ID: 1108000636

View in Genome Browser
Species Human (GRCh38)
Location 13:45902669-45902691
Sequence CTTAATACTCAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108000636_1108000639 18 Left 1108000636 13:45902669-45902691 CCCAGCTCCATCTGAGTATTAAG No data
Right 1108000639 13:45902710-45902732 TAGAAAGCCTCTGACTGTGCTGG No data
1108000636_1108000641 20 Left 1108000636 13:45902669-45902691 CCCAGCTCCATCTGAGTATTAAG No data
Right 1108000641 13:45902712-45902734 GAAAGCCTCTGACTGTGCTGGGG No data
1108000636_1108000642 21 Left 1108000636 13:45902669-45902691 CCCAGCTCCATCTGAGTATTAAG No data
Right 1108000642 13:45902713-45902735 AAAGCCTCTGACTGTGCTGGGGG No data
1108000636_1108000640 19 Left 1108000636 13:45902669-45902691 CCCAGCTCCATCTGAGTATTAAG No data
Right 1108000640 13:45902711-45902733 AGAAAGCCTCTGACTGTGCTGGG No data
1108000636_1108000644 25 Left 1108000636 13:45902669-45902691 CCCAGCTCCATCTGAGTATTAAG No data
Right 1108000644 13:45902717-45902739 CCTCTGACTGTGCTGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108000636 Original CRISPR CTTAATACTCAGATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr