ID: 1107988352

View in Genome Browser
Species Human (GRCh38)
Location 13:45795420-45795442
Sequence AGAGTTTCCCAGCACTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 1, 2: 0, 3: 19, 4: 238}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107988346_1107988352 30 Left 1107988346 13:45795367-45795389 CCTCCAGTCACAGACCTGCTAAT 0: 1
1: 3
2: 3
3: 16
4: 177
Right 1107988352 13:45795420-45795442 AGAGTTTCCCAGCACTCAGCAGG 0: 1
1: 1
2: 0
3: 19
4: 238
1107988351_1107988352 -1 Left 1107988351 13:45795398-45795420 CCAGGTAGGTGATACTTGTATGA 0: 1
1: 0
2: 0
3: 6
4: 156
Right 1107988352 13:45795420-45795442 AGAGTTTCCCAGCACTCAGCAGG 0: 1
1: 1
2: 0
3: 19
4: 238
1107988347_1107988352 27 Left 1107988347 13:45795370-45795392 CCAGTCACAGACCTGCTAATCTG 0: 2
1: 3
2: 6
3: 18
4: 127
Right 1107988352 13:45795420-45795442 AGAGTTTCCCAGCACTCAGCAGG 0: 1
1: 1
2: 0
3: 19
4: 238
1107988349_1107988352 16 Left 1107988349 13:45795381-45795403 CCTGCTAATCTGTGACACCAGGT 0: 1
1: 2
2: 1
3: 11
4: 122
Right 1107988352 13:45795420-45795442 AGAGTTTCCCAGCACTCAGCAGG 0: 1
1: 1
2: 0
3: 19
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107988352 Original CRISPR AGAGTTTCCCAGCACTCAGC AGG Intronic
900370297 1:2329223-2329245 AGACGTGCCCAGCGCTCAGCGGG - Intronic
901188309 1:7389007-7389029 AGAGCCTCCCAGCACTGAGTAGG + Intronic
903344457 1:22675525-22675547 AGAGATGCCCTGCACACAGCAGG + Intergenic
903445931 1:23423178-23423200 AGAAGCTCCCAGCACTCTGCAGG + Intronic
903626051 1:24730823-24730845 CGAGTTCCCCAGCTCTGAGCCGG - Intergenic
906689554 1:47783642-47783664 AGAGGTTCCCTGCTCTGAGCAGG + Intronic
907513083 1:54976974-54976996 ACAGTTTGCCAGCACTCCCCAGG + Intergenic
908639290 1:66204335-66204357 AGGTTCTCCCAGCACACAGCTGG - Intronic
908765358 1:67549708-67549730 TGGGTCTCCCAGCACGCAGCTGG - Intergenic
908793298 1:67804371-67804393 AAACTTTCCAAGCACTCAGCTGG + Intronic
910381299 1:86629835-86629857 TGATTCTCCCAGCACGCAGCTGG - Intergenic
911225219 1:95297602-95297624 TGATTCTCCCAGCACACAGCTGG - Intergenic
912451078 1:109768186-109768208 AGAGTTTCCCAGCTCTGACCAGG - Intronic
916226077 1:162490642-162490664 AGAGTTTCCAAGAACTGACCTGG + Intergenic
916454629 1:164958348-164958370 AGAGTGTTCCAGTACTCAGCAGG + Intergenic
917259768 1:173154364-173154386 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
918785449 1:188757601-188757623 TGGTTCTCCCAGCACTCAGCTGG - Intergenic
923099027 1:230797707-230797729 AGAGCGTGCCAGCACTGAGCTGG - Intronic
924780417 1:247142010-247142032 TGAGATTCCCAGCCCTCAGCAGG - Intronic
1063480808 10:6375008-6375030 TGGTTCTCCCAGCACTCAGCTGG - Intergenic
1065814791 10:29473819-29473841 AGAGCTCCCCAGGACTCACCTGG + Exonic
1067783785 10:49227971-49227993 AGTGGGGCCCAGCACTCAGCCGG - Intergenic
1068642687 10:59427536-59427558 TGATTCTCCCAGCACGCAGCTGG - Intergenic
