ID: 1108000640

View in Genome Browser
Species Human (GRCh38)
Location 13:45902711-45902733
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108000637_1108000640 18 Left 1108000637 13:45902670-45902692 CCAGCTCCATCTGAGTATTAAGA No data
Right 1108000640 13:45902711-45902733 AGAAAGCCTCTGACTGTGCTGGG No data
1108000634_1108000640 27 Left 1108000634 13:45902661-45902683 CCACCGCACCCAGCTCCATCTGA No data
Right 1108000640 13:45902711-45902733 AGAAAGCCTCTGACTGTGCTGGG No data
1108000638_1108000640 12 Left 1108000638 13:45902676-45902698 CCATCTGAGTATTAAGAAAGAAT No data
Right 1108000640 13:45902711-45902733 AGAAAGCCTCTGACTGTGCTGGG No data
1108000635_1108000640 24 Left 1108000635 13:45902664-45902686 CCGCACCCAGCTCCATCTGAGTA No data
Right 1108000640 13:45902711-45902733 AGAAAGCCTCTGACTGTGCTGGG No data
1108000636_1108000640 19 Left 1108000636 13:45902669-45902691 CCCAGCTCCATCTGAGTATTAAG No data
Right 1108000640 13:45902711-45902733 AGAAAGCCTCTGACTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108000640 Original CRISPR AGAAAGCCTCTGACTGTGCT GGG Intergenic
No off target data available for this crispr