199158605-199158627 GGATGAAGTCAACTTGATCATGG - Intergenic
944393254 2:199241931-199241953 GGATGAAGCCAACTTGATCTTGG + Intergenic
944520668 2:200563399-200563421 GGATGAAGCCAACTTGATCATGG + Intronic
944524742 2:200607323-200607345 GGATGAAGCCAACTTGATCGTGG + Intronic
944536962 2:200720164-200720186 GGATGAACCCTACTTGATCATGG - Intergenic
944988410 2:205205787-205205809 GGATGAAGCCAACTTGATCATGG + Intronic
945116431 2:206412400-206412422 GGATGAAGCCAACTTGATCATGG + Intergenic
945164663 2:206930175-206930197 GGATGAAGCCAACTTGATCGTGG - Intergenic
945343858 2:208689227-208689249 GGATGAAGCCAACTTGATCATGG + Intronic
945391010 2:209265171-209265193 GGATGAAGCCAACTTGATCATGG - Intergenic
945467398 2:210185137-210185159 GGATGAAGCCAACTTGATCGTGG - Intergenic
945479847 2:210332749-210332771 GGATGAAGCCAACTTGATCATGG + Intergenic
945687355 2:212987633-212987655 GAATAAACACAACTAATTCTTGG + Intergenic
946513360 2:220384558-220384580 GGATGAAGCCAACTTGATCGTGG + Intergenic
946546592 2:220750685-220750707 GGATGAAGTCAACTTGATCGTGG + Intergenic
946719398 2:222588160-222588182 GGATGAAGCCAACTTGATCATGG - Intronic
946837971 2:223791333-223791355 GGATGAAGCCAACTTGATCATGG - Intronic
947123628 2:226843610-226843632 GGATGAAGCCAACTTGATCGTGG + Intronic
947182319 2:227422136-227422158 GGACAAACACAACTGACTCTTGG - Intergenic
947301575 2:228693607-228693629 GGATGAAGCCAACTTGATCATGG + Intergenic
947681050 2:232033809-232033831 GGATGAAGCCAACTTGATCGTGG + Intronic
949056532 2:241931019-241931041 GGAGGAAAAAAAATTAATCTGGG - Intergenic
1168882603 20:1220523-1220545 GGATGAAGCCAACTTGATCATGG - Intergenic
1169042107 20:2504601-2504623 GGATGAAGACCACTTGATCATGG - Intronic
1169306762 20:4498149-4498171 GGATGAAGCCAAGTTGATCTTGG + Intergenic
1169940410 20:10931129-10931151 GGATGAACCTAACTTGATCATGG - Intergenic
1170076486 20:12425014-12425036 GGATGAACCCAACTTGATCATGG + Intergenic
1170167526 20:13377414-13377436 GAATGAACCCAACTTGATCATGG + Intergenic
1170483294 20:16790168-16790190 GGATGAAGCCAACTTGATCATGG + Intergenic
1170637963 20:18125447-18125469 GGATGAAGCCAACTTGATCGTGG - Intergenic
1170720120 20:18869767-18869789 GGATGAAGACGACTTGATCATGG + Intergenic
1170832514 20:19855222-19855244 GGATGAAGCCCACTTGATCTTGG + Intergenic
1171007620 20:21482332-21482354 GGATGAAGCCAACTTGATCATGG + Intergenic
1171050871 20:21857547-21857569 TGATGAAGCCAACTTGATCTTGG - Intergenic
1171051970 20:21867717-21867739 AGTTGAACATAAATTAATCTTGG + Intergenic
1171052087 20:21869349-21869371 AGTTGAACATAAATTAATCTTGG + Intergenic
1171246858 20:23617682-23617704 GGATGAAGCCAACTTGATCTTGG + Intergenic
1171256935 20:23696330-23696352 GGATGAAGCGAACTTGATCTTGG - Intergenic
1171273966 20:23839266-23839288 GGATGAAGCCAAGTTGATCTTGG - Intergenic
1171337595 20:24398846-24398868 GGATGAAGCCAACTTGATCTTGG + Intergenic
1171454944 20:25264078-25264100 GGATGAACCCCACTTGATCATGG - Intronic
1171934905 20:31265374-31265396 GGATGAAGCCAACTTGATCGTGG + Intergenic
1172455953 20:35073613-35073635 GGATGAAGCCAACTTGATCGTGG + Intronic
1172806431 20:37615262-37615284 GGATGAACGGGAGTTAATCTGGG - Intergenic
1173412119 20:42821211-42821233 GGATGAAGCCAACTTGATCATGG - Intronic
1173543530 20:43873476-43873498 GGATGAAGCCAACTTGATCGTGG + Intergenic
1173771456 20:45662761-45662783 GGATGAAGCCAACTTGATCATGG + Intronic
1173777118 20:45718463-45718485 GGATGAAGCCAACTTGATCATGG - Intergenic
1174694878 20:52547046-52547068 GGATGAACCCCACTTGATCATGG - Intergenic
1174925499 20:54754928-54754950 GGATGAAGCCAACTTGATCATGG - Intergenic
1174948450 20:55015031-55015053 GGGTGAACACAACTCAGTGTAGG - Intergenic
1174962639 20:55175642-55175664 CAATGTACACAACTTAATTTGGG - Intergenic
1175041300 20:56053682-56053704 GGATGAAGTCAACTTGATCGTGG - Intergenic
1176126452 20:63477489-63477511 GGAGGAACAAGATTTAATCTGGG + Intergenic
1176420773 21:6513245-6513267 GGATGAAGCCCACTTAATCATGG + Intergenic
1176716242 21:10352011-10352033 GGATGAAGCCAACTTGATCTTGG + Intergenic
1176814927 21:13590444-13590466 GGATGAAGCCAACTTGATCATGG - Intergenic
1177025454 21:15916922-15916944 GGATGAAGCCCACTTAATCATGG + Intergenic
1177028399 21:15951523-15951545 GGATGAAGCCAACTTGATCGTGG + Intergenic
1177089193 21:16745147-16745169 GGATGAATTCAACTGAATCATGG - Intergenic
1177138378 21:17331150-17331172 GGATGAAGCCCACTTGATCTTGG - Intergenic
1177341884 21:19814358-19814380 GGATGAAGCCAACTTGATCGTGG - Intergenic
1177691590 21:24517035-24517057 GGATGAAGCCAACTTGATCATGG - Intergenic
1178038080 21:28607525-28607547 GGGTGAACATAACCTAATCTTGG - Intergenic
1178057177 21:28812479-28812501 GGATGAAGCCAACTTGATCGTGG + Intergenic
1178560028 21:33630073-33630095 GGATGAACACCACTCGATCATGG + Intronic
1178739512 21:35185107-35185129 GGATGAAGCCAACTTGATCATGG + Intronic
1178913107 21:36692429-36692451 GGACGAAAACAAAATAATCTCGG - Intergenic
1179696264 21:43121564-43121586 GGATGAAGCCCACTTAATCATGG + Intergenic
1180428793 22:15225969-15225991 GGATGAAGCCAACTTGATCATGG + Intergenic
1180504596 22:15982432-15982454 GGATGAAGCCCACTTGATCTTGG + Intergenic
1180598734 22:16998981-16999003 GGATGAAGCCAACTTGATCGTGG + Intronic
1180602093 22:17027925-17027947 GGATGAAGCCAACTTGATCTTGG - Intergenic
1180640603 22:17295638-17295660 GGATGAAGCCGACTTGATCTTGG + Intergenic
1181935464 22:26435314-26435336 GGCTTAAAACAACTTAATCATGG + Intronic
1182040277 22:27233079-27233101 GGATGAAGCCAACTTGATCGTGG + Intergenic
1182152631 22:28040387-28040409 GGATGAAGACGACTTGATCGTGG - Intronic
1182178986 22:28324540-28324562 GGATGAAGACCACTTGATCATGG - Intronic
1182825882 22:33264359-33264381 GGAGGCACACAACTTAAATTAGG + Intronic
1182993622 22:34792487-34792509 GGATGAAGCCCACTTGATCTTGG - Intergenic
1203333993 22_KI270739v1_random:40142-40164 GGATGAAGCCCACTTGATCTTGG - Intergenic
949155349 3:820284-820306 GGATGAAGCCAACTTGATCATGG - Intergenic
949302616 3:2601892-2601914 GGATGAAGCCAACTTGATCTTGG - Intronic
949416515 3:3820803-3820825 GGATGAATAAAACATAACCTTGG + Intronic
949427805 3:3938205-3938227 GGATGAAGACAACTTGATCGTGG + Intronic
949476940 3:4456023-4456045 GGATAAACCCCACTTAATTTTGG - Intronic
949532436 3:4969551-4969573 GGATGAAGCCAACTTGATCATGG - Intergenic
950302635 3:11894601-11894623 GGATGAAGCCAACTTGATCGTGG + Intergenic
950383673 3:12638993-12639015 GGATGAAGCCAACTTGATCACGG + Intronic
951178835 3:19635242-19635264 GGATGAAGCCAACTTGATCGTGG + Intergenic
951191600 3:19778534-19778556 GGATGAAGCCCACTTAATCATGG - Intergenic
951238976 3:20268185-20268207 GGATGAAGCCAACTTGATCAGGG + Intergenic
951254133 3:20429461-20429483 GGATGAAGCCAACTTGATCGTGG + Intergenic
951618097 3:24570539-24570561 GGATGAAGCCGACTTGATCTTGG - Intergenic
951684825 3:25332325-25332347 GGATGAAGCCAACTTGATCGTGG - Intronic
951784253 3:26400362-26400384 GGATGAAGCCCACTTAATCATGG + Intergenic
951832542 3:26946653-26946675 GGATGAATCCAACTTGATCGTGG - Intergenic
951871856 3:27370443-27370465 GGATTAACAATACTTAAGCTTGG + Intergenic
951972035 3:28456812-28456834 GGATGAAGCCAACTTGATCATGG + Intronic
952133203 3:30388023-30388045 GGATGAAGCCAACTTAATCATGG + Intergenic
952432968 3:33243360-33243382 GGATGAACTCCACTTAGTCATGG - Intergenic
952501527 3:33967022-33967044 GGATGAAGACAACTTGATCATGG + Intergenic
953287004 3:41620416-41620438 GGATGAAGCCAACTTGATCGTGG - Intronic
953554869 3:43936777-43936799 GGATGAAGCCGACTTAATCGTGG + Intergenic
954120097 3:48492832-48492854 GGCTGAAAACAACTCCATCTTGG - Intronic
954500456 3:51008959-51008981 GGATGAAGCCAACTTGATCTTGG + Intronic
954507836 3:51094009-51094031 GGATGAAGCCAACTTGATCATGG + Intronic
954513508 3:51149681-51149703 GGATGAAGCCAACTTGATCGTGG + Intronic
954524030 3:51253204-51253226 GGATGAAGCCCACTTGATCTTGG + Intronic
954572270 3:51651586-51651608 GGATGAAGCCAACTTGATCTTGG - Intronic
954828277 3:53394935-53394957 GGATGAAGCCAACTTGATCGTGG - Intergenic
955121842 3:56067881-56067903 GGATGAAGCCAACTTGATCATGG + Intronic
955303555 3:57807631-57807653 GGATGAAGCCAACTTGATCGTGG + Intronic
955629962 3:60962770-60962792 GGATGAAGCCAACTTGATCGTGG + Intronic
955637586 3:61046792-61046814 GGATGAAGCCAACTTGATCGTGG - Intronic
955645429 3:61132416-61132438 AGATGAGCACAACATAATCTTGG + Intronic
955667502 3:61366082-61366104 GGATGAAGCCAACTTGATCATGG - Intergenic
955975884 3:64479597-64479619 GGATGAAGCCAACTTGATCATGG - Intergenic
955982726 3:64543417-64543439 GGATGAAGCCAACTTGATCATGG - Intronic
956394803 3:68813966-68813988 GGATGAAGCCAACTTGATCATGG - Intronic
956940813 3:74159305-74159327 GGATGAAGCCCACTTGATCTTGG + Intergenic
957010904 3:75005209-75005231 GGATGAAGCCAACTTGATCTTGG + Intergenic