1071923816 10:90382148-90382170 AGCGTTTCCAATCACTAAGCTGG - Intergenic
1075925378 10:126247544-126247566 TGAGTTTCTCAGGACTGAGCCGG - Intronic
1079380713 11:19934757-19934779 AGAAAGCCCCAGCACTCAGCAGG - Intronic
1079629112 11:22652288-22652310 TGGTTTTCCCAGCACACAGCTGG - Intronic
1081496624 11:43617679-43617701 TGAGTCACCCAGCACACAGCAGG + Intronic
1082559144 11:54598485-54598507 TGATTCTCCCAGCACGCAGCTGG + Intergenic
1082629140 11:55520569-55520591 TGGTTCTCCCAGCACTCAGCTGG - Intergenic
1082744283 11:56945510-56945532 TGATTCTCCCAGCACGCAGCTGG - Intergenic
1082770658 11:57205155-57205177 AGAGCTTTCCAGCAGTCAGCAGG - Intergenic
1082774868 11:57237135-57237157 AGTCCTTCCCAGCACTCAGGAGG + Exonic
1083305869 11:61761675-61761697 ATAGTATCCCAGCACACAGCAGG - Intronic
1084185632 11:67469340-67469362 AGAGTTGCCGAGCCCTGAGCGGG + Intergenic
1084441299 11:69175204-69175226 TGAGTTTGCCAGAACTCAGCTGG - Intergenic
1085783254 11:79428627-79428649 GGCATTTCCCAGCACTCAGAAGG + Intronic
1085980083 11:81714321-81714343 ACACTTTCCCACCACTCAACAGG - Intergenic
1086142971 11:83519225-83519247 AGTCTTCCCTAGCACTCAGCAGG + Intronic
1086523997 11:87703558-87703580 TGGTTCTCCCAGCACTCAGCTGG - Intergenic
1087420837 11:97923353-97923375 TGATTCTCCCAGCACGCAGCTGG + Intergenic
1087590150 11:100176941-100176963 AGATCTTCCCAGCACAGAGCAGG + Intronic
1087882530 11:103434781-103434803 AGAGACCCCCAGCTCTCAGCCGG - Intronic
1088598388 11:111456225-111456247 CGGGATTCCCAGGACTCAGCAGG - Intronic
1088844966 11:113657242-113657264 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
1089577199 11:119453606-119453628 TGTGTTTCCCAGTTCTCAGCTGG + Intergenic
1090509923 11:127363800-127363822 TGATTCTCCCAGCACGCAGCTGG + Intergenic
1093629877 12:21395647-21395669 TGGGTCTCCCAGCACGCAGCTGG + Intronic
1095059525 12:37666085-37666107 TGTTTCTCCCAGCACTCAGCTGG - Intergenic
1095151054 12:38797195-38797217 TGGTTCTCCCAGCACTCAGCTGG + Intronic
1099106813 12:78507069-78507091 TGATTCTCCCAGCACACAGCTGG + Intergenic
1103481894 12:121255759-121255781 TGAGTGTCCCAGCTCCCAGCAGG - Intronic
1106613251 13:31302951-31302973 TGGTTCTCCCAGCACTCAGCTGG + Intronic
1107433084 13:40356927-40356949 TGGGTCTCCCAGCACGCAGCTGG + Intergenic
1107680778 13:42847892-42847914 AGATTTTCTCAACATTCAGCAGG - Intergenic
1107828148 13:44349752-44349774 TGAGCATCCCAGGACTCAGCAGG - Intergenic
1107988352 13:45795420-45795442 AGAGTTTCCCAGCACTCAGCAGG + Intronic
1111703463 13:91719240-91719262 AGACTTTGGCAGCAGTCAGCAGG - Intronic
1111778251 13:92690934-92690956 TGGTTCTCCCAGCACTCAGCTGG - Intronic
1111783025 13:92753112-92753134 TGGTTCTCCCAGCACTCAGCTGG + Intronic
1112748849 13:102559784-102559806 AGAATTTCCCTGCACTTACCAGG - Intergenic
1112899937 13:104345847-104345869 TGATTCTCCCAGCACGCAGCTGG - Intergenic
