ID: 1107992022

View in Genome Browser
Species Human (GRCh38)
Location 13:45827011-45827033
Sequence CTGTTAGCCATGAAGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 330}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107992022_1107992023 8 Left 1107992022 13:45827011-45827033 CCTTTTTTCTTCATGGCTAACAG 0: 1
1: 0
2: 0
3: 23
4: 330
Right 1107992023 13:45827042-45827064 TTTCATTCATGTCAGCTAAGTGG 0: 1
1: 0
2: 0
3: 17
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107992022 Original CRISPR CTGTTAGCCATGAAGAAAAA AGG (reversed) Intronic
901527074 1:9830330-9830352 CTCCTAGCCATGAACAATAATGG - Intergenic
902340664 1:15781583-15781605 CTGTTAACTAAGAAGAAAAATGG + Intronic
904069914 1:27786918-27786940 ATGTTAGTGATGAAGAAAAGTGG + Intronic
906980927 1:50628473-50628495 CAGTTAAACATGAAGATAAAAGG - Intronic
907706324 1:56835663-56835685 CCCTTGGCCATGAAGGAAAAGGG + Intergenic
908149937 1:61289300-61289322 CTGGTGGCCATGAATAAAAATGG - Intronic
908954054 1:69599707-69599729 CTGCCAGCAAGGAAGAAAAAGGG - Intronic
909039792 1:70635518-70635540 CTGTTTGCGATTGAGAAAAAGGG - Intergenic
909466558 1:75979981-75980003 CTAATAGGCATGAAGGAAAATGG + Intergenic
909591151 1:77350981-77351003 CTGTCTGCCATGAAAATAAATGG - Intronic
911910408 1:103627680-103627702 TTGTTACCCATGCAGAAAACGGG + Intergenic
911917826 1:103721805-103721827 TTGTTACCCATGCAGAAAATGGG + Intronic
912160315 1:106975167-106975189 ATGTTAGACATCCAGAAAAAAGG - Intergenic
912847825 1:113092006-113092028 CTGTTAGCAAAGAATTAAAAAGG - Intronic
913142703 1:115956988-115957010 CTGTTCCCCATAAAAAAAAAAGG - Intergenic
915904782 1:159869732-159869754 GTGTTGGCAATTAAGAAAAAAGG + Intronic
916705323 1:167343318-167343340 CTATTAGTAATGAACAAAAATGG - Intronic
917290825 1:173470890-173470912 CTTTTAGCCATGACTAAAAGGGG + Intergenic
917630382 1:176885595-176885617 CTGTGAGCCAAGCAGAGAAAAGG - Intronic
918193962 1:182204148-182204170 TTGTTAGCCACTAACAAAAATGG - Intergenic
918338541 1:183546745-183546767 CTGTTTCTCATGAATAAAAAGGG - Intronic
919275497 1:195410032-195410054 CTCTCAGGCATGAAGAAGAATGG + Intergenic
919666853 1:200300736-200300758 TTGTAACCCATTAAGAAAAAAGG + Intergenic
920027303 1:203008387-203008409 TTTTCAGCCCTGAAGAAAAAAGG - Intronic
920494233 1:206442882-206442904 CTCACAGCAATGAAGAAAAAGGG - Intronic
921256133 1:213341183-213341205 CTGAGAGCCGTGAAGATAAAAGG - Intergenic
922123849 1:222702493-222702515 CTGTTAGTGATTATGAAAAATGG - Intronic
923193269 1:231641056-231641078 CTGATAGGCCTGAAGGAAAAGGG + Intronic
923774563 1:236966824-236966846 TTGTTACACATCAAGAAAAAGGG + Intergenic
923794656 1:237142302-237142324 CTGTTATTCATGGACAAAAAGGG + Intronic
1063705345 10:8424961-8424983 CTGTTAGCCAGGAAGAGAGGAGG + Intergenic
1063954556 10:11254416-11254438 GTATTAGCCAAGAAAAAAAATGG - Intronic
1064101732 10:12469845-12469867 CAATCAGCCAGGAAGAAAAAAGG - Intronic
1064826852 10:19413552-19413574 CTTTTAATCATGAAAAAAAAAGG + Intronic
1069495507 10:68900372-68900394 CTATTTGCAATGAATAAAAAAGG - Intergenic
1072026023 10:91457822-91457844 TCTTTAGCCATTAAGAAAAAGGG - Intronic
1072186464 10:93044119-93044141 CAATTAAACATGAAGAAAAAAGG - Intronic
