ID: 1107989822

View in Genome Browser
Species Human (GRCh38)
Location 13:45810008-45810030
Sequence GACTCAGGACTAGCTCGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107989822_1107989829 17 Left 1107989822 13:45810008-45810030 CCTGGTCGAGCTAGTCCTGAGTC 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1107989829 13:45810048-45810070 TAAAGCAGCCCAGAGCCCTGAGG 0: 1
1: 0
2: 2
3: 22
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107989822 Original CRISPR GACTCAGGACTAGCTCGACC AGG (reversed) Intronic
919834297 1:201563182-201563204 GACTCAGGGCTAGCTGCCCCTGG + Intergenic
922937930 1:229435087-229435109 AACCCAGGACTGGCTAGACCTGG + Intergenic
922999147 1:229991794-229991816 GATTCAGGAGTAGCTCAGCCAGG + Intergenic
1073851195 10:107620198-107620220 GACTCAGGAATAACACAACCTGG + Intergenic
1074049401 10:109868389-109868411 GAAACAGGACTATCTCCACCTGG + Intronic
1084777512 11:71387230-71387252 GATTCAGGGCCAGCTCGACAGGG + Intergenic
1085043823 11:73342269-73342291 GACACAGGACAAGCTGGATCCGG + Intronic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1126330720 15:47528105-47528127 GACTCAGGATTACATCAACCAGG - Intronic
1132548944 16:546454-546476 AACTCAGGACCAGGTCGTCCTGG - Intronic
1132641712 16:981165-981187 GACTCTGGACGAGCTGGGCCTGG + Intronic
1132997268 16:2829836-2829858 GACCCAGGCCGAGCTCGACGCGG - Intergenic
1139675749 16:68522285-68522307 GCCTCAGGACAATCTAGACCAGG + Intergenic
1148825775 17:50392852-50392874 TACTCAGGTCTAGCTTCACCAGG + Exonic
931881658 2:66576226-66576248 GACTCAGGGGTAGCACGTCCTGG - Intergenic
937071952 2:119070925-119070947 GACACAGGACTAGCTGGAAGAGG - Intergenic
941489871 2:166129990-166130012 GACTCAGGACCAGGTGGACCAGG + Intergenic
942307038 2:174618786-174618808 GACTCAGGACTAGCCCCACAGGG - Intronic
945674015 2:212833357-212833379 GACTCAGTAGTAGCCAGACCTGG + Intergenic
947579576 2:231306591-231306613 CAATCAGAACTAGCTAGACCGGG + Intronic
1171034781 20:21706084-21706106 GACCCAGGACTGGGTCGCCCAGG - Intronic
1172442172 20:34973549-34973571 GACTCAGGCAGAGGTCGACCAGG - Intergenic
1173599500 20:44283275-44283297 GACTCAGGCCTGGCACCACCTGG - Intergenic
1182470954 22:30547978-30548000 CAATCAGGACTATCTGGACCTGG + Intergenic
1183779574 22:39990071-39990093 GACTCAGGACCAGAGAGACCGGG + Intergenic
1183884053 22:40862240-40862262 GACTCTGGACTAGCTCTATTTGG - Intronic
954827138 3:53383966-53383988 GAGTCAGGAGTAGCACTACCAGG + Intergenic
956948625 3:74253669-74253691 GGCTCAGGACTAGCTAGGCTAGG + Intergenic
968624629 4:1621602-1621624 GAATCAGGATTAGCTCCACTGGG + Intronic
969558969 4:7933661-7933683 AGCTCAGGACTAGCTAGGCCAGG - Intronic
985777232 5:1851228-1851250 GACTCAGGACTGCCTGGACGCGG - Intergenic
988042821 5:25910737-25910759 GACTCAGGAATAGCTGGCCTTGG + Intergenic
990278846 5:54228401-54228423 TATTCAGGACTAGCTCAAACAGG + Intronic
1013427263 6:110024078-110024100 GACTCAGGCCTCACTCAACCAGG - Intergenic
1016847028 6:148578702-148578724 GACTCAGGATTAGGTCCACATGG - Intergenic
1019739521 7:2665795-2665817 GGCTCAGGAAGAGCTCGGCCCGG - Intergenic
1026972102 7:74474779-74474801 GCCTCAGGGCTAGCTGGGCCTGG - Intronic
1032987280 7:137352116-137352138 GCTTCAGGACTAGCTCATCCAGG + Intergenic
1035741009 8:1928743-1928765 GACTCAGGAGTAGCCCGTGCAGG + Intronic
1035783256 8:2244969-2244991 GGCTCAGGGCCAGCTCTACCTGG - Intergenic
1035808868 8:2474617-2474639 GGCTCAGGGCCAGCTCTACCTGG + Intergenic
1045264128 8:100604547-100604569 GATGCAGGACTAGCCCCACCTGG + Intronic
1046016074 8:108606896-108606918 AACTCAGGAATAGCTTGACTGGG + Intronic
1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG + Intronic
1193731409 X:85107942-85107964 CACTCAGGACTAGTTCGCTCAGG + Exonic