1113069186 13:106403060-106403082 AGAGTCTCCCAGACCTCGGCAGG + Intergenic
1114156633 14:20110711-20110733 AGAGTTTTCCAGCACTTATTAGG + Intergenic
1114945322 14:27673697-27673719 TGGTTTTCCCAGCACGCAGCTGG + Intergenic
1117665790 14:58054355-58054377 AGCCTTTCCCATCACTCAGCTGG - Intronic
1117802694 14:59461600-59461622 AGATTTTCCCTTCACTCACCAGG + Exonic
1119205493 14:72790898-72790920 AGACTTCCGCAGCACCCAGCAGG - Intronic
1120463344 14:84825286-84825308 AGAATGCCACAGCACTCAGCAGG - Intergenic
1121297678 14:92842834-92842856 AGCCTTTTCCAACACTCAGCTGG - Intergenic
1122056150 14:99099557-99099579 GGAGATTCCCAGCACCAAGCCGG + Intergenic
1122720546 14:103719630-103719652 AGGCTTTCCCAGCACACTGCAGG + Intronic
1123161500 14:106282581-106282603 ACATTTTGCCAGCACGCAGCTGG + Intergenic
1125973156 15:43928606-43928628 AGGGTATCCCAGGACGCAGCTGG - Intronic
1126722046 15:51591582-51591604 TGGTTCTCCCAGCACTCAGCTGG + Intronic
1128902321 15:71435817-71435839 AGACTTTCCCAGCACTAACCAGG + Intronic
1129048247 15:72756212-72756234 AGAATTTCACAGATCTCAGCTGG - Intronic
1129048487 15:72758026-72758048 AGAATTTCACAGATCTCAGCTGG - Intronic
1132285391 15:100658703-100658725 AGAGTCTGTCAGCACTCAGGAGG + Intergenic
1132503727 16:296629-296651 AGCCTTCCCCAGCCCTCAGCAGG + Intronic
1132536237 16:482495-482517 AGAGTGCGCCAGCAGTCAGCGGG - Intronic
1132943002 16:2517579-2517601 CCTGTGTCCCAGCACTCAGCAGG - Intronic
1134529331 16:14970723-14970745 GGATTTCCTCAGCACTCAGCTGG - Intergenic
1136062308 16:27735091-27735113 AAAGGTTTCCAGCACTCTGCAGG - Intronic
1136996488 16:35194396-35194418 AGAATTTCCCAGAGCTCACCAGG + Intergenic
1138324756 16:56155146-56155168 TGATTTTCCCAGCACGCAGCTGG + Intergenic
1138796637 16:59977239-59977261 TGATTCTCCCAGCACGCAGCTGG + Intergenic
1139867018 16:70070231-70070253 GGATTTCCTCAGCACTCAGCTGG + Intergenic
1140991841 16:80220339-80220361 TGGTTTTCCCAGCACACAGCTGG + Intergenic
1141868693 16:86769478-86769500 AGAGGCTCCCAGCACTCTGGGGG + Intergenic
1142491837 17:284602-284624 AGAGGTTTCCAGCTGTCAGCAGG + Intronic
1143826907 17:9616623-9616645 TGGTTCTCCCAGCACTCAGCTGG + Intronic
1145394675 17:22485776-22485798 GGAGTCTCCCAGCACTAATCAGG + Intergenic
1145924334 17:28634456-28634478 AGAGCTCCCCAGAGCTCAGCGGG + Intronic
1147906431 17:43825994-43826016 TGAGGTGCCCAGCACTTAGCAGG - Intronic
1149371928 17:56003029-56003051 TGATTCTCCCAGCACGCAGCTGG + Intergenic
1154346137 18:13545139-13545161 AGAGATCCCCTGCAATCAGCTGG - Intronic
1160704288 19:522710-522732 CCAGTTTCCCAGCACTGAGCTGG + Intergenic
1162446763 19:10728085-10728107 AAAATTTCCCACCACCCAGCAGG - Intronic
1163003896 19:14385551-14385573 GGCGGTTCCCAGCACTCAGGGGG - Intronic
1164429936 19:28178220-28178242 TGATTCTCCCAGCACACAGCTGG + Intergenic