1072436597 10:95419682-95419704 CTTTTAGTCCTGAAGAAGAAAGG + Intronic
1073638135 10:105220387-105220409 CTGATACCCAAGAAGATAAAAGG - Intronic
1074654452 10:115569116-115569138 CTGTTAGAGTTGAAGAAATATGG + Intronic
1076139001 10:128064792-128064814 GTGTGAGCAATTAAGAAAAAGGG - Intronic
1076278802 10:129227676-129227698 CTGTTAGCCAAGGTGAAATATGG + Intergenic
1076823459 10:132954209-132954231 CTGTTGGTAATTAAGAAAAATGG + Intergenic
1077901651 11:6494879-6494901 CTAATGGCCATGAAGAAAACAGG + Intronic
1078724087 11:13913026-13913048 ATGTTGGACATGAAGAAAATGGG - Intergenic
1079711508 11:23688905-23688927 CTGCTTGCCTTGAAGAAAGAAGG - Intergenic
1081379081 11:42392976-42392998 GTTTTAACCATGAAGGAAAAAGG + Intergenic
1081783158 11:45727490-45727512 CTGGTGGCCCTGAAGAAAAGGGG + Intergenic
1086368966 11:86137436-86137458 ATGTTAGCTATAAAGACAAATGG - Intergenic
1086483022 11:87265355-87265377 CTGTCATCCATGAAGAATACTGG + Intronic
1086486677 11:87310705-87310727 CTGCTAGCCATGGAGAGAGAAGG + Intronic
1087209121 11:95428269-95428291 CTGTGAGGGAAGAAGAAAAATGG - Intergenic
1087283387 11:96237761-96237783 CTGTGAGCCTTGAAGAAAGTAGG - Intronic
1088005817 11:104938605-104938627 CTGATAGCCATGAAGGATACAGG + Intergenic
1089537697 11:119170754-119170776 CTGGTGGCCAAGAAGGAAAAAGG + Intronic
1089994693 11:122894748-122894770 CTGTTATCAAAGAAAAAAAAAGG + Intronic
1090755262 11:129784948-129784970 ATGTTACCCATCTAGAAAAAAGG + Intergenic
1092390561 12:8073930-8073952 TTGTTAGCCATTAGGAGAAAAGG + Intergenic
1092607971 12:10140661-10140683 CTGTTAGCACTAAAGAAAGAAGG + Intergenic
1092856189 12:12675732-12675754 CTGATAGCCATCAAGGAAATAGG + Intronic
1093730022 12:22556636-22556658 CTGATAGCCAGGAAGGAAATGGG + Intergenic
1093832488 12:23780451-23780473 CTGATATGCATGAAGCAAAAAGG + Intronic
1094263905 12:28532887-28532909 TTATCAGCCATGAAGAAAATGGG + Intronic
1095208034 12:39460805-39460827 TTGGTAACCATGAAGAAGAATGG + Intergenic
1096558333 12:52418092-52418114 CTGTTGGGCAGGCAGAAAAATGG - Intergenic
1097854611 12:64449353-64449375 CAAGTAGCCATGAATAAAAATGG - Exonic
1100952269 12:99864339-99864361 CTTTTAGCCATGAAAATCAAAGG + Intronic
1101052274 12:100875323-100875345 CAGGAAGCCATGAAGAGAAAGGG + Intronic
1101306983 12:103538246-103538268 CTGCTAGCTGGGAAGAAAAATGG + Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1103942169 12:124507006-124507028 TTCTTAGCCATGAAGCAAAACGG - Intronic
1105236001 13:18554211-18554233 ATGTGAGACATGAAGACAAAGGG + Intergenic
1107992022 13:45827011-45827033 CTGTTAGCCATGAAGAAAAAAGG - Intronic
1108291580 13:48967231-48967253 CTGGTAGCCTTGAAGAAATGTGG + Intergenic
1108749696 13:53435923-53435945 GTTTTATCCATGAATAAAAAGGG - Intergenic
1109049104 13:57455097-57455119 AAGTTAGCCAGGAAAAAAAAGGG + Intergenic
1109590000 13:64466192-64466214 TTTTTAGACATGCAGAAAAAAGG - Intergenic
1110469206 13:75839914-75839936 CTGTTACACCTGGAGAAAAAAGG + Intronic
1111387851 13:87551700-87551722 CTGTGTGCCATGCAGAAAATGGG + Intergenic
1111456247 13:88487717-88487739 CTGCTAGCCAAGAAGGAGAAAGG - Intergenic
1113242379 13:108352360-108352382 AAGTTAGGCATGAAAAAAAAAGG + Intergenic
1113245495 13:108390379-108390401 ATGATATACATGAAGAAAAATGG - Intergenic
