ID: 1107994255

View in Genome Browser
Species Human (GRCh38)
Location 13:45845429-45845451
Sequence GGCCATCTGAAACACCGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107994255_1107994257 -6 Left 1107994255 13:45845429-45845451 CCATCACGGTGTTTCAGATGGCC 0: 1
1: 0
2: 2
3: 9
4: 83
Right 1107994257 13:45845446-45845468 ATGGCCACAGTTATAAAGCTGGG 0: 1
1: 6
2: 24
3: 47
4: 208
1107994255_1107994256 -7 Left 1107994255 13:45845429-45845451 CCATCACGGTGTTTCAGATGGCC 0: 1
1: 0
2: 2
3: 9
4: 83
Right 1107994256 13:45845445-45845467 GATGGCCACAGTTATAAAGCTGG 0: 1
1: 6
2: 28
3: 33
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107994255 Original CRISPR GGCCATCTGAAACACCGTGA TGG (reversed) Intronic
915488599 1:156239159-156239181 GCCCATGTCAAACAACGTGAGGG - Intronic
915830455 1:159124726-159124748 GGACCTCTGAAACACTGGGAAGG - Intronic
918783301 1:188731360-188731382 TGCCATGTAGAACACCGTGATGG + Intergenic
920147849 1:203878013-203878035 TGCCATTTGAAACAATGTGAAGG - Intergenic
921480764 1:215662216-215662238 GGCCATCTGAAGAGCCATGAGGG + Intronic
921662354 1:217819843-217819865 GGCCAGCTAAAACTCCTTGAAGG + Intronic
1062960792 10:1572470-1572492 GTCCATCTGAATGACTGTGAGGG + Intronic
1065380064 10:25081083-25081105 AGCCATCTGAAATACAATGACGG - Intergenic
1067278467 10:44854020-44854042 GGCCAGCGGAAGCCCCGTGAAGG + Intergenic
1069382666 10:67856599-67856621 GGCAATCTCAAACATAGTGATGG - Intergenic
1069663626 10:70140050-70140072 GGCCGGCTGGAGCACCGTGATGG + Exonic
1075082155 10:119391377-119391399 ACCCATCTGAAGCACCGTGCAGG + Intronic
1075284865 10:121174766-121174788 GCCCATCTCAAACACAGTCACGG + Intergenic
1076409108 10:130233290-130233312 AGCCACCTGAAATACCGTAAGGG + Intergenic
1084891117 11:72237603-72237625 GGCCATCTGCAGCACCGAGCAGG - Exonic
1088097370 11:106116330-106116352 TGCCATGTGAAACACCATGATGG - Intergenic
1091671911 12:2457973-2457995 GGCCATCTGAGCCACCCTGGAGG + Intronic
1093653421 12:21669807-21669829 AGTCATCTGAAGTACCGTGAAGG - Intronic
1099980010 12:89588172-89588194 AGCCAACTGAGATACCGTGATGG - Exonic
1103145713 12:118594026-118594048 GATCATCTGAAATACCATGACGG - Intergenic
1103254700 12:119531083-119531105 GGACACCTGAAACACTGTGGAGG - Intronic
1107392647 13:39983081-39983103 GGCCATCTGAAACTGCGCAAGGG + Intergenic
1107994255 13:45845429-45845451 GGCCATCTGAAACACCGTGATGG - Intronic
1108224315 13:48272048-48272070 GGTCATCTGAAATACCATGATGG + Intergenic
1109175057 13:59144880-59144902 GGCCTTCTGAAACACATTGCTGG - Intergenic
1109329389 13:60909374-60909396 GGCCATCTGCCATACAGTGAAGG + Intergenic
1112585746 13:100716901-100716923 TGCCATCTGAAACAGAGAGAAGG + Intergenic
1113014669 13:105815032-105815054 GTACATCTGAGACACCCTGAAGG - Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1114589847 14:23852522-23852544 AGTCATCTGAAATACTGTGAAGG - Intergenic
1114643885 14:24242702-24242724 GGCCTTCTGACGCACCGTCACGG - Intergenic
1115478703 14:33840942-33840964 GGCCATGTGAGGCACTGTGAGGG - Intergenic
1120256294 14:82123686-82123708 TGCCATTTGAAACACAGTCAGGG - Intergenic
1121447268 14:93987138-93987160 GGCCAGCTGGAACACCAGGAGGG - Intergenic
1125539062 15:40459312-40459334 GGCCATCTGCAACTCCTTGTGGG + Exonic
1125956761 15:43795711-43795733 GGGCAGCAGAAACACAGTGAGGG + Exonic
1126683298 15:51225027-51225049 GGCCATCTAAAGCACATTGAGGG - Intronic
1129173930 15:73825996-73826018 GGTCATCTTAAGGACCGTGATGG - Intergenic
1129743153 15:77999980-78000002 GGCCTTCAGAAACACAGGGAGGG - Intronic
1129842329 15:78751460-78751482 GGCCTTCAGAAACACAGGGAGGG + Intergenic
1130802041 15:87275104-87275126 TGACATCTGGAACACCGTCAAGG + Intergenic
1135957594 16:26968955-26968977 AGTCATCTGAAATACCATGATGG - Intergenic