1164595384 19:29528252-29528274 AGAGTTTCCCAGGAGGAAGCGGG - Intronic
1164700817 19:30282667-30282689 ACAGGTCCCCAGCACCCAGCCGG - Intronic
1165084470 19:33333977-33333999 TGAGTTTACCAGAACCCAGCTGG - Intergenic
1165733708 19:38162788-38162810 AGAGGTTCCAAGCCCTCTGCTGG + Intronic
1165828233 19:38717756-38717778 AGGGCCCCCCAGCACTCAGCAGG - Intronic
1168138850 19:54370998-54371020 AGACTTTACCAGCACACTGCTGG + Intergenic
1168159175 19:54497506-54497528 AGACTTTACCAGCACACTGCTGG - Intergenic
926401671 2:12503393-12503415 AGAGTTTCCTGGAACTCAGAGGG - Intergenic
927084288 2:19659212-19659234 AAAGTTTGGCAGCACTCATCTGG + Intergenic
927243512 2:20938667-20938689 AGAGTTTCCAGACACTCAGAGGG + Intergenic
930922768 2:56777336-56777358 TGGTTCTCCCAGCACTCAGCTGG - Intergenic
932984323 2:76707448-76707470 TGATTCTCCCAGCACGCAGCTGG - Intergenic
935633876 2:105235015-105235037 AGAGTCTCCCAGCCACCAGCTGG + Intergenic
938970926 2:136431772-136431794 AGGGTGTCCCAGCCCTGAGCAGG + Intergenic
939955902 2:148527488-148527510 TACTTTTCCCAGCACTCAGCTGG + Intergenic
942879236 2:180839031-180839053 TGGGTCTCCCAGCACGCAGCTGG - Intergenic
943679832 2:190756618-190756640 AGACTTTTACAGCACTGAGCAGG - Intergenic
947767742 2:232648394-232648416 ACTGTTTCCCAGCCCGCAGCTGG + Intronic
947887222 2:233583207-233583229 TGGTTCTCCCAGCACTCAGCTGG - Intergenic
948287044 2:236793871-236793893 AGAGTCAGCCAGCACTCAGATGG - Intergenic
1169281615 20:4272483-4272505 AGTGTTTCCCAACACTCACATGG - Intergenic
1170246061 20:14223034-14223056 AGAGTATATCAGCACTGAGCTGG + Intronic
1170250048 20:14271140-14271162 TGATTCTCCCAGCACACAGCTGG + Intronic
1170689576 20:18601548-18601570 TGGGTCTCCCAGCACGCAGCTGG + Intronic
1172102167 20:32491537-32491559 AGAGTTACCCTGCACACAGTAGG + Intronic
1172221616 20:33278038-33278060 TGAAAATCCCAGCACTCAGCCGG + Intronic
1174185929 20:48706293-48706315 AGAGTTTCCTGGCACTCAGTTGG - Intronic
1174725973 20:52862426-52862448 TGATTTTCCCAGCAATCATCAGG + Intergenic
1175390243 20:58622539-58622561 AGAGGTGACCAGCACTGAGCAGG - Intergenic
1175682459 20:61000000-61000022 TGAGTTTCCCAGCACAAAGAAGG + Intergenic
1177174369 21:17688824-17688846 CGAGTTTCCCAGCTCTGGGCTGG + Intergenic
1181980720 22:26764040-26764062 AGACATTCCCAGCAGTCAACAGG + Intergenic
1182969104 22:34555049-34555071 TGGGTCTCCCAGCACGCAGCTGG - Intergenic
1183251393 22:36732847-36732869 AGTGTTTCCCAGGACTGAGGAGG - Intergenic
1183818335 22:40322850-40322872 AGTGTTTCCCAACACACACCTGG - Exonic
1184160868 22:42696612-42696634 CTAGGTTCCCAGCACGCAGCAGG + Intronic
1185146040 22:49137231-49137253 AGTGAGTCCCAGCCCTCAGCAGG + Intergenic
949831063 3:8214917-8214939 AGATTTATGCAGCACTCAGCAGG - Intergenic
950451678 3:13068934-13068956 AGTGGTTCCCAGCACTGAGCTGG + Intronic
951573942 3:24094832-24094854 TGGTTCTCCCAGCACTCAGCTGG - Intergenic