957116347 3:76031704-76031726 GGATGAAGCCAACTCGATCTTGG + Intronic
957426438 3:80045640-80045662 GGATGAAGCCAACTTGATCTTGG - Intergenic
957475177 3:80713229-80713251 GGATGAAACCAACTTGATCATGG - Intergenic
957698577 3:83678920-83678942 GGATGAAACCAACTTGATCGTGG - Intergenic
957908224 3:86584783-86584805 GGATGAAGCCAACTTAATCATGG - Intergenic
958011565 3:87886140-87886162 GGATGAAGACAACTTGATCGTGG - Intergenic
958046893 3:88295956-88295978 GGATGAAGCCAACTTGATCATGG + Intergenic
958062104 3:88496585-88496607 GGATGAAGCCAACTTCATCATGG - Intergenic
958077077 3:88694375-88694397 GGATGAAGCCAACTTGATCATGG - Intergenic
958198864 3:90280958-90280980 GGATGAAGCCCACTTGATCTTGG + Intergenic
958422619 3:93945459-93945481 GGATGAACCCCACTTGATCATGG - Intronic
958423357 3:93953379-93953401 GGATGAAGCCAACTTGATCGGGG - Intronic
958523578 3:95223526-95223548 GGATGAAGCCAACTTGATCATGG + Intergenic
958553873 3:95648864-95648886 TGATGAAGTCAACTTGATCTTGG - Intergenic
958569768 3:95864174-95864196 GGATGAAGCCCACTTGATCTTGG - Intergenic
958625859 3:96623520-96623542 GGATGAAGCCCACTTAATCATGG + Intergenic
958972346 3:100625870-100625892 GGATGAAGCCAACTTGATCGTGG + Intronic
959339521 3:105111451-105111473 GGATGAAACCAACTTGATCATGG - Intergenic
959354627 3:105310081-105310103 GGATGAACCCAATTTGATCGTGG - Intergenic
959362210 3:105407370-105407392 GTATGAAACCCACTTAATCTTGG - Intronic
959418020 3:106100873-106100895 GGATGAAGCCAACTTGATCGTGG + Intergenic
959479749 3:106856871-106856893 GGATGAAGCCAACTTAAGCATGG - Intergenic
959617654 3:108366320-108366342 GGATGAAGCCAACTTTATCATGG + Intronic
959688485 3:109173322-109173344 GGGTAAACACAACAGAATCTTGG + Intergenic
959724168 3:109525137-109525159 GGATGAAGCCCACTTGATCTTGG - Intergenic
959736807 3:109668591-109668613 GGATGAAGCCAACTGGATCTTGG - Intergenic
959801339 3:110498830-110498852 GGATGAACCCGACTTGATCGTGG - Intergenic
959813005 3:110641498-110641520 TGATGAACTCAAACTAATCTGGG - Intergenic
960143725 3:114176212-114176234 AGATGAAGACAACTACATCTGGG + Intronic
960177647 3:114535792-114535814 GGATGAAGCCAACTTGATCGTGG - Intronic
960278534 3:115754692-115754714 GGATGAAGCCAACTTGATCATGG - Intergenic
960679755 3:120235343-120235365 GGATGAAGTCAACTTGATCGTGG + Intronic
960769006 3:121170991-121171013 GGATGAAGCCAACTTGATCATGG - Intronic
960866539 3:122206416-122206438 GGATGAATCCTACTTAATCATGG + Intronic
960911687 3:122655472-122655494 GGATGAAGCCAACTTTATCATGG - Intergenic
961984503 3:131118315-131118337 GGATGAAGCCAACTTGATCGTGG + Intronic
962073009 3:132051195-132051217 GGATGAAGACCACTTGATCATGG + Intronic
962077785 3:132102466-132102488 GGATGAAGACCACTTGATCATGG - Intronic
962239327 3:133738112-133738134 GGATGAAGCCAACTTGATCGTGG - Intergenic
962341130 3:134584518-134584540 GGATGAAGCCAACTTGATCATGG + Intergenic
962524806 3:136228079-136228101 GGATGAAGCCAACTTGATCATGG - Intergenic
962548932 3:136468786-136468808 GGATGAAGCCAACTTGATCATGG - Intronic
962833827 3:139168810-139168832 GGATGAAGCCAACTTGATCATGG + Intronic
963362855 3:144298638-144298660 GGATGAACCCCACTTGATCATGG + Intergenic
963576272 3:147064595-147064617 GGATGAAGCCAACTTGATCATGG - Intergenic
963620139 3:147596171-147596193 GGATGAAGCCAACTTGATCGTGG + Intergenic
963714079 3:148782972-148782994 GGATGAAGCCAACTTGATCGTGG + Intergenic
963976660 3:151487631-151487653 GGATGAAGCCAACTTGATCATGG - Intergenic
964214692 3:154266366-154266388 GGATGAAGCCAACTTGATCGTGG - Intergenic
964245501 3:154648004-154648026 GGATGAAGCCGACTTAATCATGG - Intergenic
964273520 3:154984514-154984536 GGATGAAGCCCACTTAATCATGG - Intergenic
964377678 3:156065545-156065567 GGATGAAGCCAACTTGATCGTGG + Intronic
964429683 3:156591981-156592003 GGATGAAGCCAACTTGATCTTGG + Intergenic
964715593 3:159718030-159718052 GGATGAAGCCCACTTAATCACGG - Intronic
964783088 3:160362670-160362692 GGATGAAGCCAACTTGATCATGG - Intronic
964905181 3:161710848-161710870 GGATGAAGCCAACTTGATCGTGG - Intergenic
964947734 3:162246471-162246493 GGATGAAGCCAACTTGATCGTGG + Intergenic
965002123 3:162967673-162967695 GGATGAAGACGACTTGATCGTGG - Intergenic
965256529 3:166420805-166420827 GGATGAAGCCAACTTGATCATGG + Intergenic
965393378 3:168132090-168132112 GGATGAAGTCATCTTGATCTTGG - Intergenic
965502982 3:169478538-169478560 GTCTGAACATAACTCAATCTTGG - Intronic
965525728 3:169716195-169716217 AGATGAAGCCAACTTGATCTTGG + Intergenic
965527254 3:169734126-169734148 GGATGAAGCCAACTTGATCTTGG - Intergenic
965573588 3:170195552-170195574 GGATGAAACCCACTTAATCATGG - Intergenic
965621583 3:170647481-170647503 GGATGAAGCCAACTTGATCATGG + Intronic
965818605 3:172662309-172662331 GGATGAAGCCAACTTGATCGTGG + Intronic
966150723 3:176865064-176865086 GGATGAAGCCAACTTGATCGTGG - Intergenic
966453761 3:180092383-180092405 GGATGAAGCCAACTTGATCATGG + Intergenic
966536696 3:181043092-181043114 GGATGAAGCCAACTTAATTATGG + Intergenic
966651997 3:182311925-182311947 GGATGAAGCCAACTTGATCATGG + Intergenic
967181136 3:186905853-186905875 GGATGAAGCCAACTTGATCTTGG + Intergenic
967713935 3:192741556-192741578 GGATGAAGCCCACTTAATCATGG + Intronic
967737467 3:192968200-192968222 GGATGAAGCCAACTTGATCTTGG + Intergenic
967757186 3:193183203-193183225 GGATGAAGCCAACTTCATCATGG - Intergenic
968217910 3:196909561-196909583 GGATGAAGCCAACTTGATCATGG - Intronic
968375564 4:37679-37701 GGATGAAGCCAACTTGATCATGG + Intergenic
968828695 4:2919173-2919195 GGATGAAGCCAACTTGATCGTGG + Intronic
969151448 4:5172650-5172672 GGATGAACCCCACTTGATCATGG + Intronic
969164469 4:5295115-5295137 GGATGAAGCCAACTTAATTGTGG + Intronic
970096141 4:12465088-12465110 GGATGAACCCCACTTGATCATGG - Intergenic
970182035 4:13408353-13408375 GGATGAAGCCAACTTGATCGTGG + Intronic
970183173 4:13420557-13420579 GGATGAAGCCGACTTGATCTTGG - Intronic
970214189 4:13741743-13741765 GGATGAAGCCAACTTGATCGTGG + Intergenic
970282525 4:14473530-14473552 GGATGAAGCCCACTTAATCATGG + Intergenic
970303835 4:14710013-14710035 AGAAGAACACAACTTAAAATGGG + Intergenic
970412438 4:15821992-15822014 GGATGAAGCCAACTTGATCATGG - Intronic
970755244 4:19418078-19418100 GGATGAAGCCAACTTGATCTTGG + Intergenic
970975356 4:22037187-22037209 GGATGAAGCCAACTTGATCGTGG + Intergenic
970983320 4:22126959-22126981 GGATGAAGCCAACTTGATCGTGG - Intergenic
971429195 4:26546146-26546168 GGATGAAGCCAACTTGATCGTGG + Intergenic
971437587 4:26644223-26644245 GGATGAAACCGACTTGATCTTGG - Intronic
971561054 4:28079995-28080017 GGATGAAGTCAACTTGATCTTGG - Intergenic
971575888 4:28274090-28274112 GGATGAAGCCAACTTGATCATGG + Intergenic
971925439 4:33003893-33003915 GGATGAAGCCGACTTAATCGTGG - Intergenic
972125750 4:35762386-35762408 GGATAAAGCCTACTTAATCTTGG - Intergenic
972317489 4:37940865-37940887 GGATGAACCCCACTTGATCATGG + Intronic
972660786 4:41114123-41114145 GGATGAAGCCAACTTGATCGTGG - Intronic
972914507 4:43859162-43859184 GGATGAAGCCAACTTGATCATGG + Intergenic
972972699 4:44596868-44596890 GGATGAAGTCAACTTGATCATGG - Intergenic
973013539 4:45107457-45107479 GGATGAATCCAACTTGATCATGG + Intergenic
973094690 4:46181778-46181800 GGATGAAGCCAACTTGATCATGG - Intergenic
973137377 4:46724808-46724830 GGATGAAGCCAACTTGATCTTGG + Intergenic
973178949 4:47244224-47244246 GGATGAAGCCAACTTGATCGTGG + Intronic
973311862 4:48718145-48718167 GAATAAACACAATTTACTCTAGG - Intronic
973341508 4:49009817-49009839 GGATGAAGCTAACTTGATCTTGG + Intronic
973714874 4:53666150-53666172 GGATGAAGCCAACTTGATCATGG + Intronic
973837840 4:54828571-54828593 GGATGAAGCCGACTTGATCTTGG - Intergenic
973873746 4:55193274-55193296 GGATGAAGCCAACTTGATCGTGG - Intergenic
973877332 4:55232965-55232987 GGATGAAGCCAACTTGATCGTGG + Intergenic
974177307 4:58340874-58340896 GGAGGAAGACAACTTGATCATGG - Intergenic
974196449 4:58581951-58581973 GGATGAAGCCAACTTGATCGTGG + Intergenic
974230764 4:59110927-59110949 GGATGAAGCCAACTTGATCATGG + Intergenic
974284407 4:59845597-59845619 AGATGAAGACAACTTGATCGTGG - Intergenic
974568330 4:63608115-63608137 AGCTGAAAACAACTTAATTTTGG - Intergenic
974605089 4:64141767-64141789 GGATGAACCCAACTTGATCATGG + Intergenic
974643752 4:64667336-64667358 GGATGAAGCCCACTTAATCATGG - Intergenic
974793355 4:66717714-66717736 GGATGAAGACAAGTTGATCATGG - Intergenic
974814293 4:66985512-66985534 GGATGAAGCCAACTTGATCACGG + Intergenic
974836276 4:67254937-67254959 GGATGAAGCCAACTTGATCATGG + Intergenic
974979583 4:68938356-68938378 GGATGAAGCCAACTTGATCATGG - Intronic
975178269 4:71312572-71312594 GGATGAAGCCAACTTGATCATGG - Intronic
975236212 4:71999844-71999866 GAATGAAGCCAACTTGATCTTGG - Intergenic
975246217 4:72123563-72123585 GGATGAAGTCAACTTGATCATGG - Intronic
