ID: 1108003795

View in Genome Browser
Species Human (GRCh38)
Location 13:45927702-45927724
Sequence GGCCTAAAGAGACCAAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108003793_1108003795 -4 Left 1108003793 13:45927683-45927705 CCTAGTCTAATCTGTTGAAGGCC No data
Right 1108003795 13:45927702-45927724 GGCCTAAAGAGACCAAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108003795 Original CRISPR GGCCTAAAGAGACCAAAAGG TGG Intergenic
No off target data available for this crispr