1114128391 14:19758746-19758768 CTGCTATCCATGCAGAAAAGAGG + Intronic
1114130216 14:19783162-19783184 CTAATATCAATGAAGAAAAAGGG + Intronic
1114303346 14:21397945-21397967 CTCATAGCCTAGAAGAAAAAGGG + Exonic
1114835797 14:26201932-26201954 CTGTTATACATGAAAATAAAAGG + Intergenic
1116028677 14:39544372-39544394 ATGTTATCCATAAAGAAAAAAGG - Intergenic
1117235026 14:53764368-53764390 CTGAGCGCCATGAAGAAAACTGG + Intergenic
1117338615 14:54775483-54775505 CTTTTTGCCATGGATAAAAAGGG - Intronic
1117550106 14:56826485-56826507 TTGTTAACCTTGAAGAAGAATGG + Intergenic
1117882942 14:60329438-60329460 CTGTGAGGCATTAAGAAACATGG + Intergenic
1118656788 14:67959567-67959589 ATGTTAGCCTTGAAAAATAATGG + Intronic
1120352488 14:83380722-83380744 TTGGTTGCCAGGAAGAAAAATGG + Intergenic
1120402822 14:84054175-84054197 CTGAAGGCCATGGAGAAAAAAGG + Intergenic
1124807079 15:32895292-32895314 CTGTCTGACATGAAGAAAAAAGG + Intronic
1125446341 15:39761610-39761632 CAGTTAGACAGGAAGAATAAGGG + Intronic
1125495762 15:40192239-40192261 GTGTTAGCTTTGCAGAAAAATGG + Intronic
1125840872 15:42800331-42800353 CTGATTGCCATAAAGAATAAGGG - Intronic
1126362717 15:47862901-47862923 CTGGAAGCCATTAAGAAAGAAGG + Intergenic
1126921987 15:53537020-53537042 CTGTTTTTCATTAAGAAAAAAGG - Intronic
1127319244 15:57826606-57826628 CTGGTAGCAATGAGGAAAATAGG - Intergenic
1127401621 15:58592574-58592596 CTGGTTCCCTTGAAGAAAAATGG + Exonic
1128618869 15:69132148-69132170 CTGTTTTTCATGAAGAAGAAGGG - Intergenic
1128799023 15:70485601-70485623 CATTTAGCCATAAAAAAAAATGG + Intergenic
1132120966 15:99175016-99175038 CTGTGAGACAGGAAGAGAAAAGG + Intronic
1134360953 16:13530690-13530712 CTGTAAGGAAGGAAGAAAAAGGG - Intergenic
1135488771 16:22888928-22888950 GTTTTAGCCAAGAAGACAAAGGG - Intronic
1139250788 16:65493459-65493481 CTGTAAGTAATTAAGAAAAAAGG - Intergenic
1140167235 16:72565121-72565143 CTGTAAGCCATGGTGAAAACTGG + Intergenic
1142662181 17:1438578-1438600 CTGTTCGCTATGAAGCAAACAGG + Intronic
1143984781 17:10902861-10902883 TTTTTAGCTATGAAGAAAAAAGG - Intergenic
1144783478 17:17819390-17819412 CTGACAGCCATGAAGACAGACGG - Exonic
1147862301 17:43530692-43530714 CTGTTAGACCTGAAAAAACAAGG - Intronic
1147930876 17:43980082-43980104 GTGTTAGAAATGAGGAAAAATGG - Intronic
1149763359 17:59253055-59253077 GTGTTTTCCATGAAAAAAAAAGG - Intronic
1154933820 18:21030111-21030133 CTGTTGGCCATTAAGGAAAGTGG - Intronic
1156167655 18:34442544-34442566 CTGCTAGTCAGGAAAAAAAAAGG - Intergenic
1156850553 18:41720739-41720761 TTTTTGGTCATGAAGAAAAATGG - Intergenic
1157283183 18:46359436-46359458 CAGTTAGCCAGGTAGAAAAAAGG + Intronic
1157607617 18:48935719-48935741 CTGGAACCCACGAAGAAAAAAGG + Intronic
1158019599 18:52826075-52826097 AGGGTAGTCATGAAGAAAAATGG - Intronic
1158840810 18:61384688-61384710 ATGTTATCCATGAAAAAAATTGG - Intronic
1159618358 18:70608503-70608525 CTGACAGCCAGCAAGAAAAATGG + Intergenic
1160241287 18:77124835-77124857 CTGGCAGCCAAGAAGGAAAAAGG + Intronic
1164748887 19:30636407-30636429 CTTTTATCCATGAAGAGACAAGG - Intronic
1168223458 19:54977738-54977760 GTGTTATCCCTGGAGAAAAAGGG - Exonic
926743578 2:16132015-16132037 CTCTTATCTATGAAAAAAAAAGG - Intergenic