975304280 4:72831124-72831146 GGATGAAGCCAACTTGATCATGG - Intergenic
975306114 4:72850568-72850590 GCATGAAGCCAACTTGATCTTGG - Intergenic
975308068 4:72871665-72871687 GGATGAAGCCAACTTGATCGTGG - Intergenic
975453756 4:74564824-74564846 GGATGAAGCCAACTTGATCATGG - Intergenic
975520340 4:75293988-75294010 GGATGAAGCCAACTTGATCGTGG + Intergenic
975524630 4:75335318-75335340 GGATGAAGCCAACTTGATCATGG - Intergenic
975529977 4:75390108-75390130 GGATGAAGACCACTTGATCATGG + Intergenic
975729520 4:77323968-77323990 GGATGAAGCCAACTTGATCATGG + Intronic
975807109 4:78124314-78124336 GGATGAAGCCAACTTGATCGTGG + Intronic
975952671 4:79792824-79792846 GGATGAAACCAACTTGATCGCGG - Intergenic
976024618 4:80672345-80672367 GGATGAAGCCAACTTGATCGTGG + Intronic
976159898 4:82187921-82187943 GGATGAAGCCAACTTGATCGTGG - Intergenic
976272429 4:83244598-83244620 GGATGAAGCCAACTTGATCGTGG - Intergenic
976330547 4:83826245-83826267 GGATGAAGCCAACTTGATCGTGG - Intergenic
976790593 4:88873939-88873961 GGATGAAGCCAACTTGATCTTGG - Intronic
976809568 4:89086448-89086470 GGATGAATCCAACTTGATCGTGG + Intronic
976969002 4:91081208-91081230 GGATGAAGCCAACTTGATCGTGG - Intronic
976976948 4:91177160-91177182 GGATGAAGCCAACTTGATCATGG + Intronic
977203533 4:94144807-94144829 GGATGAAGCCAACTTGATCGTGG + Intergenic
977204188 4:94151395-94151417 GGATGAAGCCAACTTGATCGTGG - Intergenic
977264479 4:94838100-94838122 GGATGAAGCCCACTTAATCATGG + Intronic
977462336 4:97340669-97340691 GGATGAAGCCAACTTGATCATGG - Intronic
977464357 4:97364533-97364555 GGATGAAGCCAACTTGATCATGG + Intronic
977500599 4:97832169-97832191 GGATGAAGCCAACTTGATCATGG - Intronic
977511529 4:97968586-97968608 GGATGAAGCCAACTTGATCTTGG - Intronic
977946813 4:102923212-102923234 GGATGAAGCCAACTTGATCGTGG - Intronic
978012136 4:103700700-103700722 GGATGAAGCCCACTTGATCTTGG - Intronic
978108626 4:104934259-104934281 GGATGAAGCCAACTTGATCATGG - Intergenic
978204974 4:106070482-106070504 GGATGAAGCCGACTTGATCTTGG + Intronic
978298706 4:107239913-107239935 GGATGAAACCTACTTAATCATGG - Intronic
978313609 4:107413048-107413070 GGATGAAGCCAACTTGATCATGG - Intergenic
978363919 4:107960463-107960485 GGATGAAGCCAACTTGATCATGG - Intergenic
978419566 4:108516038-108516060 GGATGAAGCCAACTTGATCATGG - Intergenic
978517466 4:109583904-109583926 GGATGAAGCCAACTTGATCGTGG + Intronic
978600342 4:110420600-110420622 GGATGAAGCCAACTTGATCTTGG - Intronic
978674305 4:111292374-111292396 GGATGAAGCCAACTTGATCCTGG - Intergenic
978929259 4:114290832-114290854 GGATGAAGCCAACTTGATTTTGG - Intergenic
978940602 4:114431848-114431870 GGATGAAGCCAACTTGATCATGG + Intergenic
978977465 4:114895841-114895863 GGATGAAGCCAACTTGATCGTGG - Intronic
979048593 4:115901298-115901320 GGATGAAGCCAACTTGATCTTGG - Intergenic
979115619 4:116818850-116818872 GGATGAAGCCAACTTGATCATGG - Intergenic
979165147 4:117519443-117519465 GGATGAAGCCAACTTGATCTTGG + Intergenic
979236609 4:118407474-118407496 GGATGAAGACCACTTGATCATGG - Intergenic
979337954 4:119485341-119485363 GGATGAAGCCAACTTGATCATGG - Intergenic
979457956 4:120947872-120947894 GGATGAAGCCAACTTGATCATGG - Intergenic
979667923 4:123332997-123333019 GGATGAAGCCAACTTGATCATGG + Intergenic
979757939 4:124365030-124365052 GGATGAAGCCAACTTGATCTTGG - Intergenic
979914787 4:126417499-126417521 GGATGAATACCACTTGATCATGG + Intergenic
979925291 4:126555502-126555524 GGATGAAGCCAACTTGATCGTGG - Intergenic
979934400 4:126673386-126673408 GGATGAAGCCAACTTGATCATGG - Intergenic
980037477 4:127901887-127901909 GGATGAAGCCAACTTGATCGTGG + Intergenic
980149743 4:129031112-129031134 GGATGAAAGCGACTTGATCTTGG - Intronic
980334680 4:131456192-131456214 GGATGAAGCCAACTTGATCATGG + Intergenic
980384827 4:132075224-132075246 GGATGAACACAAATTGATTCAGG - Intergenic
980503651 4:133687519-133687541 GGATGAAGCCAACTTGATCATGG + Intergenic
980633577 4:135470279-135470301 GGTTGAAGCCAACTTGATCTTGG + Intergenic
980769659 4:137354662-137354684 GGATGAAGCCAACTTGATCATGG - Intergenic
980859284 4:138480537-138480559 GGATGAAGCCAACTTGATCATGG + Intergenic
981068684 4:140511993-140512015 GGATGAAGCCAACTTGATCGTGG - Intergenic
981200017 4:141969492-141969514 GGATGAAGCCAACTTGATCGTGG - Intergenic
981479686 4:145225421-145225443 GGATGAAGCCAACTTGATCGTGG + Intergenic
981501941 4:145461284-145461306 GGATGAAGCCAACTTGATCGTGG - Intergenic
981560613 4:146044607-146044629 AGATGAAGCCAACTTGATCTTGG + Intergenic
981671901 4:147296268-147296290 GGATGAAGCCAACTTGGTCTTGG - Intergenic
981681583 4:147405644-147405666 GGATGAAGCCAACTTGGTCTTGG + Intergenic
981752468 4:148105677-148105699 GGATGAAGCCAACTTGATCGTGG - Intronic
981790635 4:148532786-148532808 GGATGAAGCCAACTTGATCGTGG + Intergenic
981794581 4:148581836-148581858 GGATGAAGCTAACTTGATCTTGG + Intergenic
981814651 4:148816690-148816712 GGATGAAGCCAACTTGATCATGG - Intergenic
981869738 4:149471771-149471793 GGATGAAGCCAACTTGATCGTGG - Intergenic
981903784 4:149896170-149896192 GGATGAAGCCAACTTGATCATGG - Intergenic
982674933 4:158364889-158364911 GGATGAAGCCAACTTGATCATGG + Intronic
982875070 4:160638058-160638080 GGATGAAGCCAACTTGATCATGG + Intergenic
982908869 4:161114591-161114613 GGATGAAGCCAACTTGATCGTGG + Intergenic
983103531 4:163656705-163656727 GGATGAAGGCAACTTGATCATGG - Intronic
983181360 4:164652852-164652874 GGATGAAGCCAACTTGATCATGG - Intergenic
983264324 4:165492139-165492161 TGATGACTACAACTTAATTTAGG + Intronic
983300535 4:165919667-165919689 GGATAAATACAGCTTATTCTAGG + Intronic
983328645 4:166293657-166293679 GGATAGACACAACTTGATCCAGG + Intergenic
983334300 4:166372825-166372847 GGATGAAGCCAACTTGATCTTGG + Intergenic
983362733 4:166747284-166747306 GGATGAAGCCAACTTGATCATGG - Intronic
983364320 4:166766529-166766551 GGATGAAGCCAACTTGATCGTGG + Intronic
983418610 4:167489497-167489519 GGATGAAGCCAACTTTATCATGG + Intergenic
983457590 4:167984374-167984396 GGATGAAGCCAACTTGATCATGG + Intergenic
983464307 4:168068059-168068081 GGATGAAGCCAACTTGATCTTGG - Intergenic
983594644 4:169452463-169452485 GGATGAAGCCAACTTGATCATGG - Intronic
983602263 4:169544308-169544330 GGATGAAGCCAACTTGATCATGG + Intronic
983668625 4:170210911-170210933 GGATGAAGCCAACTTGATCGTGG - Intergenic
983694090 4:170507406-170507428 GGATGAAGACCACTTGATCATGG + Intergenic
983841212 4:172459013-172459035 GGATGAAGCCGACTTAATCCTGG - Intronic
984008714 4:174344948-174344970 GGATGAAGCCAACTTGATCATGG + Intergenic
984092406 4:175390332-175390354 GGATGAAGCCAACTTGATCATGG - Intergenic
984110120 4:175602361-175602383 GGATGAAGCCAACTTTATCTTGG + Intergenic
984216147 4:176914827-176914849 GGATGAAGCCAACTTGATCGTGG - Intergenic
984217938 4:176937354-176937376 GGATGACGCCAACTTGATCTTGG + Intergenic
984403858 4:179301760-179301782 GGATGAAGCCAACTTGATCGTGG - Intergenic
984433718 4:179681987-179682009 GGATGAAGCCAACTTGATCGTGG + Intergenic
984628182 4:182032391-182032413 GGATGAAGCCAACTTGATCATGG + Intergenic
985317782 4:188676505-188676527 GGATGAAGATGACTTGATCTTGG - Intergenic
986172089 5:5323340-5323362 GGATGAAGCCAACTTGATCATGG + Intergenic
986656042 5:10013373-10013395 GGATGAAGCCAACTTGATCATGG + Intergenic
986915093 5:12609989-12610011 GGATGAAGCCAACTTGATCATGG + Intergenic
987013747 5:13795850-13795872 GGATGAAGCCAACTTGATCATGG - Intronic
987072237 5:14349511-14349533 GGAAGAGCACAGCTTAACCTTGG - Intronic
987128272 5:14835917-14835939 GGATGAAGCCAACTTGATCGTGG - Intronic
987157143 5:15100441-15100463 GGATGAAGCCAACTTGATCATGG - Intergenic
987275583 5:16358867-16358889 GGATGAAGCCAACTTGATCGTGG + Intergenic
987279395 5:16397308-16397330 GGATGAAGCCAACTTGATCATGG + Intergenic
987454028 5:18120797-18120819 GGATGAAGCCAACTTGATCATGG - Intergenic
987454231 5:18123151-18123173 GGATGAAGCCAACTTGATCATGG - Intergenic
987560720 5:19516190-19516212 GGATGAAGCTAACTTGATCTTGG + Intronic
987698029 5:21357286-21357308 GGATGAAGCCAACTTGATCTTGG - Intergenic
987796139 5:22629412-22629434 GAATGAAGCCTACTTAATCTAGG - Intronic
987838328 5:23189813-23189835 GGATGAAGCCAACTTAATCGCGG - Intergenic
987896919 5:23958605-23958627 GGATGAAGCCAACTTGATCATGG - Intronic
987920167 5:24269941-24269963 TGATGAACAAAATTTAATATTGG + Intergenic
988010360 5:25474319-25474341 GGATGAAGCCAACTTCATCATGG - Intergenic
988023375 5:25652530-25652552 GGATGAAGCCAACTTGATCTTGG + Intergenic
988110809 5:26816559-26816581 GGATGAAGCCAACTTAATCATGG - Intergenic
988116366 5:26897469-26897491 GGATGAAGCCAACTTGATCGTGG - Intronic
988187513 5:27886233-27886255 GGATGAAGCCAACTTGATCTTGG + Intergenic
988235482 5:28538036-28538058 GGATGAAGCCAACTTGATCTTGG + Intergenic
