ID: 1107989822

View in Genome Browser
Species Human (GRCh38)
Location 13:45810008-45810030
Sequence GACTCAGGACTAGCTCGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107989822_1107989829 17 Left 1107989822 13:45810008-45810030 CCTGGTCGAGCTAGTCCTGAGTC 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1107989829 13:45810048-45810070 TAAAGCAGCCCAGAGCCCTGAGG 0: 1
1: 0
2: 2
3: 22
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107989822 Original CRISPR GACTCAGGACTAGCTCGACC AGG (reversed) Intronic