927370569 2:22350260-22350282 CTATTAACTATGAAGAAACAGGG - Intergenic
927437057 2:23075774-23075796 CAGTGAGACATGAAGAAAGAGGG - Intergenic
929038116 2:37715665-37715687 GTGTTAGAAATGAAAAAAAAGGG - Intronic
931674235 2:64677842-64677864 CTGGTAGAAATGAAGCAAAATGG + Intronic
932130665 2:69184471-69184493 TTCTCAGCCATGAAGAAGAAAGG + Intronic
936553400 2:113471129-113471151 CTGTTAACTATGGGGAAAAAAGG - Intronic
936670616 2:114652033-114652055 GGGATATCCATGAAGAAAAAAGG + Intronic
936691095 2:114889804-114889826 CTGCAAAACATGAAGAAAAAGGG - Intronic
939430791 2:142104422-142104444 CTGTTTGGCATGAAGGAAACTGG + Intronic
940368596 2:152876338-152876360 GTGTTAGCCAAGAGGACAAAGGG - Intergenic
941092742 2:161197080-161197102 CAGTTACCCTTGAGGAAAAATGG + Intronic
941128791 2:161620700-161620722 CACTTAACCATTAAGAAAAAGGG - Intronic
942795761 2:179816898-179816920 TTGTTACTAATGAAGAAAAAGGG - Intronic
943927819 2:193810519-193810541 GTGTTCTCCATGAAGAAAAAAGG + Intergenic
944959128 2:204850182-204850204 CTGTTTTCCATGAAACAAAATGG - Intronic
945487784 2:210417887-210417909 CTGGTAGGGATGTAGAAAAAAGG - Intergenic
945564945 2:211386151-211386173 CTGTTAGCATAGAAGAAGAAAGG + Intronic
945627278 2:212226194-212226216 CTGTTGGCCAGTAAGAAAATGGG + Intronic
946464227 2:219897150-219897172 CAGTTAGCCTTGAACCAAAATGG + Intergenic
1169495765 20:6113429-6113451 CTGTGATCTATAAAGAAAAAAGG - Intronic
1169558974 20:6778695-6778717 CTTTTGGCCATGATGGAAAAGGG + Exonic
1169831089 20:9826092-9826114 ATGATTGCCATGAAGAAACATGG + Intronic
1170404085 20:16018316-16018338 TTTTTAGCCTTGAAAAAAAAAGG - Intronic
1170565118 20:17595933-17595955 TGGTTAACAATGAAGAAAAAAGG - Intronic
1172245387 20:33442479-33442501 CTGTTAGCGGAGAGGAAAAATGG - Intronic
1173223529 20:41147955-41147977 CTGTTTCCCAGGAAGCAAAAAGG + Intronic
1176779999 21:13182498-13182520 ATGTGAGACATGAAGACAAAGGG + Intergenic
1176993885 21:15531072-15531094 CTGTAATTTATGAAGAAAAAAGG - Intergenic
1177462259 21:21428112-21428134 CTGTTAGAGGTGAAGAGAAAGGG + Intronic
1177977655 21:27871524-27871546 ATGTGAGACATGGAGAAAAAAGG + Intergenic
1178127150 21:29527787-29527809 TTGTAACCCATGAAGAAAAGAGG + Intronic
1178360587 21:31946125-31946147 CTGCTCGCCAGGAAGAAATACGG + Exonic
1180648558 22:17359936-17359958 CTGTTGGCCTTAAAGGAAAAAGG + Intronic
1182153208 22:28045469-28045491 ATTTTACCCATGAAGAAGAAAGG - Intronic
1182894489 22:33848028-33848050 CTCCTAGTCATGAAGCAAAATGG - Intronic
1183660721 22:39219426-39219448 CTGTTACAGATGAAGAAACAAGG - Intergenic
949352887 3:3143408-3143430 CTATTAGCCATTCACAAAAATGG - Intronic
951211290 3:19977934-19977956 CTGTCTGCAATGAAGACAAAGGG - Intronic
951663547 3:25096985-25097007 CTGATAGCCAAGAATAAAAGAGG + Intergenic
951844065 3:27066436-27066458 CTGTTAGCAAAGAAGAAAGAAGG + Intergenic
951969201 3:28424166-28424188 CTATTCTCCATGAAGAAAATAGG + Intronic
952012783 3:28920086-28920108 CTGTTCTCCATGGAGCAAAATGG + Intergenic
953778870 3:45847700-45847722 CTCTGAGCCTTGAAGGAAAAAGG - Intronic
955626306 3:60923333-60923355 CTCTGAGAAATGAAGAAAAATGG - Intronic
956106909 3:65828957-65828979 CTGACAGCCAGCAAGAAAAAGGG + Intronic
956185931 3:66562030-66562052 CTGGTATCCAAGAAGAAAAGAGG + Intergenic