988309407 5:29538499-29538521 GGATGAAGCCAACTTGATCGTGG + Intergenic
988667287 5:33342906-33342928 GGATGAAGCCAACTTGATCGTGG - Intergenic
988667927 5:33350503-33350525 GGATGAAGCCAACTTGATCGTGG + Intergenic
988719555 5:33862843-33862865 GGATGAAGCCGACTTGATCTTGG - Intronic
988810369 5:34779023-34779045 GGATGAAGCCCACTTGATCTTGG - Intronic
989143181 5:38222247-38222269 GGATGAAGCCCACTTAATCATGG - Intergenic
989522125 5:42414654-42414676 GGATGAAGCCAACTTGATCTTGG + Intergenic
989583620 5:43056927-43056949 GGATGAAGCCAACTTGATCATGG - Intergenic
989607896 5:43262952-43262974 GGATGAAGCCAACTTGATCGTGG + Intronic
989627185 5:43441204-43441226 GGATGAAGCCAACTTGATCATGG + Intergenic
989728874 5:44623905-44623927 GGATGAAGCCCACTTAATCATGG - Intergenic
989966120 5:50467633-50467655 GGATGAAGCTAACTTGATCTTGG + Intergenic
990016371 5:51067156-51067178 GGATGAAGCCAACTTGATCATGG - Intergenic
990163793 5:52972995-52973017 GGATGAAGCCAACTTGATCGTGG + Intergenic
990229967 5:53702523-53702545 GGATGAAGCCAACTTGATCTTGG + Intergenic
990230577 5:53709020-53709042 GGATGAAGCCAACTTGATCGCGG + Intergenic
990360665 5:55015998-55016020 GGATGAAGCCCACTTAATCATGG - Intronic
990369236 5:55100315-55100337 GGATGAAGCCAACTTGATCATGG - Intergenic
990482496 5:56225133-56225155 GGATGAAGCCAACTTGATCATGG - Intronic
990721029 5:58696264-58696286 GGATGAAGCCAACTTGATCGTGG + Intronic
990945250 5:61242640-61242662 GGATGAAACCAACTTGATCATGG - Intergenic
991025370 5:62023607-62023629 GGATGAAGCCAACTTGATCGTGG + Intergenic
991046420 5:62227672-62227694 GGATGAAGCCAACTTGATCGTGG + Intergenic
991097642 5:62756177-62756199 GGATGAAGCCAACTTGATCGTGG - Intergenic
991102561 5:62809140-62809162 GGATGAAGCCAACTTGATCATGG + Intergenic
991128483 5:63094107-63094129 GGACGAAGCCAACTTGATCTTGG - Intergenic
991151823 5:63379616-63379638 GGATGAAGCCAACTTGATCATGG - Intergenic
991363953 5:65849226-65849248 GGATGAAGCCAACTTGATCGTGG + Intronic
991387856 5:66109743-66109765 GGATGAAGCCAACTTGATCTTGG - Intergenic
991532322 5:67629287-67629309 GGATGAAGCCAACTTGATCATGG + Intergenic
991576184 5:68106030-68106052 GGATGAAGCCAACTTGATCGTGG - Intergenic
991634962 5:68695368-68695390 GGATGAAGCCAACTTGATCGTGG - Intergenic
991742411 5:69695092-69695114 GGATGAAGCCAACTTGATCTTGG + Intergenic
991755283 5:69860116-69860138 GGATGAAGCCAACTTGATCTTGG - Intergenic
991793985 5:70274832-70274854 GGATGAAGCCAACTTGATCTTGG + Intergenic
991821801 5:70570395-70570417 GGATGAAGCCAACTTGATCTTGG + Intergenic
991834610 5:70735264-70735286 GGATGAAGCCAACTTGATCTTGG - Intergenic
991886362 5:71274364-71274386 GGATGAAGCCAACTTGATCTTGG + Intergenic
992288276 5:75258114-75258136 GGATGAAGCCAACTTGATCGTGG - Intergenic
992340712 5:75820445-75820467 GGATGAAGCCAACTTGATCGTGG - Intergenic
992651104 5:78861412-78861434 GGATGAAGCCAACTTGATCTTGG - Intronic
993020081 5:82581557-82581579 GGATGAAGCCAACTTGATCGTGG + Intergenic
993093876 5:83460144-83460166 GGATGAAGCCCACTTGATCTTGG + Intergenic
993220677 5:85092823-85092845 GGATGAAGCCAACTTGATCATGG - Intergenic
993230499 5:85229270-85229292 GGATGAAGCCAACTTAATTGTGG + Intergenic
993290353 5:86060395-86060417 GGATGAAGCCAACTTGATCATGG - Intergenic
993336138 5:86661352-86661374 GGATGAAGCCAACTTGATCCTGG + Intergenic
993381541 5:87214391-87214413 GGATGAAGTCAACTTGATCGTGG + Intergenic
993459883 5:88170356-88170378 GGATGAAGCCAACTTGATCATGG + Intergenic
993541932 5:89162624-89162646 GGATGAAGCCAACTTAATGGTGG - Intergenic
993546942 5:89223731-89223753 GGATGAAGCCAACTTGATCTTGG - Intergenic
993676199 5:90818756-90818778 GGATGAAGCCCACTTAATCATGG + Intronic
993742589 5:91559173-91559195 GGATGAAGCCAACTTGATCGTGG - Intergenic
993837346 5:92831818-92831840 GGATGAAGCCAACTTAATTGTGG + Intergenic
994143210 5:96364174-96364196 GGATGAAGACAACTTGATCATGG + Intergenic
994344865 5:98672419-98672441 GGATGAAACCAACTTGATCATGG - Intergenic
994378430 5:99041420-99041442 GGATGAAGCCAACTTGATCTTGG - Intergenic
994418271 5:99501427-99501449 GGATGAACCCCACTTGATCATGG - Intergenic
994461697 5:100073722-100073744 GGATGAACCCCACTTGATCATGG + Intergenic
994499529 5:100557277-100557299 GGATGAAGCCCACTTGATCTTGG + Intronic
994586212 5:101712590-101712612 GGATGAAGCCAACTTAATCATGG + Intergenic
994637379 5:102360165-102360187 GGATGAAGCCCACTTAATCATGG - Intergenic
994721174 5:103382187-103382209 GGATGAAGCCAACTTGATCATGG + Intergenic
994850684 5:105051570-105051592 GGATGAAGCCAACTTGATCGTGG + Intergenic
995263254 5:110130265-110130287 GGATGAAGTCAACTTGATCATGG - Intergenic
995460085 5:112393890-112393912 GAATGAAGCCAACTTGATCTTGG - Intronic
995660784 5:114480666-114480688 GGATGAAGCCAACTTGATCATGG - Intronic
995690047 5:114815509-114815531 GGATGAAGTCAACTTGATCATGG + Intergenic
996085034 5:119296467-119296489 GGATGAAGCCCACTTGATCTTGG + Intronic
996110023 5:119554444-119554466 GGATGAAACCAACTTGATCGTGG + Intronic
996185585 5:120470004-120470026 GGATGAAAATAACATAATCCAGG - Intronic
996193996 5:120580865-120580887 GGATGAAGCCAACTTGATCTTGG + Intronic
996539014 5:124609448-124609470 GGATGAAGCCAACTTGATCGTGG - Intergenic
996625893 5:125569994-125570016 GGATGAAGCCCACTTGATCTTGG - Intergenic
996639408 5:125734091-125734113 GGATGAAGCCAACTTGATCGTGG - Intergenic
996687031 5:126294280-126294302 GGATGAAGCCCACTTAATCATGG - Intergenic
996909706 5:128641143-128641165 GGACAAACACAACTCATTCTTGG - Intronic
996910520 5:128652306-128652328 GGATGAATCCAACTTGATCATGG + Intronic
996952919 5:129149499-129149521 GGATGAAGCCAACTTGATCGTGG + Intergenic
997252653 5:132401891-132401913 GGATGAAGCCAACTTGATCATGG - Intergenic
997770932 5:136552291-136552313 GGATGAACCATACTTAATCATGG + Intergenic
997809089 5:136949528-136949550 GGATGAAGCCAACTTGATCATGG + Intergenic
998691220 5:144590783-144590805 GGATGAAACCAACTTGATCATGG + Intergenic
998759553 5:145417547-145417569 GGATGAAGCCAACTTGATCATGG - Intergenic
998774433 5:145583091-145583113 GGATGAAGCCAACTTGATCATGG - Intronic
998803519 5:145894935-145894957 GGATGAAGACGACTTGATCATGG - Intergenic
999677617 5:154020946-154020968 GGATAAAGCCAACTTGATCTTGG - Intronic
1000032105 5:157411223-157411245 GGATGAAGCCTACTTAATCATGG - Intronic
1000406838 5:160896842-160896864 GGATGAAGCCAACTTGATCGTGG - Intergenic
1000452785 5:161410987-161411009 GGATGAACAAAACTGCACCTTGG - Exonic
1000471954 5:161654305-161654327 GGATGAAGCCAACTTGATCATGG - Intronic
1000490278 5:161904377-161904399 GGATGAACCCGACTTGATCGTGG + Intergenic
1000557308 5:162741845-162741867 GGATGAAGACAGCTTGATCGTGG + Intergenic
1000581893 5:163045191-163045213 GGATGAATCCCACTTGATCTTGG - Intergenic
1000587567 5:163119183-163119205 GGATGAAGCCCACTTGATCTTGG + Intergenic
1000647726 5:163778976-163778998 GGATGAAGCCCACTTGATCTTGG + Intergenic
1001076732 5:168634671-168634693 GGATGAAGCCAACTTGATCTTGG - Intergenic
1001348499 5:170932750-170932772 GGATGAAGCCAACTTGATCGTGG + Intronic
1002677523 5:180930115-180930137 GGATGAAGCCAACTTGATCGTGG - Intronic
1002746902 6:65377-65399 GGATGAAGCCCACTTGATCTTGG - Intergenic
1002996473 6:2290336-2290358 GGATGAAGCCAACTGGATCTTGG - Intergenic
1002997503 6:2300645-2300667 GGATGAAGCCGACTTGATCTTGG - Intergenic
1003686639 6:8311016-8311038 GGATGAAGCCAACTTGATCGTGG + Intergenic
1003782743 6:9447519-9447541 GGATGAAGCCCACTTGATCTTGG - Intergenic
1004454627 6:15780654-15780676 GGATGAAGACAACTTGAACAAGG + Intergenic
1004717492 6:18232014-18232036 GGATGAAGTCCACTTAATCATGG - Intronic
1004730735 6:18356110-18356132 GGATGAAGCCAACTTGATCGTGG + Intergenic
1004810111 6:19250730-19250752 GGATGAAGCCCACTTAATCATGG - Intergenic
1005552820 6:26941092-26941114 GGATGAAGCCAACTTGATCTTGG + Intergenic
1005558480 6:27012214-27012236 GGATGAAGCCAACTTGATCATGG - Intergenic
1005747531 6:28852568-28852590 GGATGAAGCCAACTTGTTCTTGG - Intergenic
1006197987 6:32259436-32259458 GGATGAAGCCAACTTGATCGTGG + Intergenic
1006237572 6:32648431-32648453 GGATGAAGCCAACTTGATCGTGG - Intergenic
1007146962 6:39645497-39645519 GGATGAAGCCAACTTGATCATGG + Intronic
1007347621 6:41244709-41244731 GGATGAAGCCAACTTGATCGTGG - Intergenic
1008175820 6:48267104-48267126 GGATGAAGCCAACTTGATCATGG + Intergenic
1008281602 6:49602318-49602340 GGATGAAGCCCACTTAATCATGG - Intergenic
1008287449 6:49671126-49671148 GGATGAAGCCAATTTGATCTTGG - Intergenic
1008436523 6:51482709-51482731 GGATGAAACCAACTTGATCTTGG + Intergenic
1008528312 6:52430549-52430571 GTATGAAAACCACTTAATCGTGG + Intronic
1008728884 6:54455868-54455890 GGATGAAGCCAACTTGATCATGG + Intergenic
1008771532 6:54984616-54984638 GGATGAAGCCTACTTAATCACGG - Intergenic
