ID: 1107998820

View in Genome Browser
Species Human (GRCh38)
Location 13:45888157-45888179
Sequence CCTCATCTGCAAAAGAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107998820_1107998827 29 Left 1107998820 13:45888157-45888179 CCATCCCTCTTTTGCAGATGAGG No data
Right 1107998827 13:45888209-45888231 TCCACAGTCTTTTGACCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107998820 Original CRISPR CCTCATCTGCAAAAGAGGGA TGG (reversed) Intergenic
No off target data available for this crispr