957169643 3:76721960-76721982 CTGTCTGCCATGAAGAAATCAGG + Intronic
957439859 3:80230951-80230973 CTGTTAGCCACACATAAAAACGG + Intergenic
957812998 3:85252716-85252738 GTGATAGACATGGAGAAAAATGG - Intronic
958593802 3:96195283-96195305 CTGCTAGCCTTGAAGATGAATGG - Intergenic
958789730 3:98637529-98637551 CTGTAATCCCAGAAGAAAAAAGG + Intergenic
961056407 3:123792686-123792708 CTGTTAGCTATGAGGATAAGAGG + Intronic
962024207 3:131529738-131529760 CTGATAGCCAGCAAGAAAACAGG + Intergenic
962298150 3:134212796-134212818 TTGTTACCCATGAATAAGAAGGG + Intronic
963060007 3:141217789-141217811 ATTATTGCCATGAAGAAAAAGGG - Intergenic
964337030 3:155665903-155665925 TGTTTAGGCATGAAGAAAAATGG + Intronic
964444831 3:156747881-156747903 TTGTTAACTAGGAAGAAAAATGG + Intergenic
964532594 3:157684420-157684442 TTGTGAGCCAAGAAGAATAAAGG - Intergenic
965448935 3:168812798-168812820 CTATTCCCAATGAAGAAAAAAGG + Intergenic
966067817 3:175837521-175837543 CTTTTGGCCTTGAAGAAGAAAGG - Intergenic
966330551 3:178807444-178807466 CTTATAGACATGATGAAAAAAGG + Exonic
966480110 3:180398212-180398234 CTCTAAGACATGAAGATAAAAGG + Intergenic
967222016 3:187255315-187255337 CTGACAGCCAGGAAGAAGAAGGG + Intronic
967668428 3:192202936-192202958 CTGATATCAATGAAGAAAAGTGG + Intronic
967702236 3:192606677-192606699 CTGTTACACAGGAAGAAACAAGG + Intronic
967826048 3:193878394-193878416 TTGTTAGCAATGAAAATAAAAGG - Intergenic
968782220 4:2591627-2591649 CTTATAAACATGAAGAAAAAAGG - Intronic
968966839 4:3773095-3773117 CTGGCAGCCATGGAGAAAAGGGG + Intergenic
969209065 4:5672374-5672396 CTTTAAGCCATGAAGAAACATGG + Intronic
972146085 4:36027432-36027454 CAATCAGCCATGAAGAAGAAAGG - Intronic
972709088 4:41575932-41575954 TTGTTCTCCAAGAAGAAAAAAGG + Intronic
972821206 4:42703955-42703977 CTCCTAGCCAAGAAGAAAATGGG + Intergenic
973220280 4:47718283-47718305 CTCTTAGCAATGAAGAAAATAGG - Intronic
974133844 4:57790072-57790094 CTGTCAGACAAGTAGAAAAATGG - Intergenic
974641562 4:64639456-64639478 CTGTTTTCCATTAAGAAAAAGGG + Intergenic
975439491 4:74394726-74394748 ATATTAGCCATGAAAGAAAATGG + Intergenic
975548351 4:75584344-75584366 CTGTTAGCCAGCAAGGAAATAGG + Intronic
975647787 4:76562546-76562568 CTATTAGCTATTAATAAAAAGGG + Intronic
976676283 4:87707413-87707435 CTGGAAGACTTGAAGAAAAAAGG - Intergenic
978685124 4:111432751-111432773 ACATTAGCCATGAAGAATAATGG - Intergenic
981485701 4:145283952-145283974 CTGTGATCAATGAAGCAAAATGG - Intergenic
981916456 4:150039210-150039232 CTGAAAGTCATGAAGAAATAGGG + Intergenic
983915524 4:173287488-173287510 GTGTTATCCATGTAGAAAAGAGG + Intronic
984079138 4:175221370-175221392 TGGTTAGCCATGAAGAATACAGG + Intergenic
985310973 4:188598421-188598443 CTGATAGACATAAAGAAAAGTGG - Intergenic
986315976 5:6586585-6586607 ATGTTGGCCAAGAAAAAAAAGGG + Intergenic
988851424 5:35184842-35184864 CTGTTACACATGAGGAAAAGGGG + Intronic
989181081 5:38577724-38577746 CTGTTACCAATGAAGATCAAGGG - Intronic
990532849 5:56690928-56690950 TTGGTTGCCAGGAAGAAAAAAGG + Intergenic
990891833 5:60659003-60659025 CCCTTAGCCATGCAGGAAAATGG - Intronic
990983342 5:61620743-61620765 AAGTTAGCCAAGAAGGAAAAGGG - Intergenic