951939289 3:28059880-28059902 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
952994802 3:38869071-38869093 ATAGTCACCCAGCACTCTGCTGG - Intronic
953969279 3:47334518-47334540 TGATTTTCCCAGAACTCACCTGG + Intronic
955405544 3:58623492-58623514 CGAGGTGCCCAGCACTCAGTGGG - Intronic
957727558 3:84087276-84087298 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
960573155 3:119205265-119205287 AGCGTTTGCCAGCATCCAGCAGG - Intergenic
961355022 3:126332195-126332217 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
962442889 3:135439199-135439221 TGATTCTCCCAGCACACAGCTGG - Intergenic
967287903 3:187890838-187890860 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
967309976 3:188096509-188096531 AGAGTTTCACACCAGTGAGCTGG - Intergenic
970008562 4:11433515-11433537 AAGGTATTCCAGCACTCAGCAGG - Intergenic
970437697 4:16051418-16051440 AATGTTTCCCAGCACTCAAAAGG - Intronic
972177559 4:36427215-36427237 AGAGCTACCCAGCACTTTGCAGG + Intergenic
972854801 4:43093507-43093529 TGGTTTTCCCAGCACGCAGCTGG + Intergenic
973776228 4:54244214-54244236 TGATTCTCCCAGCACACAGCTGG + Intronic
973876930 4:55229526-55229548 TGAGATTCCCAGCAAGCAGCAGG - Intergenic
974830856 4:67187581-67187603 TGAGTTTCCAAGGACTCAACTGG + Intergenic
975158744 4:71101545-71101567 TGGTTTTCCCAGCACACAGCTGG + Intergenic
977510158 4:97952578-97952600 AGACTTTCCCAGCACCAACCTGG - Intronic
978825093 4:113013048-113013070 AAAGTTTCCCTGCAATCAGTTGG + Intronic
979640117 4:123003800-123003822 TGGTTTTCCCAGCACGCAGCTGG - Intronic
979873834 4:125862593-125862615 AGAGTTTCCCAGCACTCAGTAGG - Intergenic
984864013 4:184265711-184265733 AGAATTTCTCACCACTCTGCAGG + Intergenic
985521439 5:375720-375742 AGGGTGTCCCAGCAAGCAGCTGG - Intronic
985656903 5:1137085-1137107 AGTGTTTCCCAGCCCAGAGCTGG + Intergenic
985822902 5:2172468-2172490 AGAGTTGCCCAGCTCTCAAGAGG + Intergenic
988646533 5:33101387-33101409 TGATTCTCCCAGCACACAGCTGG - Intergenic
991320775 5:65370898-65370920 TGATTCTCCCAGCACACAGCTGG + Intronic
992497200 5:77305540-77305562 AGAGTTTCCCAGCATAGAGCAGG + Intronic
992576498 5:78118827-78118849 TGGTTTTCCCAGCACGCAGCTGG + Intronic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
996378529 5:122841066-122841088 AAAGTATCCCTGCCCTCAGCTGG + Intergenic
997426737 5:133808322-133808344 AGAGTGTCCCAGGACAGAGCAGG + Intergenic
997528297 5:134567359-134567381 CCTGTTTCCCAGCACACAGCTGG - Intronic
997838805 5:137219360-137219382 AGAGTATCCCAACACTTAGCAGG + Intronic
999534731 5:152504007-152504029 AAAATTTCCCAGGACTCGGCTGG - Intergenic
1000274720 5:159723733-159723755 GGAGCTTCCCAGAACTCAGAAGG + Intergenic
1001945272 5:175773022-175773044 TGGGTTTACCAGCCCTCAGCAGG - Intergenic
1003381760 6:5630746-5630768 AGAGTTCCCCAGCACTGGGGTGG + Intronic