1008963587 6:57291646-57291668 GGATGAAGCCAACTTGATCGTGG - Intergenic
1009193205 6:60654300-60654322 GGATGAAGCCAACTTGATCATGG + Intergenic
1009213127 6:60887249-60887271 GGATGAAGCCAACTTGATCATGG - Intergenic
1009299968 6:62004813-62004835 GGATGAAGCCAACTTGATCTTGG - Intronic
1009340748 6:62551703-62551725 GGATGAAGACCACTTGATCACGG + Intergenic
1009384535 6:63072604-63072626 GGATGAAGCCAACTTGATCGTGG + Intergenic
1009411059 6:63365737-63365759 GGATGAAGCCAACTTAATTGTGG - Intergenic
1009447164 6:63756467-63756489 GGATGAAGCCAACTTGATCATGG + Intronic
1009449241 6:63782091-63782113 GGATGAAGCCAACTTGATCATGG + Intronic
1009457607 6:63875313-63875335 GGATGAAGCCAACTTGATCATGG + Intronic
1009579493 6:65513590-65513612 GGATGAAGCCCACTTAATCATGG - Intronic
1009597231 6:65751381-65751403 GGATGAAGCCAACTTGATCATGG - Intergenic
1009605801 6:65865648-65865670 GGATGAATCCAACTTGATCTTGG - Intergenic
1009629032 6:66170604-66170626 GGATAAAGCCAACTTGATCTTGG - Intergenic
1009647480 6:66425276-66425298 GGATGAATCCAACTTGATCGTGG - Intergenic
1009756718 6:67949462-67949484 GGATGAAGCCAACTTGATCATGG + Intergenic
1009805986 6:68602712-68602734 GGATGAAGCCCACTTAATCATGG - Intergenic
1009817519 6:68755059-68755081 CTATAAACACAACTTAATTTAGG + Intronic
1009819947 6:68787495-68787517 GGATGAAGCCCACTTAATCATGG + Intronic
1010102092 6:72121994-72122016 GGATGAAGCCAACTTGATCGTGG + Intronic
1010171479 6:72981001-72981023 GGATGAAGCCAACTTGGTCTTGG + Intronic
1010670433 6:78680100-78680122 GGATGAAGCCAAGTTGATCTTGG - Intergenic
1010681450 6:78803934-78803956 GGATGAAGTCAACTTGATCGTGG + Intergenic
1010889113 6:81284336-81284358 GGATGAAGCCCACTTGATCTTGG + Intergenic
1010988756 6:82455725-82455747 GAATGAACACTACTTGATCATGG + Intergenic
1011145056 6:84205369-84205391 GGATGAAGCCAACTTGATCGTGG - Intronic
1011229807 6:85147930-85147952 GGATGAAGCCAACTTGATCATGG + Intergenic
1011297957 6:85843888-85843910 GGATGAAGCCAACTTGATCATGG + Intergenic
1011313751 6:86008670-86008692 GGATGAAGCCAACTTGATCATGG - Intergenic
1011348380 6:86396368-86396390 GGATGAAGCCAACTTGATCGTGG - Intergenic
1011393746 6:86883268-86883290 GGATGAAGCCAACTTGATCGTGG + Intergenic
1011418089 6:87143459-87143481 GGATGAAGCCAACTTGATCGTGG - Intergenic
1011607954 6:89123285-89123307 GGATGAAAACGACTTAAGTTTGG - Intergenic
1011916648 6:92514132-92514154 GGATGAAGACAACTTGATCTTGG - Intergenic
1011932458 6:92731256-92731278 GGATGAAGCCAACTTGATCTTGG + Intergenic
1011992347 6:93538642-93538664 GGATTCAATCAACTTAATCTTGG + Intergenic
1012116156 6:95301070-95301092 GGATGAAGCCAACTTGATCGTGG + Intergenic
1012490331 6:99776332-99776354 GGATGAAGCCAACTTGATCATGG + Intergenic
1012514463 6:100042554-100042576 GGATGAAGCCAACTTGATCGTGG - Intergenic
1012590394 6:100973199-100973221 GGATGAAACCAACTCGATCTTGG - Intergenic
1012688659 6:102286074-102286096 GGATGAAGCCAACTTCATCATGG - Intergenic
1012922098 6:105230886-105230908 GGATGAAGCCAACTTGATCGTGG + Intergenic
1012970369 6:105722881-105722903 GGATGAACAATACTTAGTCATGG - Intergenic
1013038342 6:106408669-106408691 GGATGAAGCCAACTTGATCGTGG - Intergenic
1013200358 6:107888931-107888953 GGATGAAGCCAACTTGATCGTGG + Intronic
1013331958 6:109111865-109111887 GGATGAAGCCAACTTGATCGTGG + Intronic
1013333760 6:109134212-109134234 GGATGAAGCCCACTTGATCTTGG - Intronic
1013379539 6:109554042-109554064 GGATGAAGCCAACTTGATCATGG + Intronic
1013380771 6:109568078-109568100 GGATGAAGCCAACTTGATCGTGG - Intronic
1013388032 6:109652204-109652226 GGATGAAGCCAACTTGATCGTGG - Intronic
1013423482 6:109988378-109988400 GGATGAAGCCAACTTGATCATGG + Intergenic
1013734936 6:113214704-113214726 GGATGAAGCCAACTTGATCGTGG + Intergenic
1013957524 6:115857771-115857793 GGATGAAGCCAACTTGATCATGG - Intergenic
1013964552 6:115939137-115939159 GGATGAAGCCAACTTGATCGTGG - Exonic
1014123167 6:117749386-117749408 GGATGAAGCCAACTTGATCATGG - Intergenic
1014157409 6:118127322-118127344 GGATGAAGCCCACTTAATCATGG + Intronic
1014185914 6:118433855-118433877 GGATGAAGACAACTTGATTGTGG - Intergenic
1014224855 6:118836189-118836211 GGATGAAGCCAACTTGATCGTGG + Intronic
1014301964 6:119693080-119693102 GGATGAAGCCAACTTGATCATGG + Intergenic
1014332462 6:120086763-120086785 GGATGAAGCCAGCTTAATCATGG - Intergenic
1014409833 6:121101387-121101409 GGATGAAGCCCACTTGATCTTGG - Intronic
1014569391 6:122990008-122990030 GGATGAAGCCAACTTGATCATGG - Intergenic
1014589570 6:123246902-123246924 GGATGAAGCCAACTTGATCGTGG - Intronic
1014674264 6:124345174-124345196 GGATGAAGTCCACTTGATCTTGG + Intronic
1014846501 6:126283868-126283890 GGATGAAGCCAACTTGATCGTGG - Intergenic
1014864348 6:126509320-126509342 GGATGAAGCCAACTTGATCGTGG - Intergenic
1014881562 6:126730040-126730062 GGATGAAGCCCACTTAATCGTGG - Intergenic
1014892862 6:126863868-126863890 GGATGAAGCCAACTTGATCGTGG + Intergenic
1014922767 6:127232025-127232047 GGATGAAGCCAACTTGATCGTGG - Intergenic
1015109265 6:129572766-129572788 GGATGAAGCCAACTTGATCGTGG - Intergenic
1015368241 6:132421892-132421914 GGATGAAGCCAACTTGATCGTGG + Intergenic
1015430005 6:133119993-133120015 GGATGAAGCCAACTTGATCGTGG + Intergenic
1015779404 6:136848691-136848713 GGATGAAGCCAACTTGATCTTGG + Intronic
1015802422 6:137073940-137073962 GGATGAAGCCGACTTGATCTTGG - Intergenic
1015882912 6:137887708-137887730 GGATGAAGCCAACTTGATCGTGG + Intergenic
1016005675 6:139086761-139086783 GGATGAAGCCAACTTGATCTTGG + Intergenic
1016333556 6:142979704-142979726 GGATGAAGCCAACTTGATCCTGG + Intergenic
1016335210 6:142997545-142997567 GGATGAAGCCAACTTGATCCTGG - Intergenic
1016338180 6:143031567-143031589 GGATGAAGCCAACTTGATCATGG + Intergenic
1016436526 6:144043516-144043538 GGATGAAACCAATTTGATCTTGG + Intronic
1016520881 6:144945193-144945215 GAATGAGCAGAAATTAATCTTGG - Intergenic
1016771394 6:147856129-147856151 GGATGAACTCAACATAATTATGG + Intergenic
1016790033 6:148058872-148058894 GGATGAAGCCAACTTGATCGTGG + Intergenic
1017660312 6:156667642-156667664 GGATGAAGACGACTTGATCATGG - Intergenic
1017876225 6:158526520-158526542 GGATGAAGCCAACTTGATCATGG - Intergenic
1017888105 6:158616826-158616848 GGATGAAGCCAACTTGATCGTGG + Intronic
1018113729 6:160562409-160562431 GGATGAAGCCAACTTGATCATGG + Intronic
1018175469 6:161174989-161175011 GGATGAAGCCAACTTGATCGTGG + Intronic
1018507501 6:164487292-164487314 GGATGAAGCCAACTTGATCATGG + Intergenic
1018590245 6:165411503-165411525 GGAGAAACACACCTTGATCTTGG + Intronic
1019027111 6:168976717-168976739 GGATGAAGCCCACTTAATCATGG - Intergenic
1019071537 6:169350217-169350239 GGATGAAGCCAACTTGATCATGG + Intergenic
1019122801 6:169817243-169817265 GTATGAAACCAACTTAATCATGG + Intergenic
1020343851 7:7141940-7141962 GGATGAAGCCAACTTGATCTTGG + Intergenic
1020366887 7:7390333-7390355 GGATGAAGCCAACTTGATCGTGG + Intronic
1020609407 7:10376343-10376365 GGATGAAGCCAACTTGATCGTGG - Intergenic
1020659177 7:10962422-10962444 GGATGAAGCCAACTTGATCATGG + Intergenic
1020873933 7:13670411-13670433 GGATGAAGCCAACTTAATTGTGG + Intergenic
1020927884 7:14355618-14355640 GGATGAAGCCAACTTGATCATGG + Intronic
1021064917 7:16161525-16161547 GGATGAAGCCAACTTGATCATGG + Intronic
1021307508 7:19049542-19049564 GGATGAAGCCAACTTGATCTTGG - Intronic
1021354838 7:19641230-19641252 GGATGAAGCCAACTTGATCGTGG + Intergenic
1021371728 7:19857384-19857406 GGATGAAGCCAACTTGATCGTGG - Intergenic
1021379566 7:19951058-19951080 GGATGAAGCCAACTTGATCGTGG + Intergenic
1021557145 7:21931427-21931449 GGATGAAGCCAACTTGATCCTGG - Intronic
1021755594 7:23848638-23848660 GGATGAAGCCAACTTAATCATGG - Intergenic
1021832378 7:24628167-24628189 GGATGAAGCCAACTTGATCGTGG - Intronic
1021916651 7:25440437-25440459 GGATGAAGTCAACTTGATCGGGG + Intergenic
1021966553 7:25925655-25925677 GGATGAAGCCAACTTGATCATGG - Intergenic
1022182965 7:27939873-27939895 GGATGAACACATTGGAATCTGGG + Intronic
1022635004 7:32123505-32123527 GGATGAAGCCAACTTGATCATGG - Intronic
1023065719 7:36375430-36375452 GGATGAAGCCAACTTCATCTTGG + Intronic
1023147418 7:37165678-37165700 GGATGAAGCCCACTTGATCTTGG + Intronic
1023465047 7:40445065-40445087 GGATGAAGCCAACTTGATCATGG + Intronic
1023650870 7:42367775-42367797 GGATGAAGCCAACTTGATCGTGG + Intergenic
1024679695 7:51672636-51672658 GGATGAAGCCCACTTAATCATGG - Intergenic
1024703142 7:51926593-51926615 GGATGAAGCCAACTTGATCATGG + Intergenic
1024738440 7:52330537-52330559 GGATGAAGCCAACTTGATCATGG - Intergenic
1024817153 7:53284666-53284688 GGATGAAGCCAACTTGATCGTGG + Intergenic
1025017852 7:55454599-55454621 GGATGAAGCCAACTTGATCATGG - Intronic
1026485150 7:70811779-70811801 GGATGAAGCCAACTTGATCGTGG + Intergenic
