ID: 1107995084

View in Genome Browser
Species Human (GRCh38)
Location 13:45851383-45851405
Sequence CCCGAGACCCGGGTTTGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107995074_1107995084 2 Left 1107995074 13:45851358-45851380 CCGGGTTCCAGACACCGTCCCAG 0: 1
1: 0
2: 0
3: 19
4: 214
Right 1107995084 13:45851383-45851405 CCCGAGACCCGGGTTTGCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 49
1107995075_1107995084 -5 Left 1107995075 13:45851365-45851387 CCAGACACCGTCCCAGCCCCCGA 0: 1
1: 0
2: 1
3: 17
4: 264
Right 1107995084 13:45851383-45851405 CCCGAGACCCGGGTTTGCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 49
1107995073_1107995084 16 Left 1107995073 13:45851344-45851366 CCGAGGCAAACACGCCGGGTTCC 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1107995084 13:45851383-45851405 CCCGAGACCCGGGTTTGCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107995084 Original CRISPR CCCGAGACCCGGGTTTGCAA AGG Intronic
900238185 1:1602262-1602284 GCCGGGACCCTGGGTTGCAATGG - Intergenic
900354216 1:2252287-2252309 CCCAAGACCAGGGTTTGCTGTGG + Intronic
900720402 1:4172227-4172249 CCTGAGAACCAGGTTTGCCAGGG - Intergenic
902730508 1:18365728-18365750 CCCCACACCCAGGTCTGCAAGGG - Intronic
905169200 1:36099416-36099438 CCCGAGGCCCGGGCTTCCCAGGG + Exonic
1075702425 10:124478109-124478131 CCCAAGCCCCGGGCTTGCAGAGG + Intronic
1076841382 10:133047567-133047589 CCCGAGGGCCGGGTGTGCACTGG - Intergenic
1077360630 11:2138939-2138961 CCCGAGGCCCGGGCTCGCGACGG - Intronic
1092946914 12:13465197-13465219 CCTGAAAACCGGGTTTGGAAAGG + Intergenic
1107995084 13:45851383-45851405 CCCGAGACCCGGGTTTGCAAAGG + Intronic
1115851368 14:37592562-37592584 CCCTAGGCCCGGGTTGGCATAGG + Exonic
1131527915 15:93167337-93167359 TGCGTGACCAGGGTTTGCAAAGG + Intergenic
1137760815 16:50938979-50939001 CCAGTGACCCAGGTTTCCAAGGG - Intergenic
1139873298 16:70124940-70124962 CCAAAGACCCAGTTTTGCAAGGG - Intronic
1140362484 16:74356364-74356386 CCAAAGACCCAGTTTTGCAAGGG + Intergenic
1142982306 17:3679370-3679392 CCCGAGACCCTGGATGGCCATGG - Intronic
1146182778 17:30708456-30708478 CCCGGGACCTGGGTTCGCATGGG - Intergenic
1152563683 17:81090868-81090890 CCCGCTGGCCGGGTTTGCAAAGG - Intronic
1159743335 18:72200461-72200483 TCCGAGACCCAGGTATGCAATGG + Intergenic
1160571011 18:79817870-79817892 CCCGAGACCTGGGCTTCCACGGG - Intergenic
1164932791 19:32188111-32188133 ACAGAGACCCCTGTTTGCAATGG - Intergenic
1166214646 19:41327465-41327487 CCTGGGACCCGGGTCAGCAAGGG - Intronic
929544340 2:42846036-42846058 CCTGAAACCCGGGTCTGCAGGGG - Intergenic
935735592 2:106104418-106104440 CCCGCGAGCCATGTTTGCAATGG + Intronic
1176306495 21:5126264-5126286 CCCCATACCCCAGTTTGCAAAGG - Intronic
1177724870 21:24954746-24954768 CCCTAGACCCTGTTTTACAAGGG + Intergenic
1179850564 21:44135766-44135788 CCCCATACCCCAGTTTGCAAAGG + Intronic
1182781854 22:32874672-32874694 CCCAAGAGCCAGGTTGGCAAAGG + Intronic
1183100766 22:35582716-35582738 CCAGAGATCTGGGTCTGCAATGG - Intergenic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
952676160 3:36032639-36032661 CCGGAATCCCTGGTTTGCAATGG - Intergenic
960026728 3:113019199-113019221 CCGAAGACCCGGGTGAGCAAGGG + Intronic
960439698 3:117671554-117671576 CCTAAGACTTGGGTTTGCAATGG - Intergenic
961555056 3:127691593-127691615 CCTGAGACCAGGCTTTGCAGAGG - Exonic
961812500 3:129529965-129529987 CCCGTCACCCAGCTTTGCAATGG - Intronic
962564707 3:136645935-136645957 CCTGAGACTTGGGTTTGCAGTGG - Intronic
966665773 3:182469532-182469554 CCCTACACCCGTGTTTACAATGG - Intergenic
974483815 4:62480185-62480207 CCTGGGACCAGGGTTTACAAGGG + Intergenic
982126518 4:152188546-152188568 CCCAAGACCAGGGTTCACAAAGG - Intergenic
984902226 4:184595719-184595741 GCCGAGACCCTGTTTTCCAATGG - Intergenic
1009242720 6:61200618-61200640 CCCGGGACCCAGGATGGCAATGG + Intergenic
1009413387 6:63392253-63392275 CCCTAGGCCAGGGTTTGCCATGG - Intergenic
1012252290 6:96992229-96992251 CCCGGGACCCAGGGTTGCAAAGG + Intronic
1013233351 6:108175964-108175986 CCCGAGCCCCGGGATTGCTAGGG - Intronic
1015618689 6:135106792-135106814 CCCGAGGCCCGTGTTTGCGATGG - Intergenic
1019170449 6:170130626-170130648 CCGGAGACACTGGTTAGCAATGG + Intergenic
1050685905 9:8169125-8169147 CCGGAGAACCGTTTTTGCAAAGG - Intergenic
1051262079 9:15274477-15274499 CCCCATAACTGGGTTTGCAAAGG + Intronic
1053414438 9:37938189-37938211 CCTGAGGCCCAGATTTGCAATGG - Intronic
1056617419 9:88180457-88180479 CCCCAGACACGGGTTTCCCATGG + Intergenic
1060534328 9:124371662-124371684 CCTGAGACCCAAGTTAGCAAAGG + Intronic
1185486105 X:482856-482878 CCCGAGTCCCCGGTTCACAAAGG - Intergenic
1197010644 X:121558519-121558541 CCAGAGAACCTGATTTGCAAAGG + Intergenic
1199699333 X:150364436-150364458 CCCGAGGCGCGTGTTTGCACAGG - Intronic