1004807635 6:19221463-19221485 TGGGTCTCCCAGCACGCAGCTGG + Intergenic
1005263212 6:24083481-24083503 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
1005922609 6:30415575-30415597 AGGGTTTCCCAGGACAGAGCTGG - Intergenic
1006878257 6:37317015-37317037 AGAGTTTCCCACCTCCCAGAAGG + Intronic
1007046063 6:38775255-38775277 AGGGTTTCCCAGGTCTCATCAGG + Intronic
1008636878 6:53419587-53419609 GGAGTTTCCCAGTAATCAGATGG + Intergenic
1008825206 6:55685296-55685318 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
1008915744 6:56785207-56785229 TGGTTCTCCCAGCACTCAGCTGG - Intronic
1009889467 6:69663207-69663229 GGTGTTTCCCAGCCATCAGCAGG - Intergenic
1010029403 6:71257530-71257552 TCAGTTTTGCAGCACTCAGCAGG + Intergenic
1010677257 6:78758772-78758794 TGGTTTTCCCAGCACACAGCTGG + Intergenic
1011012302 6:82715854-82715876 TGATTCTCCCAGCACACAGCTGG + Intergenic
1011299841 6:85862779-85862801 TGGTTTTCCCAGCACGCAGCTGG - Intergenic
1011379945 6:86732027-86732049 TGGATTTCCCAGCACGCAGCTGG + Intergenic
1012087744 6:94851769-94851791 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
1013323452 6:109019359-109019381 AGATTCCCCCAGCACTCTGCTGG - Intronic
1013433667 6:110080131-110080153 AGAGTTGCCCAGCACAGAGAGGG + Intergenic
1014970820 6:127813127-127813149 GGAATTTCCCAGCACTCCGTGGG + Exonic
1015454736 6:133413770-133413792 AGAGATATCCAGCAGTCAGCAGG - Intronic
1015899653 6:138051652-138051674 TGATTCTCCCAGCACACAGCTGG - Intergenic
1016580873 6:145628406-145628428 AGAGTCTACCAGGCCTCAGCAGG - Intronic
1018540328 6:164872895-164872917 ATAGTTTCCCAGGAGTGAGCTGG - Intergenic
1019828743 7:3304767-3304789 AGAGTTTCCAGGAAGTCAGCAGG - Intronic
1021201152 7:17729733-17729755 AGACTTTCCCAGAACTGACCAGG - Intergenic
1021746091 7:23742642-23742664 AGCCTTTCCCAGCTCTCAGCTGG + Intronic
1021906169 7:25335700-25335722 AGAATGTCCCAGCTCTCTGCAGG + Intergenic
1023504317 7:40884436-40884458 TGAGTTTCCCTGAACTCAGTGGG + Intergenic
1024049242 7:45608496-45608518 AGAGTCACCCAGCTATCAGCTGG - Intronic
1024175939 7:46841240-46841262 TTAGTTTCCCATCACTAAGCAGG - Intergenic
1024337749 7:48226364-48226386 AGAGGGTCTCAGAACTCAGCAGG - Intronic
1024538267 7:50456548-50456570 GGACTTTCCCAACACTAAGCAGG + Intronic
1026029878 7:66781876-66781898 AGAGTGTCCCAGCTCACTGCTGG - Intronic
1026212306 7:68316421-68316443 AGAGTTGCCCAGAACACAGCTGG - Intergenic
1027208252 7:76121222-76121244 AGAGTGTCCCAGCTCACTGCTGG + Intergenic
1031848206 7:126831198-126831220 TGGTTCTCCCAGCACTCAGCTGG - Intronic
1033623871 7:143088924-143088946 TGGTTCTCCCAGCACTCAGCTGG + Intergenic
1033893446 7:146043207-146043229 CGGTTCTCCCAGCACTCAGCTGG - Intergenic
1034375880 7:150643404-150643426 AGAGGCTCCCAGCTTTCAGCGGG - Intergenic
1037232073 8:16670756-16670778 TGGTTTTCCCAGCACGCAGCTGG + Intergenic