991362605 5:65836551-65836573 CTGTTAGGAAGGAGGAAAAAGGG - Intronic
992128866 5:73670992-73671014 CCGTTAGACCTGAAAAAAAAAGG - Intronic
993029740 5:82691948-82691970 ATGTGAGATATGAAGAAAAAAGG + Intergenic
995101905 5:108321450-108321472 CTGTTTCACATGAAAAAAAATGG + Intronic
997001140 5:129763431-129763453 CTCTTACCAATGTAGAAAAATGG - Intronic
997478234 5:134161960-134161982 GTTTTAGCCATACAGAAAAATGG - Intronic
998373788 5:141678422-141678444 GAGTTAGCCATGAAGATAACTGG - Intronic
998788119 5:145734660-145734682 AAGTTAGCCATGAAAATAAATGG - Intronic
999053249 5:148546635-148546657 CAGTCAGCCAGGAAAAAAAATGG - Intronic
999910998 5:156199016-156199038 CTATTCGACATGAAGAAATAAGG + Intronic
999929234 5:156412533-156412555 CTTTTACTCATGAGGAAAAAGGG + Intronic
1000427023 5:161103203-161103225 ATGTTGACCATGAAGAAAAGTGG + Intergenic
1000702977 5:164476156-164476178 CTGTTAACCATGGGGAAGAAGGG - Intergenic
1001300450 5:170529843-170529865 CTCTTAGCCATCAAGCAATATGG + Intronic
1001720779 5:173855361-173855383 CTGTTGGCCAGGAGGGAAAAAGG - Intergenic
1002628585 5:180551707-180551729 CCATTAGCCATGTAGTAAAAAGG + Intronic
1004301403 6:14461432-14461454 CTGTTAGACACAAAGAGAAATGG - Intergenic
1005125461 6:22442014-22442036 CCCTTAGCTATTAAGAAAAAAGG + Intergenic
1005336177 6:24798847-24798869 CTGTTAGCCATTGTGTAAAAAGG + Exonic
1006334684 6:33414454-33414476 CTGGGAGAAATGAAGAAAAATGG - Intronic
1007018814 6:38497958-38497980 GTGTTAGGCATGCTGAAAAATGG + Intronic
1007460966 6:42018395-42018417 GTGTTAGCCAGGAAAAAATACGG + Intronic
1007694345 6:43722708-43722730 CTGTTAACAATGAGGAATAATGG + Intergenic
1007777986 6:44234368-44234390 CTGTTAGCCAAGACTAAGAACGG + Intergenic
1008020893 6:46575943-46575965 CTGTAATTTATGAAGAAAAAAGG + Intronic
1008366824 6:50690779-50690801 CTGTCTTCCATGAGGAAAAAAGG + Intergenic
1009279668 6:61731838-61731860 TTGTTAACTATGAAGAAAATAGG - Intronic
1009521928 6:64694248-64694270 CTTTTATCCATGAAGGAACATGG + Intronic
1009736070 6:67676828-67676850 CTGCCAGCTATGAAGAAACAGGG + Intergenic
1011200693 6:84832500-84832522 GTGTAAGCCATGAAGAAGACTGG - Intergenic
1011399277 6:86942140-86942162 CTGTTAGCATCCAAGAAAAATGG + Intronic
1012429860 6:99153055-99153077 CTGCTGGCCTTGAAGAAACAAGG + Intergenic
1013755336 6:113455169-113455191 TTGTTAGTAATGAAAAAAAAAGG + Intergenic
1014106254 6:117565847-117565869 TTGTCTTCCATGAAGAAAAATGG + Intronic
1014248395 6:119092007-119092029 CTCTTAGCAATGAGGAAAAGAGG - Intronic
1014606490 6:123480133-123480155 ATATTTGCCATAAAGAAAAATGG - Intronic
1015356983 6:132289596-132289618 CTGTTAAGCATAAAAAAAAAAGG + Intergenic
1016189165 6:141239655-141239677 CTGTTATCCATGAGAAAAAATGG + Intergenic
1016240873 6:141929029-141929051 CTGTAAGCCAAGAAGGGAAATGG - Intergenic
1016631507 6:146238517-146238539 TTTTTAGAAATGAAGAAAAAGGG + Intronic
1016753908 6:147662434-147662456 ATCTTAGAAATGAAGAAAAATGG + Intronic
1016885176 6:148952603-148952625 GTGTTAGACATGAAGGAACAAGG + Intronic
1017247791 6:152245833-152245855 CTTTTACCCGGGAAGAAAAAGGG - Intronic
1017315484 6:153026516-153026538 CTGTGAGGAATGAAGAAAGAGGG - Exonic
1017665391 6:156715441-156715463 CTTTTACCCATTAAAAAAAATGG - Intergenic
1018251016 6:161870330-161870352 CTGTGGGTCATGAAGAAAAGGGG + Intronic