1027509949 7:79067946-79067968 GGATGAAGCCAACTTGATCTTGG + Intronic
1027727527 7:81826390-81826412 GGATGAAGCCAACTTGATCGTGG + Intergenic
1027731620 7:81881490-81881512 GGATGAAGCCAACTTGATCGTGG - Intergenic
1027786213 7:82581989-82582011 GGATGAAGCCAACTTGATCATGG + Intergenic
1027840210 7:83300263-83300285 GTATGAATACCACTTAATCATGG + Intergenic
1028019032 7:85748398-85748420 AGATGAAAACTACTTAATCATGG - Intergenic
1028078945 7:86549988-86550010 GGATGAAGCCAACTTGATCTTGG - Intergenic
1028139719 7:87260162-87260184 GGATGAAGCCAACTTGATCGTGG + Intergenic
1028325849 7:89523872-89523894 GGATGAAGCCCACTTAATCATGG - Intergenic
1028369392 7:90073753-90073775 GGATGAAGCCAACTTTATCATGG - Intergenic
1028395697 7:90366105-90366127 GGATGAAGCCAACTTGATCATGG + Intronic
1028442866 7:90883738-90883760 GGATGAAGCCAACTTGATCGTGG - Intronic
1028471092 7:91207161-91207183 GAATGATGACAACTTAATCCTGG - Exonic
1028476103 7:91255067-91255089 GGATGAAGCCAACTTGATCATGG + Intergenic
1028526600 7:91793370-91793392 GGATGAAGCCAACTTGATCGTGG - Intronic
1028578832 7:92383540-92383562 GGATGAAGCCAACTTGATCTTGG - Intronic
1028626768 7:92886648-92886670 GGATGAAGCCAACTTGATCATGG + Intergenic
1028691726 7:93660379-93660401 GGATGAAGCCAACTTGATCTTGG + Intronic
1028692861 7:93673538-93673560 GGATGAAGCCAACTTGATCTTGG + Intronic
1028805606 7:95022820-95022842 GGATGAAGCCAACTTGATCGTGG + Intronic
1028836753 7:95383002-95383024 GGATGAAGCCCACTTGATCTTGG - Intronic
1028991642 7:97054893-97054915 GGATGAAGCCAACTTGATCGTGG - Intergenic
1029006190 7:97212391-97212413 GGATGAAGCCAACTTGATCATGG + Intergenic
1029041803 7:97583820-97583842 GGATGAAGCCAACTTGATCATGG - Intergenic
1029062619 7:97814132-97814154 GGATGAAGCCAACTTGATCTTGG - Intergenic
1029855205 7:103508311-103508333 GGATGAAGCCAACTTGATCTTGG - Intronic
1029869428 7:103674686-103674708 GGATGAAGCCAACTTGATCATGG - Intronic
1029888426 7:103899592-103899614 GGATGAAGCCAACTTGATCATGG - Intronic
1030159857 7:106496124-106496146 GGATGAAGCCAACTTGATCATGG - Intergenic
1030413458 7:109211791-109211813 GCATGAAAGCAACTTGATCTTGG + Intergenic
1030759630 7:113334429-113334451 GGATGAAGACAACTTGATCATGG - Intergenic
1030774446 7:113516023-113516045 GGATGAACCCAACTTGATTGTGG + Intergenic
1031245536 7:119306794-119306816 GCATGAAGACAACTTGATCATGG - Intergenic
1031396130 7:121276670-121276692 GGATGAACAGGACTTAATCAAGG + Intronic
1031433955 7:121709801-121709823 GGATGAAGCCAACTTGATCATGG + Intergenic
1031590934 7:123591640-123591662 GGATGAAGCCAACTTGATCGTGG + Intronic
1031829009 7:126603035-126603057 GGATGAAGCCAACTTGATCATGG - Intronic
1031830228 7:126617176-126617198 GGATGAAGCCAACTTGATCATGG - Intronic
1031864930 7:127028174-127028196 GGATGAAGCCAACTTGATCATGG + Intronic
1031905374 7:127454741-127454763 GGATGAAGCCAACTTGATCGTGG - Intergenic
1032312207 7:130798664-130798686 GGATGAAGCCAACTTGATCGTGG + Intergenic
1032686830 7:134242853-134242875 GGATGAAGCCAACTTGATCGTGG - Intronic
1032777169 7:135125694-135125716 GGATGAAGCCAACTTCATCATGG - Intronic
1032926453 7:136611300-136611322 GGATGAAGCCAACTTTATCGTGG + Intergenic
1033102582 7:138487686-138487708 GGATGAAGCCCACTTGATCTTGG + Intronic
1033776386 7:144616284-144616306 GGATGAAGCCAACTTGATCATGG - Intronic
1033900680 7:146134752-146134774 GGATGAAGCCCACTTAATCATGG + Intronic
1033902586 7:146161002-146161024 GGATGAAGCCAACTTGATCCTGG - Intronic
1033914433 7:146306546-146306568 GGATGAAGCCAACTTGATCGTGG - Intronic
1034375216 7:150636998-150637020 GGATGAAGCCAACTTGATCGTGG + Intergenic
1035182803 7:157102192-157102214 GGATGAAGCCAACTTGATCGCGG + Intergenic
1035492032 7:159288253-159288275 GGATGAAGCCAACTTGATCATGG - Intergenic
1035554868 8:559543-559565 GGATGAAGCTAACTTGATCTTGG - Intergenic
1036554107 8:9842440-9842462 GGATGAAGCCAAGTTGATCTTGG - Intergenic
1037030333 8:14096446-14096468 GGATGAAGCCAACTTGATCGTGG + Intronic
1037087372 8:14869238-14869260 GGATGACGTCAACTTAATCGTGG - Intronic
1037213297 8:16418562-16418584 GGATGAAGCCAACTTGATCATGG - Intronic
1037214300 8:16429830-16429852 GGATGAAGCCAACTTGATCATGG + Intronic
1037285065 8:17290519-17290541 GGATGAAGCCAACTTGATCGTGG + Intronic
1037422046 8:18712934-18712956 GGATGAAGCCAACTTCATCATGG - Intronic
1037544777 8:19908548-19908570 GGATGAAGCCGACTTGATCTTGG + Intronic
1037557318 8:20037662-20037684 GGATGAAGCTAACTTGATCTTGG + Intergenic
1037634046 8:20684505-20684527 GGATGAAGCCCACTTAATCATGG + Intergenic
1038221402 8:25611712-25611734 GGATGAAGCCAACTTTATCGTGG + Intergenic
1038707961 8:29913163-29913185 GGATGAAGCCAACTTGATCACGG - Intergenic
1039036376 8:33364070-33364092 GGATGAAGCCAACTTGATCATGG - Intergenic
1039154412 8:34539196-34539218 GGATGAAGCCAACTTGATCATGG - Intergenic
1039348032 8:36729557-36729579 GGATGAAGCCAACTTGATCGTGG - Intergenic
1039680214 8:39727037-39727059 GGATGTATACAACTTTCTCTGGG - Intronic
1039849783 8:41354284-41354306 GGATGAAGCCAACTTGATCATGG + Intergenic
1040383686 8:46897747-46897769 AGATGAAGCCAACTTGATCTTGG - Intergenic
1040411126 8:47155520-47155542 GGATGAAGCCAACTTGATCATGG - Intergenic
1040501154 8:48006590-48006612 GGATGAAGCCGACTTGATCTTGG - Intergenic
1041575064 8:59384628-59384650 GGATGAAGCCAACTTGATCATGG - Intergenic
1041634430 8:60126998-60127020 GGATGAAGCCAACTTGATCGTGG + Intergenic
1041910237 8:63081291-63081313 GGATGAAGCCAACTTGATCTTGG - Intronic
1041946213 8:63445844-63445866 GGATGAAGCCCACTTAATCATGG + Intergenic
1041965833 8:63675141-63675163 TGATAAACAGAACTCAATCTGGG + Intergenic
1041973227 8:63767393-63767415 GGATGAAGCCAACTTGATCGTGG + Intergenic
1042644952 8:70976558-70976580 GGATGAAGCCCACTTGATCTTGG + Intergenic
1042753853 8:72187982-72188004 GGATGAAGCCGACTTGATCTTGG - Intergenic
1042833806 8:73059551-73059573 GGATGAAGCCAACTTGATCGTGG - Intergenic
1042853178 8:73237193-73237215 GGATGAAGCCAACTTGATCATGG + Intergenic
1042887905 8:73572549-73572571 GGATGAAGCCAACTTGATCGTGG - Intronic
1042931625 8:74019720-74019742 GGATGAAGCCAACTTGATCTTGG - Intronic
1042967801 8:74374098-74374120 GGATGAAGACCACTTGATCATGG + Intronic
1043071095 8:75636777-75636799 GGATGAAGCCAACTTGATCGTGG + Intergenic
1043279756 8:78448641-78448663 AGATGAAGCCAACTTGATCTTGG - Intergenic
1043330752 8:79115716-79115738 GGATGAAGCGAACTTGATCTTGG - Intergenic
1043381934 8:79711846-79711868 GGATGAAGCCAACTTGATCATGG - Intergenic
1043604804 8:81987421-81987443 GGATGAAGCCAACTTGATCTTGG + Intergenic
1043619466 8:82170935-82170957 GGATGAAGCCAACTTGATCGTGG + Intergenic
1043688364 8:83117049-83117071 GGATGAAGCCAACTTGATCGTGG + Intergenic
1043699594 8:83269048-83269070 GGATGAAGCCAACTTGATCGTGG - Intergenic
1043721317 8:83549048-83549070 GGATGGACACAGCTTTATCCTGG - Intergenic
1043748566 8:83906818-83906840 GGATGAAGCCAACTTGATCGTGG + Intergenic
1043911597 8:85870634-85870656 GGATGAAGCCCACTTGATCTTGG + Intergenic
1043929845 8:86078116-86078138 GGATGAAGCCAACTTGATCGTGG - Intronic
1044155954 8:88847655-88847677 GGATGAAGCCAACTTGATCGTGG + Intergenic
1044221549 8:89675917-89675939 GGATGAAGCCAACTTGATCATGG - Intergenic
1044284012 8:90390550-90390572 GGATGAAGCCAACTTGATCATGG - Intergenic
1044548603 8:93487026-93487048 GGATGAAGCCAACTTGATCATGG - Intergenic
1044956272 8:97484448-97484470 GGATGAAGCCAACTTGATCGTGG + Intergenic
1044960434 8:97525364-97525386 GGATGAAGCCAACTTGATCATGG + Intergenic
1044961351 8:97533973-97533995 GGATGAAGCCAACTTGATCATGG - Intergenic
1045083506 8:98654133-98654155 GGATGAATCCAACTTGATCATGG - Intronic
1045088534 8:98713930-98713952 GGATGAATCCAACTTGATCATGG - Intronic
1045122413 8:99052372-99052394 GGATGAAGCCAACTTCATCTTGG + Intronic
1045125410 8:99083798-99083820 GGATGAAGCCAACTTCATCTTGG + Intronic
1045389103 8:101697595-101697617 GGATGAAGCCAACTTGATCATGG - Intronic
1045572637 8:103385286-103385308 GGATGAAGCCAACTTGATCATGG - Intergenic
1045586423 8:103542672-103542694 GGATGAACCCCACTTGATCATGG - Intronic
1045839698 8:106564781-106564803 GGATGAAGCCAACTTGATCGTGG - Intronic
1046106812 8:109675939-109675961 GGATGAAACCAACTTGATCATGG - Intronic
1046313633 8:112471908-112471930 CTGTGAACAGAACTTAATCTAGG + Intronic
1046436017 8:114190754-114190776 GGATGGAGTCAACTTGATCTTGG - Intergenic
1046482536 8:114841083-114841105 GGATGAAGCCAACTTGATCGTGG + Intergenic
1046525165 8:115374145-115374167 GGATGAAGCCAACTTGATCGTGG - Intergenic
1046901123 8:119524808-119524830 GGATGAAGCCAACTTGATCATGG - Intergenic
1046912748 8:119646782-119646804 GAAAGAGCACAACTTAATCAAGG - Intronic
1047565900 8:126043218-126043240 GGATGAAGCCAACTTGATCGTGG + Intergenic