1136011032 16:27363516-27363538 GGCCACCTGAAACAGTGTCATGG + Exonic
1144236584 17:13267135-13267157 GGCATTCTTAAACACCGTGTTGG + Intergenic
1150846435 17:68663432-68663454 TCCCATCTGGAACACTGTGATGG + Intergenic
1151394464 17:73813048-73813070 GGCCATCTGAAAGTTCCTGATGG + Intergenic
1152260244 17:79262898-79262920 GGCCACCTGAAACAAGGAGAAGG - Intronic
1153920391 18:9783924-9783946 GGCCATCTCATACACCATTATGG + Intronic
1155178674 18:23324210-23324232 AGCCATCTGAAACCCCAGGAGGG + Intronic
1157097151 18:44696357-44696379 GGCCATCAGAACCACTGAGAGGG + Intronic
1159661362 18:71099327-71099349 AGTCATCTGAAATACTGTGATGG - Intergenic
1159900474 18:74040187-74040209 GGCCCTGTGAATCACAGTGAGGG - Intergenic
1160451855 18:78971789-78971811 GGCCATGTGGAACCCTGTGATGG - Intergenic
1160976799 19:1796738-1796760 GGCCATCTGCCACACGGTGATGG - Exonic
927171757 2:20376164-20376186 GGTCATCTGAAATACTGTGATGG + Intergenic
930668835 2:54126354-54126376 GGTCATCTGACATACCTTGATGG + Intronic
932587866 2:73043467-73043489 TGGCATGTGAAACACCGTGGTGG + Intronic
938251714 2:129820993-129821015 AGCCATCGGAGACACCTTGATGG - Intergenic
943451395 2:188046168-188046190 GGCCATCTCAAACAGCTTCAGGG + Intergenic
1170114953 20:12847394-12847416 GGACATCTGAAACATCCTAAGGG - Intergenic
1182979951 22:34659788-34659810 AGTCATCTGAAATACCATGATGG + Intergenic
1184084370 22:42250611-42250633 GGTCCTCTGAAATACCATGATGG - Intronic
1184499186 22:44861663-44861685 GGCCATGTGGACCAACGTGAGGG - Intronic
950965465 3:17142931-17142953 GGCCATCTGAAACACTCTCGAGG - Intergenic
953826524 3:46256766-46256788 AGTCATCTGAAATACTGTGATGG + Intronic
956007454 3:64796259-64796281 GCCCATCTGAAACACTGAGTTGG + Intergenic
969978461 4:11128876-11128898 AGTCATCTGAAATACCATGATGG + Intergenic
972423098 4:38908074-38908096 AACCATCTGAAACAGCCTGAGGG + Intronic
976254525 4:83085989-83086011 GGTCATCTGAAATACCAAGATGG + Intergenic
977726982 4:100307364-100307386 GGGCATCTGAAAAACCTTGTGGG - Intergenic
986310445 5:6547151-6547173 GGCCATCTGAGACTCAGTGCAGG + Intergenic
987276590 5:16369740-16369762 GGCCATCTGAAACTGCGTCTTGG - Intergenic
987390371 5:17369649-17369671 GACCAACTGAAACACAATGAAGG - Intergenic
987931332 5:24402518-24402540 CGGCCTCTGAAACACCCTGAGGG + Intergenic
989860259 5:46364906-46364928 GGACATTTGGAACACTGTGAGGG - Intergenic
992300533 5:75374579-75374601 CGTCATTTGAAACACAGTGAAGG + Intronic
1000382776 5:160644162-160644184 CACCATCAGAAACACCGAGATGG - Exonic
1008836093 6:55832325-55832347 AGCCAACTGAAACATGGTGAGGG - Intronic
1010566103 6:77416156-77416178 GGTCTTCTGAAATACCCTGAGGG - Intergenic
1017262514 6:152403320-152403342 TGCCATCTGAAGGGCCGTGAAGG + Intronic
1019008173 6:168821040-168821062 GGGCATCTGGAACACCGTGAGGG - Intergenic
1019870920 7:3760266-3760288 GGTCATCTGAAATACCATGACGG - Intronic
1024262539 7:47582792-47582814 GGCCATCTGAATCTCAGGGATGG - Intergenic
1032188370 7:129747290-129747312 TCCCTTCTGAAACACAGTGATGG - Intronic
1040935194 8:52775163-52775185 GGCCATCTTAAACATCTTGCTGG + Intergenic
1045812038 8:106232900-106232922 GGTCACCTGAAACACCATGATGG - Intergenic
1047038225 8:120963537-120963559 GGTCATCTGAAATACCATGATGG + Intergenic
1049155612 8:141064772-141064794 GGTCATCTGAAATACCCTGACGG - Intergenic
1050682624 9:8131248-8131270 GGTCATCTGAAATACCGTGATGG - Intergenic
1051746110 9:20296712-20296734 GGTCATCTGAAATACCATGATGG - Intergenic
1054344700 9:63902474-63902496 GGTCATCTGGAATACTGTGACGG + Intergenic
1061973556 9:134057215-134057237 GGCCAGCTGAAAATCAGTGATGG + Intronic
1188648353 X:32597037-32597059 GTCATTCTGAAACACTGTGAGGG - Intronic
1195645989 X:107231157-107231179 TGTCATTTGAAACAACGTGATGG + Intronic
1201947615 Y:19528706-19528728 TGCCATCAGAAACACCATTATGG - Intergenic