1018257003 6:161930857-161930879 CTGTTGGCCATGAGGATGAAAGG + Intronic
1018706253 6:166465403-166465425 AGGTTAGCCATGAAGACACATGG + Intronic
1020695888 7:11413787-11413809 GTGTTAGACATGCAAAAAAATGG - Intronic
1020854061 7:13395009-13395031 CTGTTAGCTATTATGAAAATTGG + Intergenic
1020909791 7:14114624-14114646 CTGTTAGCCACGTTGAAAAAGGG - Intergenic
1020999826 7:15315012-15315034 CTGATAGCCCGCAAGAAAAATGG + Intronic
1021181887 7:17516826-17516848 CTATTCACTATGAAGAAAAAAGG - Intergenic
1021714976 7:23453242-23453264 CTTTTAAACAAGAAGAAAAAAGG + Intronic
1021853460 7:24831118-24831140 CTTTTAGGCATCAAGATAAATGG - Intronic
1022071467 7:26919570-26919592 CTGTTGGACATGAAAAAAAGAGG + Intronic
1022513801 7:30962818-30962840 TTGTTGACAATGAAGAAAAATGG + Intronic
1022837984 7:34135191-34135213 CTGTGAATCATGAACAAAAATGG + Intronic
1023238217 7:38113661-38113683 CTGTTAGACCAGAGGAAAAAAGG - Intergenic
1023514138 7:40983783-40983805 ATGTTAGCAATGGAGAAACAAGG + Intergenic
1024217479 7:47259570-47259592 CTGGTAGCCAGGATGCAAAAGGG + Intergenic
1024238608 7:47416410-47416432 CTGTTAAACATTAACAAAAAAGG + Intronic
1024448595 7:49512360-49512382 CTGCTGGCCTTGAAGAAATAAGG - Intergenic
1024483554 7:49890632-49890654 CTTTTAGCCATGATGGAACAGGG + Intronic
1024710442 7:52009423-52009445 CTGCTTGCCAAGTAGAAAAAGGG + Intergenic
1026733620 7:72933466-72933488 CTGGTAGCCCTTCAGAAAAATGG - Intronic
1026783903 7:73288019-73288041 CTGGTAGCCCTTCAGAAAAATGG - Intergenic
1027110413 7:75434154-75434176 CTGGTAGCCCTTCAGAAAAATGG + Intronic
1027864724 7:83631163-83631185 ATTTTAGCCATGAAGAAAGACGG + Intronic
1027876772 7:83780560-83780582 CGAGGAGCCATGAAGAAAAATGG - Intergenic
1028107320 7:86894099-86894121 CAGTTAGTCATGAAGTGAAAGGG + Intronic
1028701506 7:93786292-93786314 CTGTTAGCCAGGAAAAAATTGGG - Intronic
1030838459 7:114317943-114317965 GAGTTAGCCATGCAGATAAATGG - Intronic
1030849520 7:114465818-114465840 CACTTAGCCATGAAGAACAAGGG - Intronic
1031272494 7:119669974-119669996 CTGTAAGCCAAAGAGAAAAAAGG - Intergenic
1031600070 7:123697187-123697209 TTATTAGTCAAGAAGAAAAAGGG + Intronic
1032169333 7:129571440-129571462 TTTTTAGCCAGGAGGAAAAATGG - Intergenic
1033812161 7:145028278-145028300 CTGATAGCCATGGAGAATACAGG + Intergenic
1035682655 8:1499621-1499643 CTGTTAGCCTTGAAGAAATGGGG + Intergenic
1036686651 8:10916079-10916101 CTGTGAGCCATGGAGAAGGAGGG + Intronic
1038554666 8:28500107-28500129 CAGTGAGACATGAAGAAAACAGG - Intronic
1039173922 8:34781944-34781966 CTGTTTTCCATGCAGAAAAGTGG + Intergenic
1039224240 8:35370612-35370634 CTGTTAGCTATAGAAAAAAAAGG + Intronic
1039445158 8:37625224-37625246 ATGTTAGCCATGAGGCAACATGG - Intergenic
1041113758 8:54513377-54513399 CTGTTGGCTTTGAAGAAGAAAGG + Intergenic
1041503826 8:58571435-58571457 CTCTGAACCTTGAAGAAAAAGGG - Intronic
1042104865 8:65315647-65315669 CTGATAGCCAGCAAGAAAACAGG - Intergenic
1042471149 8:69189428-69189450 CTGTTAGCAAATAACAAAAAGGG - Intergenic
1043176781 8:77031223-77031245 TTGTAAGCCATGAAGCCAAATGG + Intergenic
1043580634 8:81708704-81708726 CTGGAAACCATGGAGAAAAAGGG + Intronic
1043654986 8:82652215-82652237 ATGTTAGCAATAAATAAAAAGGG + Intergenic