1047899072 8:129399916-129399938 GGATGAAGCCAACTTGATCATGG - Intergenic
1048467403 8:134677749-134677771 GGATGAGGCCAACTTAATCGTGG - Intronic
1048796719 8:138157096-138157118 GGATGAAGCCAACTTGATCGTGG - Intronic
1049135922 8:140899750-140899772 GGATGAATCCTACTTAATCATGG - Intronic
1049485174 8:142853728-142853750 GGATGAAGCCAACTTGATCTTGG - Intronic
1049964952 9:770526-770548 GGATGAAGCCAACTTGATCGTGG - Intergenic
1050007475 9:1147997-1148019 GGATGAAGCCAACTTGATCATGG - Intergenic
1050322785 9:4470404-4470426 GGATGAAGCCAACTTGATCGTGG - Intergenic
1050398455 9:5225514-5225536 GGATGAAGCCAACTTGATCATGG - Intergenic
1050590733 9:7157695-7157717 GGATGAAGCCAACTTGATCATGG + Intergenic
1050603822 9:7280026-7280048 GGATGAAGCCCACTTGATCTTGG + Intergenic
1050623829 9:7482401-7482423 GGATGAAGCCAACTTGATCATGG - Intergenic
1050661102 9:7883727-7883749 GGATGAAGCCAACTTGATCATGG - Intronic
1050780367 9:9326034-9326056 GGATGAAGCCAACTCGATCTTGG + Intronic
1051232845 9:14970767-14970789 GGATGAAGCCAACTTGATCGTGG - Intergenic
1051253125 9:15182204-15182226 GGATGTACACAAATTAATGTTGG + Intronic
1051292409 9:15558079-15558101 GGATGAAGCCAACTTGATCGTGG + Intronic
1051303015 9:15673689-15673711 GGATGAAGCCAACTTGATCGTGG + Intronic
1051447050 9:17151501-17151523 GGATGAAGCCAACTTCATCATGG + Intronic
1051479771 9:17546777-17546799 GGATGAAGCCAACTTGATCGTGG - Intergenic
1051603671 9:18898618-18898640 GGATGAAGCCAACTTGATCATGG - Intronic
1051808223 9:21021028-21021050 GGATGAAGCCAACTTGATCGTGG - Intronic
1051846530 9:21457399-21457421 GGGTGAAGCCAACTTGATCTTGG - Intergenic
1052064102 9:23995494-23995516 GGATGAAGCCAACTTGATCGTGG - Intergenic
1052127079 9:24790585-24790607 GGATGAAGCCAACTTGATCGTGG - Intergenic
1052134431 9:24892524-24892546 GGATGAAGCCAACTTGATCATGG - Intergenic
1052143695 9:25021974-25021996 GGATGAAGCCAACTTGATCGTGG + Intergenic
1052143939 9:25024942-25024964 GGATGAAGCCAACTTGATCGTGG - Intergenic
1052154658 9:25169888-25169910 GGATGAAGCCAACTTGATCATGG - Intergenic
1052280866 9:26731939-26731961 GGATGAAGCCAACTTGATCGTGG + Intergenic
1052479771 9:29008832-29008854 GGATGAAGCCAACTTGATCATGG - Intergenic
1052628666 9:31008556-31008578 GGATGAAGCCAACTTGATCATGG - Intergenic
1052640162 9:31157289-31157311 GGATGAAGCCCACTTAATCATGG + Intergenic
1052800381 9:32961606-32961628 GGATGAAGCCAACTTGATCATGG - Intergenic
1052888323 9:33671130-33671152 GGATGAAGCCCACTTGATCTTGG - Intergenic
1053088285 9:35247695-35247717 GGATGAAGCCCACTTAATCATGG + Intronic
1053726276 9:41004639-41004661 GGATGAAGCCCACTTGATCTTGG + Intergenic
1053751409 9:41260330-41260352 GGATGAAGACTACTTGATCGTGG + Intergenic
1054256931 9:62824658-62824680 GGATGAAGACTACTTGATCGTGG + Intergenic
1054334363 9:63790844-63790866 GGATGAAGACTACTTGATCGTGG - Intergenic
1054886934 9:70208972-70208994 GGATGAAGCCAACTTGATCATGG + Intronic
1054889694 9:70237799-70237821 GGATGAAGACCACTTGATCATGG - Intergenic
1055014342 9:71599626-71599648 GGATGAAGCCAACTTGATCGTGG - Intergenic
1055226757 9:74006356-74006378 GGATGAAGCCAACTTGATCGTGG - Intergenic
1055234422 9:74103155-74103177 GGATGAAGCCAACTTGATCATGG - Intergenic
1055276218 9:74619882-74619904 GGATGAAGCCAACTTGATCATGG + Intronic
1055390605 9:75818091-75818113 GGATGAAGCCAACTTGATCGTGG + Intergenic
1055614582 9:78058016-78058038 GGATGAAGCCAACTTGATCTTGG - Intergenic
1055629095 9:78204727-78204749 GGATGAAGCCAACTTGATCGTGG - Intergenic
1056142169 9:83692951-83692973 GGATAAAAATAAGTTAATCTAGG - Intronic
1056631627 9:88298319-88298341 GGATGAACCCCACTTGATCATGG - Intergenic
1056701222 9:88910761-88910783 GGATGAAGCCAACTTGATCGTGG - Intergenic
1056885567 9:90440452-90440474 GGATGAAGCCAACTTGATCGTGG + Intergenic
1056945807 9:90995535-90995557 GGATGAAGCCAACTTGATCATGG + Intergenic
1057697651 9:97337504-97337526 GGATGAAGCCAACTTGATCTTGG + Intronic
1057975369 9:99600469-99600491 GAATGAACACAAGTGATTCTTGG + Intergenic
1058012352 9:99992316-99992338 GGATGAAGCCCACTTGATCTTGG - Intronic
1058096770 9:100870567-100870589 GGATGAAGCCAACTTGATCGTGG - Intergenic
1058122447 9:101154051-101154073 GGATGAAGCCCACTTGATCTTGG + Intronic
1058353485 9:104055043-104055065 GGATGAATCCAACTTAATCATGG - Intergenic
1058512100 9:105730411-105730433 GGATGAAGCCAACTTGATCGTGG + Intronic
1058767119 9:108192398-108192420 GGATGAACTCACTTTAATTTAGG - Intergenic
1058925793 9:109662508-109662530 GGATGAAGCCAACTTGATCATGG + Intronic
1059028756 9:110666649-110666671 GGATGAAGCCAACTTGATCGTGG - Intergenic
1059596631 9:115727625-115727647 GGATGAAGCCAACTTGATCGTGG - Intergenic
1059745874 9:117200703-117200725 GGATGAAGCCGACTTAATCATGG + Intronic
1060415687 9:123428201-123428223 GGATGAAGCCAACTTGATCATGG - Intronic
1062063111 9:134508589-134508611 GGATGAAGCCAACTTGATCGTGG + Intergenic
1203532431 Un_GL000213v1:158991-159013 GGATGAAGCCAACTTGATCATGG + Intergenic
1203690901 Un_GL000214v1:41838-41860 GGATGAAACCCACTTAATCATGG + Intergenic
1203573667 Un_KI270744v1:156466-156488 GGATGAAGCCAACTTGATCATGG - Intergenic
1203645394 Un_KI270751v1:62353-62375 GGATGAAACCCACTTAATCATGG - Intergenic
1186323416 X:8453482-8453504 GGATGCAGTCAACTTAATCGAGG + Intergenic
1186563897 X:10641816-10641838 GGATGAAGCCAACTTGATCGCGG - Intronic
1187515878 X:19969490-19969512 AGATGAAAACAATTTTATCTGGG - Intronic
1187596148 X:20774964-20774986 GGATGAAGCCAACTTGATCGTGG - Intergenic
1187620616 X:21049353-21049375 GGATAAAGCCTACTTAATCTTGG - Intergenic
1187640404 X:21282301-21282323 GTATGAACCCAACTTGATCATGG - Intergenic
1187644582 X:21333189-21333211 GGATGAAGCCAACTTGATCATGG - Intergenic
1187646454 X:21352478-21352500 GGATGAAGCCAACTTGATCATGG - Intergenic
1188123436 X:26337778-26337800 GGATGAAGTCAGCTTGATCTTGG - Intergenic
1188155178 X:26732951-26732973 GGATGAAGCCGACTTGATCTTGG + Intergenic
1188227162 X:27613793-27613815 GGACGAAGCCAACTTGATCTTGG + Intronic
1188470733 X:30536408-30536430 GGATGAAGCCTACTTAATCGTGG - Intergenic
1188664508 X:32802813-32802835 GGATGAAGCCAACTTGATCATGG + Intronic
1188703163 X:33291057-33291079 GGATGAAGTCGACTTAATCGTGG - Intronic
1189039412 X:37526803-37526825 GGATGAAGCCAACTTGATCGTGG + Intronic
1189542609 X:42007962-42007984 GGATGAATCCCACTTGATCTTGG - Intergenic
1189572172 X:42309805-42309827 GGATGAAGCCAACTTGATCGTGG - Intergenic
1189574664 X:42338794-42338816 GGATGAAGCCAACTTGATCATGG + Intergenic
1189618738 X:42813014-42813036 GGATGAAGCCAACTTGATCGTGG + Intergenic
1189639021 X:43047385-43047407 GTATGAAACCAACTTGATCTTGG + Intergenic
1189939111 X:46102946-46102968 GGATGAAGCCAACTTGATCATGG + Intergenic
1189954957 X:46268432-46268454 AGATGAACTCAAGTTAATATGGG + Intergenic
1190392352 X:49944745-49944767 GGATGAAGCCAACTTGATCGTGG + Intronic
1190420031 X:50220614-50220636 GGATGAAGCCAACTTGATCGTGG + Intronic
1190454395 X:50612677-50612699 GGATGAACCCCACTTGATCATGG - Intronic
1190604123 X:52122949-52122971 GGATGAAGGCAACTTGATCGTGG - Intergenic
1190979849 X:55447058-55447080 GGATGAAGCCAACTTGATCATGG - Intergenic
1191008206 X:55733644-55733666 GGATGAAGCCCACTTGATCTTGG + Intronic
1191012102 X:55771247-55771269 GGATGAACCCAACTTGATCGTGG + Intergenic
1191027550 X:55930725-55930747 GGATGAACCCAGCTTGATCGTGG + Intergenic
1191097130 X:56685354-56685376 GGATGAAGCCAACTTGATCTTGG + Intergenic
1191098810 X:56703047-56703069 GGATGAAGCCAACTTGATCATGG - Intergenic
1191132960 X:57034381-57034403 GGATGAAACCAACTTGATCGTGG + Intergenic
1191156291 X:57277225-57277247 GGATGAAGCCAACTTGATCGTGG - Intergenic
1191158289 X:57299255-57299277 GGATGAACCCCACTTGATCATGG - Intronic
1191595535 X:62939571-62939593 GGATGAAGCCAACTTGATCATGG + Intergenic
1191651307 X:63540810-63540832 GGATGAAGCCAACTTGATCATGG - Intergenic
1191651470 X:63542727-63542749 GGATGAAGCCAACTTGATCATGG - Intergenic
1191655962 X:63599537-63599559 GGATGAAGACCACTTGATCATGG + Intergenic
1191747538 X:64506355-64506377 GGATGAAGCCAACTTGATCATGG - Intergenic
1191762193 X:64657701-64657723 GGATGAAGCCAACTTGATCGTGG + Intergenic
1191766236 X:64701539-64701561 GGATGAAGCCAACTTGATCATGG + Intergenic
1191774564 X:64799689-64799711 GGATGAAGCCAACTTGATCATGG + Intergenic
1191799609 X:65063501-65063523 GGATGAAGCCAACTTGATCGTGG + Intergenic
1191819079 X:65283123-65283145 GGATGAAGCCAGCTTGATCTTGG - Intergenic
1191832014 X:65425802-65425824 GGATGAAGCCAACTTGATCATGG + Intronic
1191872600 X:65761760-65761782 GGATGAAGCCAACTTGATCGTGG + Intergenic
1191882093 X:65853026-65853048 GGATGAAGCCAACTTGATCATGG + Intergenic
1191886154 X:65890350-65890372 GGATGAAGCCAACTTGATTTTGG + Intergenic
1191907051 X:66104643-66104665 GGGTGAAGCCAACTTGATCTTGG + Intergenic
