ID: 1107988146

View in Genome Browser
Species Human (GRCh38)
Location 13:45793601-45793623
Sequence TAGGTACCCGGGAAGTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107988138_1107988146 17 Left 1107988138 13:45793561-45793583 CCACTGTATCCGAAGTGTCAGCA 0: 1
1: 0
2: 1
3: 5
4: 90
Right 1107988146 13:45793601-45793623 TAGGTACCCGGGAAGTATGTGGG 0: 1
1: 0
2: 1
3: 1
4: 51
1107988139_1107988146 8 Left 1107988139 13:45793570-45793592 CCGAAGTGTCAGCACAGTGATTG 0: 1
1: 0
2: 1
3: 18
4: 166
Right 1107988146 13:45793601-45793623 TAGGTACCCGGGAAGTATGTGGG 0: 1
1: 0
2: 1
3: 1
4: 51
1107988136_1107988146 19 Left 1107988136 13:45793559-45793581 CCCCACTGTATCCGAAGTGTCAG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1107988146 13:45793601-45793623 TAGGTACCCGGGAAGTATGTGGG 0: 1
1: 0
2: 1
3: 1
4: 51
1107988137_1107988146 18 Left 1107988137 13:45793560-45793582 CCCACTGTATCCGAAGTGTCAGC 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1107988146 13:45793601-45793623 TAGGTACCCGGGAAGTATGTGGG 0: 1
1: 0
2: 1
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107988146 Original CRISPR TAGGTACCCGGGAAGTATGT GGG Intronic
902090040 1:13895764-13895786 TAGGTACTCGGTGAGTACGTGGG - Intergenic
916220365 1:162438085-162438107 TAGTTTCCCGGGAAGTAGGTCGG - Intergenic
918554943 1:185787505-185787527 GAGCTAACAGGGAAGTATGTTGG + Intronic
924334179 1:242970437-242970459 AAGGTACCTTGGAAATATGTAGG - Intergenic
1064620764 10:17214819-17214841 TAGGTTACCGTGAAATATGTTGG - Intergenic
1076429590 10:130392191-130392213 TCTGTACCCGAGAAGTATGCAGG - Intergenic
1077303859 11:1859139-1859161 TGGGAACCCAGGAAGTATGCTGG - Intronic
1080758142 11:35221834-35221856 TGGGTACCCTGGGAGTTTGTTGG + Intronic
1087527347 11:99333050-99333072 AAGCTACCCGGGAAGTTTTTTGG - Intronic
1098148064 12:67517637-67517659 GAGGTACCAGGGGAGTATTTTGG + Intergenic
1102695266 12:114794051-114794073 TAGGTACCCACTATGTATGTCGG - Intergenic
1103183937 12:118939668-118939690 TATATACCTGGGAAGTTTGTAGG + Intergenic
1105452548 13:20513044-20513066 CAGGTACCCCATAAGTATGTAGG + Intronic
1106374583 13:29172991-29173013 TAGGTACACGAGATATATGTTGG - Intronic
1107877693 13:44805175-44805197 TAGGTACTCGATAAGTATTTTGG + Intergenic
1107988146 13:45793601-45793623 TAGGTACCCGGGAAGTATGTGGG + Intronic
1109163643 13:59007130-59007152 TAGGTACCTGGGCAGTGGGTGGG - Intergenic
1114901489 14:27065366-27065388 TATGTGCCCAGGAACTATGTAGG - Intergenic
1134366858 16:13586791-13586813 GAGGTGCCCTGGAAGTATTTGGG - Intergenic
1136061241 16:27728140-27728162 TGGGGGCCCGGGAAGTATGACGG + Intronic
1138468870 16:57215405-57215427 GAGGTACCAGGGAAGTCAGTGGG + Intronic
1139572695 16:67823167-67823189 GAGGTACCCGGGTGGTATCTAGG + Intronic
1139792284 16:69448618-69448640 TAAGTAACCGGGAAGGGTGTGGG - Intronic
1140271159 16:73467469-73467491 TAGGTAGCAGGGAAGTATTCAGG + Intergenic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1153553866 18:6290210-6290232 TAGGTAACCTGGAAGTAGGCTGG - Intronic
1168310929 19:55460412-55460434 CAGGCACCGGGGAAGTCTGTAGG + Intronic
937607777 2:123822551-123822573 TAGGTAGATGGAAAGTATGTAGG + Intergenic
945719051 2:213395759-213395781 TAGTTACCAGGGAAGAATGGGGG + Intronic
948216772 2:236238060-236238082 TAGGTACCAGGTAGGCATGTAGG + Intronic
1168916396 20:1491610-1491632 TAGGTGCCCGGGAGGGAGGTGGG + Intergenic
1177733218 21:25056097-25056119 TAAGTACCCTAGAAATATGTTGG + Intergenic
1178246412 21:30957234-30957256 TGGTTACCAGGGAAGAATGTAGG + Intergenic
1180001402 21:44997061-44997083 TAGGTGCCTGGGAAGAAGGTGGG + Intergenic
1182603857 22:31489107-31489129 TGGGAACCCGCGAAGTCTGTTGG + Intronic
949331630 3:2929975-2929997 TAGTAACCAGGGAAGGATGTGGG - Intronic
971055663 4:22910170-22910192 TAGGGAGCCTGGAATTATGTGGG - Intergenic
973301442 4:48589449-48589471 TAGGTACCCCGGATGTATGTGGG - Intronic
975785313 4:77881383-77881405 TAGATACCTAGGAAGTATTTTGG + Intronic
979242932 4:118464843-118464865 AAGGTACCTTGGAAATATGTGGG + Intergenic
981613824 4:146625091-146625113 TAGCGACCTGGAAAGTATGTTGG + Intergenic
988580885 5:32467842-32467864 TAGCAACCTGGGAATTATGTTGG + Intergenic
1000198387 5:158983257-158983279 TAAGTCCCAAGGAAGTATGTAGG + Intronic
1007119161 6:39366076-39366098 CAGGTGCCCTGGAAGTGTGTGGG + Intronic
1015455939 6:133426274-133426296 TAGGTACTCGGCAAATATTTTGG + Intronic
1016277626 6:142373407-142373429 TAGGTATCCAGGAAGTATTGTGG - Intronic
1024924367 7:54597727-54597749 AATGTACCCCGGAAATATGTGGG + Intergenic
1029482063 7:100819448-100819470 TGGGTACCCCGGAAGTGTGAGGG - Intronic
1043028460 8:75101836-75101858 TAGGTAGCCTGAAAGTAAGTGGG - Intergenic
1047689017 8:127331557-127331579 TAGTTACCAGGGAAGAATGGAGG + Intergenic
1061119095 9:128632321-128632343 CAGGTACCCGGGAGGGCTGTGGG + Exonic
1185721483 X:2385645-2385667 TAGGTAACAGGGAAGCATTTGGG - Intronic
1187727636 X:22220258-22220280 TAGGCATCCAGGAAGGATGTTGG - Intronic
1190064988 X:47233516-47233538 TAGGAACCTGGGAAGAAGGTGGG + Intronic