1043752428 8:83954975-83954997 CTTTTATCCAGGAAGAACAAAGG - Intergenic
1043981052 8:86639997-86640019 CTGTGAGTGATTAAGAAAAATGG + Intronic
1044008478 8:86964588-86964610 CTGTAAGCCCTGAAGAGAAAAGG + Intronic
1044934587 8:97280659-97280681 CTCTTTGACATGATGAAAAAAGG - Intergenic
1045112073 8:98945484-98945506 CTGTTAGCCGAGAACAAAAGGGG + Intronic
1045148137 8:99371165-99371187 GTGTTAGCCATGTAACAAAATGG - Intronic
1045308470 8:100979963-100979985 CTATCAGCCATGAAGAGAAGTGG + Intergenic
1046926083 8:119790557-119790579 ATGTTAACAATGAAAAAAAATGG + Intronic
1047691399 8:127358425-127358447 CTGTTAGGCTAGAAGTAAAATGG - Intergenic
1048800738 8:138191724-138191746 CTTTTTGCCACGAAGACAAAAGG + Intronic
1049899602 9:146040-146062 CTGTTAACTATGGGGAAAAAAGG + Intronic
1050072699 9:1833163-1833185 CAGTCAGCCATGCAGAACAAAGG - Intergenic
1052955391 9:34249923-34249945 CTCAGAGCCATGAAGAAGAAAGG + Exonic
1053742653 9:41156321-41156343 CTGTTAACTATGGGGAAAAAAGG + Intronic
1054347925 9:63986166-63986188 CTGTTAACTATGGGGAAAAAAGG + Intergenic
1054445653 9:65312509-65312531 CTGTTAACTATGGGGAAAAAAGG + Intergenic
1054484617 9:65708998-65709020 CTGTTAACTATGGGGAAAAAAGG - Intronic
1054685690 9:68274978-68275000 CTGTTAACTATGGGGAAAAAAGG - Intronic
1054867265 9:70015207-70015229 TTGGAAGCCATGAAGAAACAGGG - Intergenic
1055268020 9:74520884-74520906 CTGTTAGACATGAAAATAAATGG + Intronic
1055550844 9:77431112-77431134 CTGTTACCCTTGGAGAAAAAGGG - Intronic
1056022561 9:82455806-82455828 CTGATTGCTATGAGGAAAAAAGG - Intergenic
1057886675 9:98834885-98834907 CAGTTAGCCAAGAAGAAGAAGGG - Intronic
1059356107 9:113700705-113700727 CTGTGTGCCAAGAAGAAAGATGG + Intergenic
1059670508 9:116486747-116486769 TTGTTAGCCTGGAAGAGAAAAGG - Intronic
1061769001 9:132903211-132903233 CTGTTAGCCATGCTATAAAATGG - Intronic
1186108192 X:6227871-6227893 CTGTTAACCAGAAAGAAAAAGGG - Intronic
1187680466 X:21762025-21762047 CTCTTAGCAATGAAGAAGAAAGG + Intergenic
1188416835 X:29945411-29945433 ATGATAGCCATGAATAAAGAAGG - Intronic
1190128104 X:47723688-47723710 CTGTTTGCCATGCAGAATGATGG - Intergenic
1192201341 X:69068575-69068597 CTGTGGGCCCTGAAGGAAAAAGG - Intergenic
1192728854 X:73781835-73781857 CATTTAGCCATGCAGAAAACAGG - Intergenic
1192854378 X:74992994-74993016 TAGTCAGCCATGAACAAAAAGGG + Intergenic
1193069955 X:77296811-77296833 CTGTCCCCCAAGAAGAAAAATGG + Intergenic
1193923896 X:87462805-87462827 CTGACAGCCAGGTAGAAAAATGG + Intergenic
1194737739 X:97533430-97533452 CTGTTAAATATGAAGAAAACTGG + Intronic
1195777701 X:108425957-108425979 CTGTTGATAATGAAGAAAAATGG - Intronic
1196046289 X:111259715-111259737 CTGTCAGCTGTGAGGAAAAAAGG - Intronic
1196109783 X:111933535-111933557 ATGGTAACCATGAAGAAAGAGGG + Intronic
1196593127 X:117511769-117511791 ATGATTGCTATGAAGAAAAATGG - Intergenic
1196789928 X:119455380-119455402 CTGTCAGCCATAAAGCAGAAAGG - Intergenic
1198696504 X:139345303-139345325 CAGGTAGACAGGAAGAAAAAAGG - Intergenic
1198789833 X:140332477-140332499 CTGTTGGGGATGTAGAAAAAAGG - Intergenic
1198864781 X:141110116-141110138 CTGTTTCCCATGAATAAATAAGG + Intergenic
1199906028 X:152231818-152231840 ATGTTAATCATCAAGAAAAAAGG + Intronic