1191929635 X:66356553-66356575 GGATGAAGCCAACTTTATCATGG - Intergenic
1192009586 X:67253993-67254015 GGATGAAGCCGACTTAATCGTGG - Intergenic
1192086470 X:68103177-68103199 GGATGAAGCCAACTTGATCGTGG - Intronic
1192097537 X:68228561-68228583 GGATGAAGCCAACTTGATCGTGG - Intronic
1192160130 X:68779477-68779499 GGATGAAGCCAACTTGATCGTGG - Intergenic
1192371512 X:70517463-70517485 GGTTGAAGCCAACTTGATCTTGG + Intergenic
1192401671 X:70842281-70842303 GGATGAAGCCCACTTAATCATGG - Intronic
1192524897 X:71833747-71833769 GGATGAAGCCAACTTGATCATGG - Intergenic
1192525533 X:71840266-71840288 GGATGAAGCCCACTTGATCTTGG + Intergenic
1192853992 X:74987783-74987805 GGATGAAGTCAACTTGATCTTGG + Intergenic
1192902535 X:75515383-75515405 GGATGAAGCCAACTGGATCTTGG - Intronic
1192925975 X:75755535-75755557 GGATGAAGCCAACTTGATCATGG - Intergenic
1192943777 X:75942211-75942233 GGATGAAGCCAACTTGATCATGG + Intergenic
1192997173 X:76524158-76524180 GGATGAAGCCAACTTGATCATGG + Intergenic
1193010853 X:76673427-76673449 GGATGAAGCCAACTTGATCATGG - Intergenic
1193050358 X:77093058-77093080 GGATGAAGACCACTTGATCATGG - Intergenic
1193314775 X:80051566-80051588 GGATGAAGCCAACTTGATCGTGG + Intergenic
1193318704 X:80095275-80095297 GGATGAAGCCAACTTGATCTTGG - Intergenic
1193338935 X:80323227-80323249 GGATGAAGCCAACTTAATCTTGG - Intergenic
1193343427 X:80379289-80379311 GGATTAAGCCAACTTGATCTTGG + Intronic
1193363023 X:80598333-80598355 GGATGAAGCCCACTTGATCTTGG + Intergenic
1193409671 X:81147296-81147318 GGATGAAGCCAACTTGATCATGG - Intronic
1193413879 X:81198527-81198549 GGATGAAGCCAACTTGATCGTGG - Intronic
1193510367 X:82391895-82391917 GGATGAAGCCAACTTGATCATGG - Intergenic
1193516688 X:82474433-82474455 GGATGAAGCCAACTTGATCATGG + Intergenic
1193590243 X:83380757-83380779 AGATGAAGCCAACTTGATCTTGG - Intergenic
1193594612 X:83431208-83431230 GGATGAAGCCAACTTGATCATGG + Intergenic
1193714577 X:84923090-84923112 GGATGAAGCCTACTTAATCATGG + Intergenic
1193727836 X:85063706-85063728 GGATGAAGCCAACTTGATCATGG + Intronic
1193843842 X:86443839-86443861 GGATGAATCCAACTTAATCGTGG + Intronic
1193897584 X:87132187-87132209 GGATGAATCCAACTTGATCGTGG - Intergenic
1194074411 X:89370711-89370733 GGATGAAGCCAACTTGATCGTGG - Intergenic
1194228835 X:91296854-91296876 GGATGAAGCCAACTTGATCATGG + Intergenic
1194252193 X:91589634-91589656 GGATGAAGCCAACTTGATCATGG - Intergenic
1194337836 X:92670037-92670059 GGATGAAACCCACTTGATCTTGG - Intergenic
1194508735 X:94765931-94765953 GGATGAAGCCAACTTAATCTTGG + Intergenic
1194510856 X:94792630-94792652 GGATGAAGCCAACTTGATCGTGG - Intergenic
1194523465 X:94946453-94946475 GGATGAAGCCAACTTGATCGTGG - Intergenic
1194537933 X:95130517-95130539 GGATGAAAACAACTTAATCATGG - Intergenic
1194708492 X:97203972-97203994 GGATGAAGCCAACTTGATCGTGG - Intronic
1194761424 X:97800258-97800280 GGATGAAGCCAACTTGATCATGG + Intergenic
1194782789 X:98045692-98045714 GGATGAAGCCAACTTGATCATGG + Intergenic
1194949859 X:100112045-100112067 GGATGAAACCAACTTAATCGTGG + Intergenic
1195098360 X:101528133-101528155 GGATGAAGCCAACTTGATCATGG - Intronic
1195102667 X:101570625-101570647 GGATGAAGCCAACTTGATCGTGG - Intergenic
1195139101 X:101940926-101940948 GGATGAAGACCACTTGATCATGG - Intergenic
1195140460 X:101953992-101954014 GGATGAAGCCAACTTGATCGTGG - Intergenic
1195451339 X:105016655-105016677 GGATGAAGCCAACTTGATCGTGG + Intronic
1195518794 X:105807819-105807841 GGATGAAGCCAACTTGATCATGG + Intergenic
1195648591 X:107261154-107261176 GGATGAACACTACTTCAGCCAGG + Intergenic
1195661028 X:107378363-107378385 GGATGAAGACCACTTGATCGTGG + Intergenic
1195774463 X:108388057-108388079 GGATGAAGCCAACTTGATCGTGG + Intronic
1195794729 X:108632631-108632653 GGATGAAGCCAACTTGATCTTGG - Intronic
1195854635 X:109317213-109317235 GGATGAACCCAACTTGATGGTGG + Intergenic
1196019438 X:110974760-110974782 GGATGAAGCCAACTTGATCGTGG - Intronic
1196115535 X:111995306-111995328 GGATGAAGCCAACTTGATTTTGG + Intronic
1196139256 X:112243032-112243054 GGATGAAGCCACCTTGATCTTGG + Intergenic
1196147060 X:112329809-112329831 GGATGAAGCCACCTTGATCTTGG - Intergenic
1196167149 X:112548146-112548168 GGATGAAGCCAACTTCATCGTGG + Intergenic
1196396220 X:115264276-115264298 GGATGGACACCACTGACTCTGGG + Intergenic
1196571626 X:117272141-117272163 GGATGAAGCCGACTTGATCTTGG - Intergenic
1196575186 X:117308851-117308873 TGATGAAGCCAACTTAATCCTGG - Intergenic
1196606924 X:117667848-117667870 GGATGAAACCAACTTGATCATGG + Intergenic
1196621131 X:117825332-117825354 GGATGAAACCCACTTAATCACGG + Intergenic
1196897116 X:120348044-120348066 GGATGAAGCCCACTTGATCTTGG - Intergenic
1196959910 X:120990322-120990344 GGATGAACACAAGGTACTGTGGG + Intergenic
1197061971 X:122191954-122191976 GGATGAAGCCAACTTTATCATGG + Intergenic
1197157600 X:123287064-123287086 GGATGAAGCCAACTTGATCGTGG - Intronic
1197465708 X:126802340-126802362 GGATGAAGTCAACTTGATCGTGG + Intergenic
1197486059 X:127053162-127053184 GGATGAAGCCAACTTGATCATGG + Intergenic
1197594107 X:128446131-128446153 GGATGAAGCCAACTTGATCATGG + Intergenic
1197613948 X:128671359-128671381 GGATGAAGCCAACTTGATCGTGG + Intergenic
1197847395 X:130817568-130817590 GGATGAAGCCAACTTGATCGTGG - Intronic
1198124105 X:133624965-133624987 GGATGAAGCCAACTTGATCGTGG - Intronic
1198191249 X:134308905-134308927 GGATGAAGCCCACTTGATCTTGG - Intergenic
1198328877 X:135602814-135602836 GGATGAAGCCAACTTGATCATGG + Intergenic
1198335476 X:135661855-135661877 GGATGAAGCCAACTTGATCATGG + Intergenic
1198337616 X:135682441-135682463 GGATGAAGCCAACTTGATCATGG - Intergenic
1198361526 X:135900334-135900356 GGATGAAGCCAACTTGATCATGG + Intronic
1198365769 X:135938191-135938213 GGATGAAGCCAACTTGATCGTGG + Intergenic
1198571625 X:137963467-137963489 GGATGAAGCCAACTTGATCGTGG - Intergenic
1198572690 X:137974766-137974788 GGATGAAGCCAACTTGATCGTGG - Intergenic
1198582147 X:138077194-138077216 GGATGAAGCCAACTTGATCGTGG - Intergenic
1198584849 X:138109090-138109112 GGATGAAGCCAACTTGATCGTGG - Intergenic
1198595816 X:138234519-138234541 GGATGAAGCCAACTTGATCATGG - Intergenic
1198687429 X:139241830-139241852 GGATGAAGACTACTTGATCATGG - Intergenic
1198725491 X:139672656-139672678 GGATGAAGCCAACTTGATCATGG + Intronic
1198819946 X:140636727-140636749 GGATGAAGCCAACTTGATCCTGG - Intergenic
1198919054 X:141705031-141705053 GGATGAAGCCAACTTGATCATGG + Intergenic
1199292684 X:146122668-146122690 GGATGAAGCCAACTTGATCTTGG - Intergenic
1199302571 X:146230284-146230306 GGATGAAGCCAACTTGATCATGG + Intergenic
1199436959 X:147823198-147823220 GGATGAAGCCAACTTGATCGTGG - Intergenic
1199437645 X:147830597-147830619 GGATGAAGCCAACTTGATCATGG - Intergenic
1199450263 X:147971222-147971244 GGATGAAGCCAACTTGATCATGG - Intergenic
1199787974 X:151122433-151122455 GGATGAAGCCCACTTGATCTTGG - Intergenic
1199789904 X:151143232-151143254 GGATGAAGCCCACTTGATCTGGG + Intergenic
1199801571 X:151256514-151256536 GGATGAAGCCAACTTGATCATGG - Intergenic
1199812767 X:151367032-151367054 GGATGAAGCCAACTTGATCATGG + Intergenic
1199911493 X:152291853-152291875 GGATGAAGCCAACTTCATCGTGG + Intronic
1200269370 X:154667464-154667486 GGATGAAGCCAACTTGATCATGG + Intergenic
1200333572 X:155323331-155323353 GGATGAAGCCAACTTGATCATGG - Intronic
1200571120 Y:4830874-4830896 GGATGAAGCCAACTTGATCATGG - Intergenic
1200646246 Y:5786777-5786799 GGATGAAACCCACTTGATCTTGG - Intergenic
1201353793 Y:13075553-13075575 GGATGAAGCCAAGTTGATCTTGG - Intergenic
1201392818 Y:13516778-13516800 GGATGAAGCCAACTTAAGCATGG + Intergenic
1201483043 Y:14461173-14461195 GGATGAATCCAGCTTCATCTTGG - Intergenic
1201497926 Y:14609554-14609576 GGATGAACCCGACTTGATCATGG + Intronic
1201506325 Y:14704501-14704523 GGATGAAGCCCACTTAATCATGG + Intronic
1201561166 Y:15318636-15318658 GGATGAAGCCAACTTGATCTTGG + Intergenic
1201563179 Y:15339557-15339579 GGATGAAGCCAACTTGATCCTGG + Intergenic
1201582806 Y:15528590-15528612 GGATGAAGCCCACTTAATCATGG + Intergenic
1201600609 Y:15724659-15724681 GGATGAAGCCCACTTAATCATGG + Intergenic
1201618551 Y:15928855-15928877 GGATGAAGCCCACTTGATCTTGG - Intergenic
1201933072 Y:19375626-19375648 GGATGAAGACCACTTGATCATGG + Intergenic
1201952679 Y:19582819-19582841 GGATGAAGCCCACTTAATCGTGG + Intergenic
1201956244 Y:19626479-19626501 GGATGGACCCAACTTGATCATGG + Intergenic
1202112714 Y:21440510-21440532 GTATGAACCCAACTTGATCATGG + Intergenic
1202256243 Y:22923571-22923593 GGATGAAGCCAACTTGATCGTGG - Intergenic
1202409234 Y:24557324-24557346 GGATGAAGCCAACTTGATCGTGG - Intergenic
1202461548 Y:25112754-25112776 GGATGAAGCCAACTTGATCGTGG + Intergenic