ID: 1107998827

View in Genome Browser
Species Human (GRCh38)
Location 13:45888209-45888231
Sequence TCCACAGTCTTTTGACCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107998822_1107998827 25 Left 1107998822 13:45888161-45888183 CCCTCTTTTGCAGATGAGGCCCG No data
Right 1107998827 13:45888209-45888231 TCCACAGTCTTTTGACCTTTTGG No data
1107998820_1107998827 29 Left 1107998820 13:45888157-45888179 CCATCCCTCTTTTGCAGATGAGG No data
Right 1107998827 13:45888209-45888231 TCCACAGTCTTTTGACCTTTTGG No data
1107998826_1107998827 5 Left 1107998826 13:45888181-45888203 CCGGAAAAGTTCAGTGATTTGCT No data
Right 1107998827 13:45888209-45888231 TCCACAGTCTTTTGACCTTTTGG No data
1107998823_1107998827 24 Left 1107998823 13:45888162-45888184 CCTCTTTTGCAGATGAGGCCCGG No data
Right 1107998827 13:45888209-45888231 TCCACAGTCTTTTGACCTTTTGG No data
1107998825_1107998827 6 Left 1107998825 13:45888180-45888202 CCCGGAAAAGTTCAGTGATTTGC No data
Right 1107998827 13:45888209-45888231 TCCACAGTCTTTTGACCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107998827 Original CRISPR TCCACAGTCTTTTGACCTTT TGG Intergenic
No off target data available for this crispr