1037476669 8:19264552-19264574 AGCTTTGCTCAGCACTCAGCTGG - Intergenic
1038515314 8:28183000-28183022 AGAGTTATTCAGCACTCAGTGGG - Intronic
1040313999 8:46251327-46251349 GGAGTTTCCCAGCATTCCCCCGG - Intergenic
1040691162 8:49940273-49940295 AGAGGATCCCAGCACCCAGGCGG + Intronic
1041806038 8:61850495-61850517 TGGTTCTCCCAGCACTCAGCTGG - Intergenic
1042696084 8:71556617-71556639 GCAGGTTCCCAGCTCTCAGCTGG + Intronic
1043480750 8:80649816-80649838 TGATTCTCCCAGCACGCAGCTGG + Intronic
1044061878 8:87648658-87648680 TGGTTTTCCCAGCACACAGCTGG + Intergenic
1044453875 8:92369552-92369574 TGATTCTCCCAGCACGCAGCTGG - Intergenic
1044915880 8:97112411-97112433 AGAGTTACCCAGAAGTCAGCTGG + Intronic
1047772238 8:128038834-128038856 AGACCTGCCCAGCTCTCAGCAGG - Intergenic
1049112642 8:140657500-140657522 AGAGTTTACCTGCAGTTAGCCGG - Intergenic
1050941057 9:11458507-11458529 AGAGATTCCCTGCAGTAAGCAGG - Intergenic
1053523780 9:38808452-38808474 AGAGATTTCCAGCACTCACTGGG + Intergenic
1054196010 9:62032866-62032888 AGAGATTTCCAGCACTCACTGGG + Intergenic
1054642395 9:67555823-67555845 AGAGATTTCCAGCACTCACTGGG - Intergenic
1054966775 9:71037409-71037431 AGAGTTTCCTAAAACTCAGTAGG + Intronic
1055827585 9:80345513-80345535 TGATTCTCCCAGCACGCAGCTGG + Intergenic
1056093522 9:83228301-83228323 TGGGTCTCCCAGCACGCAGCTGG - Intergenic
1057065679 9:92048428-92048450 AGAGTTTCTCAAAACTCTGCTGG - Intronic
1059169659 9:112113259-112113281 GGAGTTTCCCATCATTCTGCTGG - Intronic
1059470684 9:114503166-114503188 GGAGTTTCCCAGCAGCCAGCAGG + Intronic
1060465827 9:123903996-123904018 TGGTTTTCCCAGCACACAGCTGG + Intronic
1060551188 9:124486167-124486189 ATGGCTTCCCAGCTCTCAGCAGG + Intronic
1060819477 9:126652960-126652982 AGTCTTGCCCAGCCCTCAGCTGG - Intronic
1185477506 X:424280-424302 AGGGTTTCCCAGCAGCCTGCAGG + Intergenic
1190822307 X:53985196-53985218 AGCTTCTCCCAGCACTCAGGAGG - Exonic
1191565049 X:62517738-62517760 TGATTCTCCCAGCACACAGCTGG + Intergenic
1191728001 X:64301933-64301955 TGGGTCTCCCAGCACGCAGCTGG - Intronic
1195509478 X:105697538-105697560 ATAGTTCCCAAGCAGTCAGCTGG - Intronic
1196141742 X:112270477-112270499 AGCATTACCCAGCACCCAGCAGG + Intergenic
1196400464 X:115311347-115311369 AGATTTTCTAAGCACACAGCAGG + Intergenic
1197864222 X:131000779-131000801 AGAAACTCCCAGCACTCAACAGG - Intergenic
1197927747 X:131664590-131664612 AGGTTCTCCCAGCACGCAGCTGG + Intergenic
1198703174 X:139418669-139418691 AGAGTTGCCCAGCAACAAGCTGG - Intergenic
1199318913 X:146415248-146415270 ACACTTTGCCAGCACTGAGCAGG - Intergenic
1201431773 Y:13909901-13909923 TGATTCTCCCAGCACGCAGCTGG + Intergenic
1201621417 Y:15962861-15962883 AGAGTTTACCACCATTCAGGAGG + Intergenic
1201795920 Y:17896185-17896207 AGAGTATTCCAACACTCAGTTGG - Intergenic
1201805635 Y:18009800-18009822 AGAGTATTCCAACACTCAGTTGG + Intergenic